A549 stable expression cell line constructed based on dCas9-VP64 transcription activation system and application thereof

By introducing dCas9-VP64 fusion protein and MS2-P65-HSF1 fusion protein into lung cancer cells and combining them with sgRNA targeting the LTR5Hs sequence, the expression of the LTR5Hs sequence in lung cancer cells is activated, which solves the problem of low activation efficiency in existing technologies and achieves a significant reduction in the proliferation rate of lung cancer cells and the discovery of therapeutic targets.

CN116240243BActive Publication Date: 2026-07-03ACADEMY OF MILITARY MEDICAL SCIENCES

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ACADEMY OF MILITARY MEDICAL SCIENCES
Filing Date
2023-03-16
Publication Date
2026-07-03

Smart Images

  • Figure HDA0004129248340000011
    Figure HDA0004129248340000011
  • Figure HDA0004129248340000012
    Figure HDA0004129248340000012
  • Figure HDA0004129248340000013
    Figure HDA0004129248340000013
Patent Text Reader

Abstract

This invention discloses a stable A549 expression cell line constructed based on a dCas9-VP64 transcriptional activation system and its applications. Based on the dCas9-VP64 transcriptional activation system, this invention yielded a stable A549 expression cell line with the highest relative expression level of dCas9 protein after puromycin selection. Subsequently, by introducing sgRNAs targeting one or more genes into this cell line, the expression of endogenous genes in lung cancer cells can be activated, and related functional gene studies can be conducted. Furthermore, this invention prepares an A549 cell line with significantly reduced proliferation rate by introducing sgRNA targeting the TP53 binding site in the LTR5Hs sequence into this cell line. This invention is the first to discover a novel target for lung cancer treatment, which is of great significance for the treatment and mechanistic research of lung cancer.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to an A549 stable expression cell line constructed based on the dCas9-VP64 transcriptional activation system and its applications. Background Technology

[0002] CRISPR-Cas is an RNA-mediated adaptive immune system found in bacteria and archaea, protecting host cells from foreign DNA invasion. Based on the different Cas protein sequence structures, CRISPR-Cas systems are mainly divided into three types: I, II, and III. Types I and III require multiple Cas proteins to cleave foreign DNA, making the process more complex. Type II systems, however, require only one protein to complete the cleavage, making them relatively simpler, faster, and more efficient, and are the most widely used in genome engineering.

[0003] Point mutations in the D10A and H840A amino acids of the HNH and RuvC domains of the Cas protein yield a cleavage-inactivated Cas9 protein. The resulting nuclease-deficient dCas9 cannot cleave DNA, but it can still specifically bind to DNA under the guidance of sgRNA. Based on this, researchers fused different transcriptional regulation-related factors, using the dCas9-sgRNA complex as a scaffold, to recruit a series of transcriptional effectors to target sites to activate or inhibit the transcriptional expression of target genes, thereby playing a crucial role in regulating gene expression.

[0004] The recruitment of transcription activators by dCas9 fusion proteins to mediate gene activation is called CRISPRa (CRISPRactivation). In *E. coli*, dCas9 fuses with the ω subunit of Pol. Guided by specific sgRNA, Pol is aggregated upstream of the promoter, assembling a holoenzyme at the target promoter for gene activation, thereby activating transcription. In eukaryotic cells, CRISPRa technology has undergone a series of upgrades, from basic transcriptional activation (VP64, p65) to enhanced transcriptional activation Sun Tag (dCas9-VPR) systems and then to the co-activation mediator system (SAM system).

[0005] The fusion of VP64 (the synthetic tetramer of herpes simplex virus protein 16) or the p65 activation domain (p65AD, the activation domain of nuclear factor kappa B) with dCas9 can activate reporter genes and endogenous genes. With the continuous development of CRISPRa fusion proteins, researchers have optimized the structure of the CRISPR-dCas9 system for gene transcription activation to a trigonometric activator domain VPR (VP64-p65-Rta), composed of VP64, p65AD, and the Epstein-Barr virus R transactivator Rta. Using multiple sgRNAs for targeting, this system can further enhance the activation efficiency of endogenous genes and has been successfully applied in Saccharomyces cerevisiae, Drosophila melanogaster, and mouse cells.

[0006] Besides engineering dCas9, engineering sgRNA can also improve gene activation efficiency. By introducing two MS2 hairpin loops that bind to the MS2 phage capsid protein (MCP) into the sgRNA, and using dCas9-VP64 as a scaffold, MS2 recruits its homologous MCPs to fuse with p65AD and heat shock factor 1 (HSF1), a process termed synergistic activation mediator (SAM). Compared to using dCas9-VP64 alone, SAM technology significantly improved the transcriptional levels of 12 previously difficult-to-activate genes.

