Methods of dosing and administration of engineered islet cells

Abstract

Provided herein are methods of dosing engineered islet cells that include functional modified beta cell containing one or more modifications, such as genetic modifications. In some embodiments, the engineered islets are hypoimmunogenic cells. In some embodiments, the one or more modifications reduce or eliminate expression of one or more MHC class I and / or MHC class II human leukocyte antigens and also increase expression of one or more tolerogenic factors, such as CD47. In some embodiments, the subject has a beta cell related disorder, such as diabetes (e.g. Type I diabetes).

Description

METHODS OF DOSING AND ADMINISTRATION OF ENGINEERED ISLET CELLSCross-Reference to Related Applications

[0001] This Application claims priority to U.S. Provisional Application Nos. 63 / 742,174 filed on January' 6, 2025; 63 / 769,357 filed on March 10, 2025; 63 / 776,518 filed on March 24, 2025;63 / 799,871 filed on May 5, 2025; and 63 / 823.315 filed on June 13, 2025, each of which is incorporated herein by reference in its entirety.Incorporation of Sequence Listing

[0002] The instant application contains a Sequence Listing XML which has been submitted electronically and is hereby incorporated by' reference in its entirety'. Said XML copy, created on Month XX. 2026. is named XXXXXXX. and is XXX, XXX bytes in size.Field

[0003] In certain aspects, the present disclosure is directed to methods of dosing engineered islet cells that include functional modified beta cell containing one or more modifications, such as genetic modifications. In some embodiments, the engineered islets are hypoimmuiiogenic cells. In some embodiments, the one or more modifications reduce or eliminate expression of one or more MHC class I and / or MHC class II human leukocyte antigens and also increase expression of one or more tolerogenic factors, such as CD47. In some embodiments, the subject has a beta cell related disorder, such as diabetes (e.g. Type I diabetes).Summary

[0004] Provided herein is a method of treating or preventing a beta cell disorder in a subject in need thereof, the method comprising administering to the subject a composition comprising a dose of engineered hypoimmunogenic islets, wherein the composition is administered to the subject via intramuscular injection, and wherein the dose is a dose from: A) about IxlO7cells to about 3 x 108cells; B) about 1.25xl05cells / kg to about 1.2 x 107cells / kg; C) about 6,500 islet equivalents (IEQ) to about 600,000 IEQ; or D) about 80 lEQ / kg to about 24,000 lEQ / kg.

[0005] Provided herein is a method of reducing exogenous insulin dependence in a subject having or at risk of having a beta cell disorder, the method comprising administering to the subject a composition a dose of engineered hypoimmunogenic islets, wherein tire composition is administered via intramuscular injection, wherein the dose is a dose from: A) about IxlO7cells to about 3 x 108cells; B)about 1.25x10’ cells / kg to about 1.2 x 107cells / kg; C) about 6.500 islet equivalents (IEQ) to about 600,000 IEQ; or D) about 80 lEQ / kg to about 24,000 lEQ / kg, and wherein the amount of exogenous insulin required is less than the amount of exogenous insulin required for a subject treated with non-hypoimmunogenic islets or is less than the amount of exogenous insulin required for untreated subjects that have the beta cell disorder.

[0006] Provided herein is a method of promoting insulin independence in a subject having or at risk of having a beta cell disorder, the method comprising administering to the subject a composition comprising a dose of engineered hypoimmunogenic islets, wherein the composition is administered via intramuscular injection, and wherein the dose is a dose from: A) about IxlO7cells to about 3 x 108cells; B) about 1.25xl05cells / kg to about 1.2 x 107cells / kg; C) about 6,500 Islet equivalents (IEQ) to about 600,000 IEQ; or D) about 80 lEQ / kg to about 24,000 lEQ / kg.

[0007] Provided herein is a method of improving graft function in a subject having or at risk of having a beta cell disorder, the method comprising administering to the subject a composition comprising a dose of engineered hypoimmunogenic islets, wherein the composition is administered via intramuscular injection, and wherein the dose is a dose from: A) about IxlO7cells to about 3 x 108cells; B) about 1.25x10’ cells / kg to about 1.2 x 107cells / kg; C) about 6,500 Islet equivalents (IEQ) to about 600.000 IEQ; or D) about 80 lEQ / kg to about 24.000 lEQ / kg.