[0007] The ability of CRISPR-dCas9 to regulate gene expression has been widely applied in many fields, including stem cell differentiation, inducing cell reprogramming, genome-wide screening, disease mechanism research, disease model construction, elucidating gene function, and gene-gene interaction research. Summary of the Invention

[0008] The purpose of this invention is to provide a novel use for substances that activate the expression of LTR5Hs sequences in lung cancer cells.

[0009] This invention provides the use of a substance that activates LTR5Hs sequence expression in lung cancer cells in any of the following 1)-4):

[0010] 1) To prepare products for the prevention and / or treatment of lung cancer;

[0011] 2) Prepare products that inhibit the proliferation of lung cancer cells;

[0012] 3) Prevention and / or treatment of lung cancer;

[0013] 4) Inhibits lung cancer cell proliferation;

[0014] The LTR5Hs sequence is shown in Sequence 1.

[0015] Another objective of this invention is to provide a method for activating LTR5Hs sequence expression in lung cancer cells.

[0016] The method for activating LTR5Hs sequence expression in lung cancer cells provided by the present invention includes the following steps: introducing a substance that activates LTR5Hs sequence expression in lung cancer cells into lung cancer cells.

[0017] In the above method, the substance that activates LTR5Hs sequence expression in lung cancer cells includes dCAS-VP64 fusion protein, MS2-P65-HSF1 fusion protein, and sgRNA targeting positions 83-89 of the LTR5Hs sequence. Positions 83-89 of the LTR5Hs sequence are TP53 binding sites. In a specific embodiment of the present invention, the target sequence of the sgRNA is shown in Sequence 10.

[0018] Furthermore, the above method may include the following steps:

[0019] (1) The lung cancer cells were infected with recombinant lentivirus A that could express the dCAS-VP64 fusion protein to obtain a positive cell line;

[0020] (2) Introduce recombinant lentivirus B, which can express the sgRNA and the MS2-P65-HSF1 fusion protein, into the positive cell line obtained in step (1) to activate the expression of LTR5Hs sequence in lung cancer cells.

[0021] Furthermore, in (1), the positive cell line is the cell line with the highest relative expression level of dCas9 protein obtained after screening with puromycin.

[0022] In (1), the recombinant lentivirus A that can express the dCas9-VP64 fusion protein can be a lentivirus obtained by packaging a lentivirus vector containing the dCas9-VP64 fusion protein encoding gene.

[0023] In (2), the recombinant lentivirus B capable of expressing the sgRNA and the MS2-P65-HSF1 fusion protein can be a lentivirus obtained by packaging a lentivirus vector containing the sgRNA encoding gene and the MS2-P65-HSF1 fusion protein encoding gene.

[0024] In one specific embodiment of the present invention, the lentiviral vector containing the dCas9-VP64 fusion protein encoding gene is lenti-EF1a-dCas9-VP64-Puro.

[0025] In one specific embodiment of the present invention, the lentiviral vector containing the sgRNA encoding gene and the MS2-P65-HSF1 fusion protein encoding gene is a vector obtained by inserting the encoding gene of the sgRNA target sequence into the lentiviral vector GV419 (U6-sgRNA-SV40-MS2-P65-HSF1-T2A-Neo).

[0026] In the above method, the lung cancer cells can specifically be A549 cells.

[0027] Another object of this invention is to provide any of the following biomaterials:

[0028] a. Lung cancer cells prepared according to the above method;

[0029] b. Any of the sgRNAs described above;

[0030] c. Expression cassettes or vectors expressing any of the sgRNAs described above;

[0031] d. A complete set of reagents, consisting of any of the dCas9-VP64 fusion proteins described above, any of the MS2-P65-HSF1 fusion proteins described above, and any of the sgRNAs targeting the LTR5Hs sequence described above;

[0032] e. A complete set of vectors, comprising a vector expressing any of the dCas9-VP64 fusion proteins described above, a vector expressing any of the MS2-P65-HSF1 fusion proteins described above, and a vector expressing any of the sgRNAs targeting the LTR5Hs sequence described above.

[0033] f. Any of the positive cell lines described above.

[0034] The final object of this invention is to provide any of the following applications:

[0035] A. The application of any of the methods described above in inhibiting the proliferation of lung cancer cells;

[0036] B. Application of any of the above methods in preparing lung cancer cells with reduced proliferation rate;

[0037] C. The application of any of the above-mentioned biomaterials in the preparation of products for treating lung cancer;

[0038] D. The application of any of the above-mentioned biomaterials in the preparation of products that inhibit the proliferation of lung cancer cells;

[0039] E. The application of any of the above-mentioned positive cell lines or their use as tool cells in activating endogenous gene expression in lung cancer cells;

[0040] F. The application of any of the above-mentioned positive cell lines or their use as tool cells in the study of endogenous gene function in lung cancer cells.

[0041] This invention utilizes the dCas9-VP64 transcriptional activation system. After selection with puromycin, a stable A549 cell line with the highest relative expression level of dCas9 protein was obtained. Subsequently, by introducing sgRNAs targeting one or more genes into this cell line, the expression of endogenous genes in lung cancer cells can be activated, and related functional genes can be studied. Furthermore, this invention prepares an A549 cell line with significantly reduced proliferation rate by introducing sgRNAs targeting the TP53 binding site (GGGCTGG) in the LTR5Hs sequence into this cell line. This invention is the first to discover a novel target for lung cancer treatment, which is of great significance for the research of lung cancer treatment and mechanisms. Attached Figure Description

[0042] Figure 1 The expression level of dCas9 mRNA in the dCas9-VP64 stable cell line is given. Error bars represent the standard error of three independent experimental results, ***p<0.001, ****p<0.0001.

[0043] Figure 2 The expression level of dCas9 protein in the dCas9-VP64 stable cell line.

[0044] Figure 3 For validation of sgRNA cleavage activity in vitro. M1: 2000 markers; M2: 500 markers; Lane 1: Control template; Lane 2: Control sgRNA targeted cleavage; Lane 3: Target sequence amplified for validation of TP53-sgRNA cleavage activity; Lane 4: TP53-sgRNA targeted cleavage; Lane 5: Target sequence amplified for validation of Up-sgRNA and Down-sgRNA cleavage activity; Lane 6: Up-sgRNA targeted cleavage; Lane 7: Down-sgRNA targeted cleavage.

[0045] Figure 4 This study was conducted to investigate the colony formation phenotype of the A549-VP64 cell line. Detailed Implementation

[0046] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0047] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0048] Example 1: A549 stably expressing cell line constructed based on the dCas9-VP64 transcriptional activation system

[0049] I. Packaging of dCas9-VP64 lentivirus

[0050] 1. Plasmid transfection

[0051] 1) Use DMEM medium (Dulbecco's modified Eagle's medium, DMEM, Thermo Fisher Scientific, 26010074) containing 10% fetal bovine serum (Thermo Fisher Scientific, 2186870) and without antibiotics to appropriately adjust the concentration of A549 cells (Beina Biotechnology, BNCC337696). Seed 10 mL in a 10 cm culture dish and incubate for 24 h to allow the cells to reach approximately 90% confluence.

[0052] 2) Dilute the plasmid DNA in 1.5 mL of Opti-MEI low-serum medium (Thermo Fisher Scientific, 2085152), including 10 μg pxPAX2 (Miaoling plasmid, P0261), 5 μg pMD2.G (Miaoling plasmid, P0262), and 10 μg lenti-EF1a-dCas9-VP64-Puro (this vector expresses the dCas9-VP64 fusion protein) (Addgene, #99371); dilute 60 μL of Lipofectamine (Invitrogen, 200011668-019) in 1.5 mL of Opti-MEI low-serum medium, mix gently, and incubate at room temperature for 5 min.

[0053] 3) Mix the diluted DNA and Lipofectamine 2000 (total volume 3 mL), mix gently, and incubate at room temperature for 20 min to obtain the transfection solution. Add 3 mL of the transfection solution to a Petri dish and gently shake to mix. After 6 h of transfection, replace with DMEM medium containing 10% fetal bovine serum and 1% Pen-Strep antibiotic (Thermo Fisher Scientific, 2199828).

[0054] 4) Collect viral supernatant at 48h and 72h after transfection.

[0055] 2. Lentiviral Concentration

[0056] 1) Centrifuge the collected viral supernatant at 500g for 10 min. Transfer the clarified viral supernatant to a 50mL centrifuge tube, add Lenti-X Concentrator (Clontech, 631231) at a ratio of 1 volume of Lenti-X Concentrator to 3 volumes of viral supernatant, and gently invert to mix.

[0057] 2) Incubate the mixture at 4°C for 30 min, then centrifuge at 1500g for 45 min at 4°C. After centrifugation, grayish-white particles will be visible at the bottom. Carefully remove the supernatant and gently resuspend the precipitate in PBS (Thermo Fisher Scientific, C10010500BT) at 1 / 100 of the original volume. The particles may be somewhat viscous at first, but they will quickly become suspended. Titrate the sample immediately.

[0058] 3. Measure the sample titer

[0059] Take 10 μL of the lentivirus supernatant to be tested, dilute it 100-fold, and add 20 μL to the sample well of the Lenti-X GoStix Plus (Clontech, 631280). Add 80 μL of Chase Buffer (provided by Lenti-X GoStix Plus) to the sample well and time for 10 min. The test band (T) will begin to appear within 5 min and reach its maximum intensity within 10 min. The control band (C) will appear when the test is running normally.

[0060] The same method was used to test lentiviruses with known titers, and the reference value was obtained as: known titer (IFU / μL) / measurement reading (ng / ml p24).

[0061] The concentration of the lentivirus to be tested is calculated using the following formula: Measurement reading (ng / μL p24) × Reference value = Titer of the lentivirus to be tested (IFU / mL).

[0062] After the titer was measured, the virus was aliquoted and stored at -80°C.