[0008] Provided herein is a method of enhancing engraftment in a subject having or at risk of having a beta cell disorder, the method comprising administering to the subject a composition comprising a dose of engineered hypoimmunogenic islets, wherein the dose is administered via intramuscular injection, and wherein the dose is a dose from: A) about IxlO7cells to about 3 x 108cells; B) about 1.25 xlO5cells / kg to about 1.2 x 107cells / kg) about 6,500 Islet equivalents (IEQ) to about 600,000 Islet equivalents (IEQ); D) about 80 lEQ / kg to about 24,000 lEQ / kg.

[0009] Provided herein is a method of stabilizing glucose levels in a subject having or at risk of having a beta cell disorder, the mclhod comprising administering to the subject a dose of engineered hypoimmunogenic islets, wherein the composition is administered via intramuscular injection, wherein the dose is a dose from: A) about IxlO7cells to about 3 x 108cells; B) about 1.25xl05cells / kg to about 1.2 x 107cells / kg; C) about 6,500 islet equivalents (IEQ) to about 600,000 IEQ; or D) about 80 lEQ / kg to about 24,000 lEQ / kg, wherein the glucose levels are stabilized compared to a subject administered an alternative islet therapy or compared to an untreated subject.

[0010] Provided herein is a method of stabilizing / increasing c-peptide levels in a subject having or at risk of having a beta cell disorder, the method comprising administering to the subject a composition comprising a dose of engineered hypoimmunogenic islets, wherein the composition is administered via intramuscular injection, and wherein the dose is a dose from: A) about 1x107 cells to about 3 x 108cells; B) about 1.25xl05cells / kg to about 1.2 x 107cells / kg; C) about 6,500 islet equivalents (IEQ) to about 600,000 IEQ; or D) about 80 lEQ / kg to about 24,000 lEQ / kg. wherein the c-peptide levels are stabilized or increased compared to a subject administered an alternative islet therapy or compared to an untreated subject.

[0011] Provided herein is a method of reducing HbAlc levels in a subject having or at risk of having a beta cell disorder, die method comprising administering to the subject a composition comprising a dose of engineered hypoimmunogenic islets, wherein the composition is administered via intramuscular injection, and wherein the dose is a dose from: A) about IxlO7cells to about 3 x 108cells; B) about 1.25x10scells / kg to about 1.2 x 107cells / kg) about 6,500 islet equivalents (IEQ) to about 600.000 IEQ; or D) about 80 lEQ / kg to about 24,000 lEQ / kg, wherein the HbAlc levels are reduced compared to a subject administered an alternative islet therapy or compared to an untreated subject.

[0012] Provided herein is a method of reducing adverse side effects associated islet cell therapy in a subject having or at risk of having a beta cell disorder, the method comprising i) introducing hypoimmunogenic modification to a population of islet cells comprising beta cells to generate engineered hypoimmunogenic islets, and ii) administering a composition comprising a dose of the engineered hypoimmunogenic islets to a subject having or at risk of having a beta cell disorder, wherein the composition is administered via intramuscular injection, and wherein the dose is a dose from: A) about IxlO7cells to about 3 x 108cells; B) about 1.25xl05cells / kg to about 1.2 x 107cells / kg; C) about 6,500 islet equivalents (IEQ) to about 600.000 IEQ; or D) about 80 lEQ / kg to about 24,000 lEQ / kg.

[0013] Provided herein is a method of increasing time in range (TIR) in a subject having or at risk of having a beta cell disorder, the method comprising administering to the subject a composition comprising a dose of engineered hypoimmunogenic islets, wherein the composition is administered via intramuscular injection, and wherein the dose is a dose from: A) about IxlO7cells to about 3 x 108cells; B) about 1.25xl05cells / kg to about 1.2 x 107cells / kg) about 6,500 islet equivalents (IEQ) to about 600,000 IEQ; or D) about 80 lEQ / kg to about 24,000 lEQ / kg, wherein the TIR is increased compared to a subject administered an alternative islet therapy or compared to an untreated subject.