[0063] II. Cell infection with lentiviruses

[0064] 1. Lentiviral infection

[0065] The concentration of A549 cells (Beina Biotechnology, BNCC337696) was appropriately adjusted using DMEM medium (Dulbecco's modified Eagle's medium, DMEM, Thermo Fisher Scientific, 26010074) containing 10% fetal bovine serum (Thermo Fisher Scientific, 26010074) and without antibiotics. 0.5 mL was seeded into each well of a 24-well plate, allowing the cells to reach approximately 30-50% confluence after 24 hours.

[0066] Calculate the MOI value: The optimal MOI value for A549 is 30. The amount of virus to be added (μL) = MOI × number of cells (cell seeding amount × 2) / titer × 1000.

[0067] The infection solution was prepared using the half-volume method: 8 μg / mL polybrene (Shanghai Maokang, MX2201) was added to the calculated required viral load (μL), and DMEM medium containing 10% fetal bovine serum was added to bring the volume to 250 μL. After infection at 37°C for 4 h, the medium was brought to a final volume of 500 μL.

[0068] About 24 hours after infection, the virus-containing culture medium is aspirated and replaced with fresh culture medium as described above.

[0069] Purinemycin screening was performed 48 hours later.

[0070] 2. Selection of stable transfected cell lines using puromycin

[0071] Cells were passaged 48 hours after transfection. They were then selected in DMEM medium containing 2 ng / mL of 10% fetal bovine serum for one week, with the medium being changed every two days.

[0072] One week later, prepare 90 μL of DMEM medium containing 10% fetal bovine serum at a puromycin concentration of 2 ng / mL into 96-well plates (columns 2-12). Digest the cells, count the cells, adjust the concentration to 1000 cells / mL and seed them into the first column. Take 10 μL of cell solution into the second column wells and mix well. Repeat this serial dilution process.

[0073] After 3–5 days, wells containing single cells were labeled and screened for 2 weeks using DMEM medium containing 10% fetal bovine serum at a puromycin concentration of 2 ng / mL, with the medium changed every 2–5 days. After the 96-well plates reached confluence, the cells were replaced with 24-well, 12-well, and 6-well plates, ultimately resulting in four monoclonal cell lines, named A549-dCas9-VP64-1, A549-dCas9-VP64-2, A549-dCas9-VP64-3, and A549-dCas9-VP64-4.

[0074] III. Verification by Real-Time PCR of Stable Transfected Cell Lines

[0075] The monoclonal cell lines A549-dCas9-VP64-1, A549-dCas9-VP64-2, A549-dCas9-VP64-3, and A549-dCas9-VP64-4 selected in step two, as well as the control cell line A549, were subjected to quantitative real-time PCR to detect the dCas9 mRNA expression level. The specific steps are as follows:

[0076] 1. Total RNA extraction

[0077] RNA extraction was performed using the MiniBEST Universal RNA Extraction Kit (TAKARA, 9767). The specific steps are as follows:

[0078] 1) Aspirate the culture medium from the cells in the 12-well plate and wash once with 1×PBS. Then add 350 μL of lysis buffer RL (with 50×DTT solution added) to the cultured cells, place horizontally for a moment to allow the lysis buffer to distribute evenly on the cell surface and lyse the cells, then use a pipette to detach the cells. Finally, transfer the lysis buffer containing the cells to a centrifuge tube, and repeatedly pipette until there is no obvious precipitate in the lysis buffer. Let the lysis buffer stand at room temperature for 2 minutes.

[0079] 2) Place the gDNA Eraser Spin Column into a 2 mL collection tube. Transfer the lysis buffer into the gDNA Eraser Spin Column. Centrifuge at 12000 rpm for 1 min.

[0080] 3) Remove the gDNA Eraser Spin Column. Retain 2 mL of the filtrate in the collection tube. Add 350 μL of 70% ethanol and mix the solution thoroughly using a pipette.

[0081] 4) Immediately transfer the entire mixture into the RNA Spin Column (including a 2 mL collection tube). Centrifuge at 12000 rpm for 1 min and discard the filtrate. Place the RNA Spin Column back into the 2 mL collection tube.

[0082] 5) Add 500 μL of Buffer RWB to the RNA Spin Column, centrifuge at 12000 rpm for 30 seconds, and discard the filtrate. Add 600 μL of Buffer RWB to the RNA Spin Column, centrifuge at 12000 rpm for 30 seconds, and discard the filtrate. Add another 600 μL of Buffer RWB to the RNA Spin Column, centrifuge at 12000 rpm for 30 seconds, and discard the filtrate.

[0083] 6) Replace the RNA spin column onto a 2 mL collection tube and centrifuge at 12000 rpm for 2 min. Place the RNA spin column onto a 1.5 mL centrifuge tube, add 70 μL of RNase-free dH2O to the center of the RNA spin column membrane, and incubate at room temperature for 5 min. Elute the RNA by centrifuging at 12000 rpm for 2 min. Store the collected RNA at -80°C.

[0084] 2. cDNA synthesis

[0085] Using PrimeScript TM cDNA synthesis was performed using the RT reagent kit with gDNA Eraser (TAKARA, RR047A). The specific steps are as follows:

[0086] 1) Genomic DNA removal reaction

[0087] Prepare the reaction mixture on ice with the following components: 2 μL 5×gDNA Eraser Buffer, 1 μL gDNA Eraser, 5 μL Total RNA, and RNase-Free dH2O to a final volume of 10 μL. Incubate the reaction mixture in a PCR instrument at 42°C for 2 min; store at 4°C.

[0088] 2) Reverse transcription reaction

[0089] The reaction system was prepared on ice with the following components: 10 μL of the above reaction solution, 1 μL of PrimeScript RT Enzyme Mix I, 1 μL of RT primer Mix, 4 μL of 5×PrimeScript Buffer II, and 4 μL of RNase-Free dH2O. The reaction conditions were as follows: 42℃ for 15 min; 85℃ for 5 s; and stored at 4℃.

[0090] 3. Quantitative real-time PCR detection

[0091] The cDNA synthesized from different monoclonal cells was diluted 5-fold with RNase-free dH2O. Real-time PCR was performed using the following primers:

[0092] dcas9-F:GCTGAAAACCTATGCCCACC;

[0093] dcas9-R:GATTGTCTTGCCGGACTGCT;

[0094] β-actin-F:CCACGAAACTACGTTCAACTCC;

[0095] β-actin-R: GTGATCTCCTTCTGCATCCTGT.

[0096] The reaction system is as follows: 10 μL of TB Green Premix Ex Taq (2×), 0.4 μL of primer F (10 μM), 0.4 μL of primer R (10 μM), 2 μL of cDNA template, and 7.2 μL of RNase-free dH2O.

[0097] The reaction conditions were as follows: heating to 95℃ for 30s pre-denaturation; 95℃ for 5s chain depolymerization; 60℃ for 20s annealing; a total of 40 cycles; 72℃ for extension for 3min; and storage at 4℃.

[0098] 4. Data Processing

[0099] Each sample group was replicated in triplicate, with three independent assays performed. β-actin was used as an internal control gene. -ΔΔCT The relative mRNA expression level for each sample was calculated using the given method. Standardized data from each group were analyzed using GraphPadPrism 8.0 for one-way ANOVA and plotted. A p-value < 0.05 was considered statistically significant.

[0100] The results of real-time quantitative PCR detection of dCas9 protein mRNA expression levels are as follows: Figure 1As shown in the figure. The results indicate that in the dCas9-VP64 stably expressing cell line, the expression level of dCas9 mRNA in A549-dCas9-VP64-2 is higher than that in other monoclonal cell lines in the same group.

[0101] IV. Western Blot Validation of Stable Transfected Cell Lines

[0102] Western blot analysis was performed on the monoclonal cell line A549-dCas9-VP64-2 and the control cell line A549 to detect the expression level of dCas9 protein. The specific steps are as follows:

[0103] 1. Cell lysis

[0104] Wash the sample twice with pre-cooled PBS. Prepare cell lysis buffer: Add 1 mL of high-efficiency RIPA lysis buffer (Solepro, R0010) to 10 μL of PMSF (Solepro, P0100).

[0105] Add 200 μL of freshly prepared cell lysis buffer to each well of a 6-well plate, mix well, and place on ice. Lyse the cells on a shaker for 30 min. Collect the cells on ice into 1.5 mL centrifuge tubes. Centrifuge at 14000 g for 15 min at 4 °C, and collect the supernatant into 1.5 mL centrifuge tubes.

[0106] 2. Protein Sample Preparation

[0107] Add 80 μL of protein to 20 μL of SDS-PAGE protein loading buffer (5×, Beyotime, P0015), mix well, and heat in a 95°C water bath for 8 min. Centrifuge briefly and allow to cool to room temperature.

[0108] 3. Sample loading and electrophoresis

[0109] Remove the pre-cast gel and place it into the electrophoresis tank. Position the shorter glass plate inwards and the longer glass plate outwards, then press the clamps to secure it. First, inject 1×SDS-PAGE electrophoresis buffer (Beyotime, P0014A) into the inner tank, ensuring it is full and leak-free before adding more to the outer tank.

[0110] Calculate the sample loading volume based on the determined protein concentration, pipette the sample into the well, and slowly add it. Add 5 μL of pre-stained protein marker (Thermo, 26616). Adjust the voltage and time: 120V, 1h.

[0111] 4. Transfer membrane

[0112] Cut the filter paper and PVDF membrane (Millipore, IPVH00010) to suitable sizes. Soak the PVDF membrane in methanol beforehand. Open the clamps and lay the membrane flat in an enamel tray, placing two sponge pads of filter paper in the tray as well. Pour in the transfer solution to submerge the material.

[0113] Remove the glass plate after electrophoresis, pry it open to remove the gel, and cut off the excess.

[0114] Open the clamps to keep the black side horizontal. Place a sponge pad on top and use a glass rod to remove air bubbles. Place three layers of filter paper on the sponge pad and use the glass rod to remove air bubbles again. Place the peeled-off adhesive on the filter paper and gently use the glass rod to remove air bubbles. Place the PVDF membrane on the adhesive and use the glass rod to remove air bubbles. Cover the membrane with three layers of filter paper and use the glass rod to remove air bubbles. Cover with another sponge pad and use the glass rod to remove air bubbles. Close the clamps to secure the membrane.

[0115] Place the clamps in the transfer tank, black side to black, red side to red, and pour in the transfer solution (Beyotime, P0021A). Submerge the transfer tank in ice. Turn on the power, 200mA, for 1 hour.

[0116] 5. Immune response

[0117] Add 1g of skim milk powder to 20mL of TBST (Solepro, T1081), mix thoroughly, and prepare the blocking solution. Take out the PVDF membrane, wash it twice with TBST, transfer it to a petri dish containing the blocking solution, and block it at room temperature by shaking on a shaker for 1 hour.

[0118] Dilute the primary antibody to an appropriate concentration with the blocking buffer, and place the blocked PVDF membrane in a solution containing the primary antibody overnight at 4°C. The next day, wash the PVDF membrane three times with TBST on a shaker at room temperature for 15 minutes each time, for a total of no more than 1 hour.

[0119] Dilute the secondary antibody to an appropriate concentration with the blocking buffer, and place the PVDF membrane in the solution containing the secondary antibody. Incubate at 37°C for 1 hour. Wash three times with TBST on a shaker at room temperature for 15 minutes each time, for a total of no more than 1 hour.

[0120] 6. Chemiluminescence

[0121] Pipette 500 μL of ECL luminescence solution (Millipore, WBKLS0100) solution A and solution B into a 1.5 mL centrifuge tube and mix well. After 1 min, evenly drop the mixture onto the PVDF membrane, incubate in a dark room for 1 min, and then develop.

[0122] Western blotting results are as follows: Figure 2 As shown in the figure. The results indicate that the A549-dCas9-VP64-2 cell line expresses dCas9 protein, while the untransfected A549 cell line does not express dCas9 protein.

[0123] Example 2: Application of A549 stably expressing cell lines

[0124] I. sgRNA Design and In Vitro Cleavage Activity Verification

[0125] Based on the LTR5Hs sequence shown in Sequence 1, sgRNAs were designed. Based on the location of the PAM sequence, an sgRNA targeting the TP53 binding site in the LTR5Hs sequence (located at positions 83-89 of Sequence 1) was designed and named TP53-sgRNA. TP53-sgRNA contains the reverse complementary sequence of the DNA fragment shown at positions 83-89 of Sequence 1. Simultaneously, an sgRNA targeting upstream (Up-sgRNA) and downstream (Down-sgRNA) of the TP53 binding site in the LTR5Hs sequence was designed as controls. The target sequences of each sgRNA are as follows:

[0126] TP53-sgRNA: tcccacctccagccctaagg (sequence 10);

[0127] Up-sgRNA:ccctgggcaatggaatgtct;

[0128] Down-sgRNA:tactaagggaactcagaggc.

[0129] Since multiple sgRNAs exist as target templates in the genome (LTR5Hs sequences exhibit polymorphism in the genome), a single template was amplified in vitro using the Takara sgRNA In Vitro Transcription and Screening Systems (Clontech, 632636) to verify the targeting (cleavage activity) of the sgRNA. The specific steps are as follows:

[0130] 1. Primer design for in vitro amplification of sgRNA

[0131] According to the instructions, adapters were added to both ends of the designed sgRNA: CCTTAATACGACTCACTATAgg and GTTTAAGAGCTATGC. The final designed sequence is as follows:

[0132] TP53-sgRNA-vitro: CCTCTAATACGACTCACTATAggtcccacctccagccctaaggGTTTAAGAGCTATGC;

[0133] Up-sgRNA-vitro: CCTCTAATACGACTCACTATAggccctgggcaatggaatgtctGTTTAAGAGCTATGC;

[0134] Down-sgRNA-vitro: CCTCTAATACGACTCACTATAggtactaagggaactcagaggcGTTTAAGAGCTATGC.

[0135] 2. PCR amplification of sgRNA template

[0136] Prepare the following PCR amplification system in a 200 μL PCR tube: 12.5 μL PrimeSTAR Max Premix, 0.5 μL TP53-sgRNA-vitro / Up-sgRNA-vitro / Down-sgRNA-vitro (10 μM), 1 μL Guide-it ScaffoldTemplate, and RNase Free Water to a final volume of 25 μL.

[0137] The PCR amplification reaction conditions were as follows: 98℃ melting for 10s; 68℃ annealing for 10s, for a total of 33 cycles; stored at 4℃.

[0138] 3. In vitro transcription of sgRNA

[0139] Prepare the following sgRNA in vitro transcription reaction system: 5 μL of sgRNA template obtained in step 2, 7 μL of Guide-it InVitro Transcription Buffer, 3 μL of Guide-it T7 Polymerase Mix, and 5 μL of RNase Free Water. After incubation at 37°C for 4 h, add 2 μL of recombinant DNase I to the 20 μL reaction system.

[0140] 4. Extracting cellular genomic DNA

[0141] Extract cellular genomic DNA according to the method in the kit.

[0142] 5. Amplify the target sequence

[0143] Prepare the following amplification reaction system: 25 μL of 2×Terra PCR Direct Buffer, 1.5 μL of Primer-F (10 μM), 1.5 μL of Primer-R (10 μM), 1 μL of Terra PCR Direct Polymerase Mix (1.25 U / μL), 19 μL of RNase-Free Water, and 2 μL of the genomic DNA prepared in step 4.

[0144] The primer sequences for amplifying the target sequence to verify the cleavage activity of TP53-sgRNA are as follows:

[0145] Cas9tem-F:GAGTCATCACCACTCCCTAATC;

[0146] Cas9tem-R: GCCTCTGAGTTCCTCTAGTATTT.

[0147] The primer sequences for verifying the cleavage activity amplification of Up-sgRNA and Down-sgRNA are as follows:

[0148] Cas9tem-F:GAGTCATCACCACTCCCTAATC;

[0149] Cas9tem-2R:CCACACCTGTGGGTG.

[0150] The amplification reaction conditions were as follows: heating to 98℃ for 2 min for pre-denaturation; 98℃ for 10 s for denaturation; 60℃ for 15 s for annealing; 68℃ for 1 min for extension, for a total of 35 cycles; and storage at 4℃.

[0151] 6. In vitro cleavage of sgRNA

[0152] Dilute the sgRNA prepared in step 3 (or the control sgRNA provided in the kit) to 50 ng / μL, and take 1 μL. Simultaneously, take 0.5 μL of the Guide-it Recombinant Cas9 Nuclease (500 ng / μL) provided in the kit, mix thoroughly, and incubate at 37°C for 5 min to obtain the Cas9 / sgRNA mixture. Then prepare the following reaction system: 5 μL of the PCR product obtained in step 5 (100–250 ng) or control, 1 μL of 15×Cas9Reaction Buffer, 1 μL of 15×BSA, 6.5 μL of RNase Free Water, and 1.5 μL of the Cas9 / sgRNA mixture. Incubate at 37°C for 1 h, then at 80°C for 5 min.

[0153] 7. Verification of sgRNA in vitro cleavage activity

[0154] The template sequence of the sgRNA cut obtained in step 6 was identified by agarose gel electrophoresis.

[0155] The results are as follows Figure 3As shown. The results indicate that the control template provided by the kit was 614 bp in length, and under the targeting of the control sgRNA, the Cas9 protein cleaved it into two segments of 350 bp and 264 bp. The template for verifying the cleavage activity of TP53-sgRNA was 573 bp (sequence 2), and under the targeting of TP53-sgRNA, the Cas9 protein cleaved it into two segments of 335 bp (sequence 3) and 238 bp (sequence 4). The template for verifying the cleavage activity of Up-sgRNA and Down-sgRNA was 703 bp (sequence 5), and under the targeting of Up-sgRNA, the Cas9 protein cleaved it into two segments of 434 bp (sequence 6) and 269 bp (sequence 7). Under the targeting of Down-sgRNA, the Cas9 protein cleaved it into two segments of 566 bp (sequence 8) and 137 bp (sequence 9). The cleavage size of the three sgRNAs matches the designed site without error. Considering that TP53-sgRNA targets the p53 protein binding region, this invention selects TP53-sgRNA for subsequent experiments.

[0156] II. sgRNA Lentiviral Packaging

[0157] The TP53-sgRNA and one random sgRNA (control) sequence were given to Jikai Gene Company for insertion of the sgRNA fragment into the GV419(U6-sgRNA-SV40-MS2-P65-HSF1-T2A-Neo) vector (which expresses the sgRNA and MS2-P65-HSF1 fusion protein) (Jikai Gene Company), and then packaged into lentivirus. The sgRNA target sequence is as follows:

[0158] TP53-sgRNA-F: CACCgTCCCACCTCCAGCCCTAAGG;

[0159] TP53-sgRNA-R:aaacCCTTAGGGCTGGAGGTGGGAc;

[0160] Control-sgRNA-F: CACCgCAACGGGTTCTCCCGGCTAC;

[0161] Control-sgRNA-R:aaacGTAGCCGGGAGAACCCGTTGc.

[0162] III. Cell infection with lentiviruses

[0163] 1. Lentiviral infection

[0164] The lentivirus obtained in step two of Example 1 was used to infect the A549-dCas9-VP64-2 cell line obtained in Example 1. G418 selection was performed after 48 hours.

[0165] 2. Selection of stable transfected cell lines using G418

[0166] Cells were passaged 48 hours after transfection. They were then selected for one week in DMEM medium containing 10% fetal bovine serum, with G418 (G418 sulfate, 10131027, Gibco) at a concentration of 400 μg / mL and puromysin (Puromysin, A1113803, Gibco) at a concentration of 2 ng / mL. The medium was changed every two days.

[0167] One week later, prepare 90 μL of DMEM medium containing 10% fetal bovine serum with a G418 concentration of 400 μg / mL and a puromycin concentration of 2 ng / mL into 96-well plates (columns 2-12). Digest the cells, count the cells, adjust the concentration to 1000 cells / mL and seed them into the first column. Take 10 μL of cell solution into the second column wells and mix well. Serially dilute each well in turn.

[0168] After 3–5 days, wells containing single cells were labeled. Cells were screened for 2 weeks in DMEM medium containing 10% fetal bovine serum (FBS) with G418 concentration of 400 μg / mL and puromycin concentration of 2 ng / mL, with the medium changed every 2–5 days. Once the 96-well plates reached confluence, the cells were transferred to 24-well and then 12-well plates. Three single-clonal cell lines were ultimately selected and named VP64-p53-1, VP64-p53-2, and VP64-p53-3, respectively.

[0169] IV. Colony formation phenotype assay of dCas9-VP64-sgRNA stably transfected cell lines

[0170] Three monoclonal cell lines in the exponential growth phase, VP64-p53-1, VP64-p53-2, and VP64-p53-3, along with the control cell VP64-Control (cells infected with lentiviruses packaged with random sgRNA), were prepared into cell suspensions using standard digestion and passage methods. The cell suspensions were repeatedly pipetted to ensure thorough cell dispersion, and cell counts were performed. Cell concentrations were then adjusted with culture medium before use.

[0171] Based on cell proliferation capacity, serially dilute the cell suspension. Seed cells into 6-well plates, adding 2 mL of cell suspension to each well at a concentration of 2000 cells. Gently shake the culture dish in a cross-shaped motion to disperse the cells evenly. Incubate the culture dishes at 37°C and 5% CO2 for 1–2 weeks, replacing the culture medium with fresh medium as needed based on pH changes.

[0172] When visible clones appear in the culture dish, stop the culture, discard the culture medium, carefully wash twice with PBS, and air dry. Fix with 4% paraformaldehyde (Shanghai Yuanye Biotechnology, R20497) for 25 min, remove the 4% paraformaldehyde, carefully wash twice with PBS, and air dry. Stain with crystal violet solution (ammonium oxalate crystal violet staining solution (1%), Solarbio, G1062) for 10 min, slowly wash away the stain with running water, air dry, and take a picture.

[0173] The results are as follows Figure 4 As shown in the figure. The results showed that the colony formation rate of monoclonal cell lines VP64-p53-1, VP64-p53-2, and VP64-p53-3 was lower than that of the control VP64-Control, indicating that the proliferation rate of monoclonal cell lines VP64-p53-1, VP64-p53-2, and VP64-p53-3 was lower than that of the control group VP64-Control.

[0174] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Application of substances that activate LTR5Hs sequence expression in lung cancer cells in any of the following 1)-2): 1) To prepare products for the treatment of lung cancer; 2) Prepare products that inhibit the proliferation of lung cancer cells; The LTR5Hs sequence is shown in Sequence 1; The substances that activate the expression of LTR5Hs sequences in lung cancer cells include dCAS-VP64 fusion protein, MS2-P65-HSF1 fusion protein, and sgRNA targeting positions 83-89 of the LTR5Hs sequence; the target sequence of the sgRNA is shown in Sequence 10.

2. The application of any one of the following biomaterials, a or b, in the preparation of products for treating lung cancer: a. A complete set of reagents, consisting of dCas9-VP64 fusion protein, MS2-P65-HSF1 fusion protein and sgRNA targeting positions 83-89 of the LTR5Hs sequence; b. A complete set of vectors, consisting of a vector expressing the dCas9-VP64 fusion protein, a vector expressing the MS2-P65-HSF1 fusion protein, and a vector expressing sgRNA targeting positions 83-89 of the LTR5Hs sequence; The target sequence of the sgRNA is shown in Sequence 10.

3. The application of any one of the following biomaterials, a or b, in the preparation of products that inhibit the proliferation of lung cancer cells: a. A complete set of reagents, consisting of dCas9-VP64 fusion protein, MS2-P65-HSF1 fusion protein and sgRNA targeting positions 83-89 of the LTR5Hs sequence; b. A complete set of vectors, consisting of a vector expressing the dCas9-VP64 fusion protein, a vector expressing the MS2-P65-HSF1 fusion protein, and a vector expressing sgRNA targeting positions 83-89 of the LTR5Hs sequence; The target sequence of the sgRNA is shown in Sequence 10.