[0014] Provided herein is a method of inducing immune tolerance to a composition comprising a dose of engineered hypoimmunogenic islet cells, the method comprising administering the composition to a subject having or at risk of having a beta cell disorder, wherein the composition comprises a mixed population of engineered and non-engineered islet cells. In an embodiment, immune tolerance is induced against the non-engineered islet cells. In some embodiments, the mixed population of engineered and non-engineered islet cells comprises less than 20%, 15%, 10%. 5%, 4%, 3%, 2%, 1% by volume nonengineered islet cells. In some embodiments, the mixed population of engineered and non-engineered islet cells comprises substantially zero non-engineered islet cells. In another embodiment, immune tolerance is induced about at least 6 months, 9 months, or 12 months after administration of the composition. In an embodiment, the composition is administered to the subject via intramuscular injection. In an embodiment, immune tolerance is reduced adaptive immune response. In an embodiment, reduced adaptive immune response comprises reduced T cell response and / or donor-specific antibodies.In another embodiment, the dose comprises A) about IxlO7cells to about 3 x 108cells; B) about 1.25x10’ cells / kg to about 1.2 x 107cells / kg) about 6,500 islet equivalents (IEQ) to about 600,000 IEQ; or D) about 80 lEQ / kg to about 24,000 lEQ / kg.

[0015] In any of the methods and compositions provided herein, the composition comprising a dose of engineered hypoimmunogenic islet cells may comprise a mixed population of engineered and non-engineered islet cells. The mixed population of engineered and non-engineered islet cells may comprise:(i) non-engineered wild type islet cells,(ii) partially gene edited islet cells comprising modifications that inactivate or disrupt one or more alleles of: (1) one or more major histocompatibility complex (MHC) class 1 molecules or one or more molecules that regulate expression of the one or more MHC class I molecules, and / or (2) one or more MHC class II molecules or one or more molecules that regulate expression of the one or more MHC class II molecules; and wherein the partially gene edited islet cells comprise endogenous levels of one or more tolerogenic factors; and(iii) the engineered hypoimmune islet cells comprising modifications that (a) inactivate or disrupt one or more alleles of: (1) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate expression of the one or more MHC class I molecules, and (2) one or more MHC class II molecules or one or more molecules that regulate expression of the one or more MHC class II molecules; and (b) increase expression of one or more tolerogenic factors, wherein the increased expression is relative to a control or wild-type islet that does not comprise the modifications. The one or more tolerogenic factors may be selected from the group consisting of CD 16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, Cl inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4. B2M-HLA-E. CD27, IL-39, CD16 Fc Receptor, IL15-RF, H2-M3 (HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF. In a particular embodiment, the one or more tolerogenic factors is CD47.

[0016] In an embodiment, the engineered hypoimmunogenic islet cells comprise less than about 100%. 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25% or 20% of the composition comprising a dose of engineered hypoimmunogenic islet cells, or comprise between about 95-100%, 90%-95%, 85%-90%, 80%-85%, 75%-80%, 70%-75%, 65%-70%, 60%-65%, 55%-60%, 50%-55%, 45%-50%, 40%-45%, 35%-40%, 30%-35%, 25%-30%, or 20%-25% of the composition comprising a dose of engineered hy poimmunogenic islet cells, or comprise at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the composition comprising a dose of engineered hypoimmunogenic islet cells.

[0017] In an embodiment, the wild type islet cells comprise less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, or 1% of the composition comprising a dose of engineered hypoimmunogenic islet cells, or comprise between about l%-5%. 5%-10%. 10%-15%, 15%-20%, 20%-25%, 25%-30%, 30%-35%, 35%-40%, 40%-45%, or45%-50% of the composition comprising a dose of engineered hypoimmunogenic islet cells, or comprise at least about 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, or 45% of the composition comprising a dose of engineered hypoimmunogenic islet cells.

[0018] In an embodiment, the partially edited islet cells comprise less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, or 1% of the composition comprising a dose of engineered hypoimmunogenic islet cells, or comprise between about I %-5%, 5-10%, 10%-15%, 15%-20%, 20%-25%, 25%-30%. 30%-35%, 35%-40%, 40%-45%, or45%-50% of the composition comprising a dose of engineered hypoimmunogenic islet cells, or comprise at least about 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, or 45% of the composition comprising a dose of engineered hypoimmunogenic islet cells.

[0019] In any of the methods and compositions provided herein, the composition comprising a dose of engineered hypoimmunogenic islet cells may comprise alpha cells, beta cells, delta cells, and / or non-endocrine cells. In an embodiment, the composition of engineered hypoimmunogenic cells comprise sat least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%. 98%, or 99% beta cells. The composition of engineered hypoimmunogenic cells may further comprise at least 10%, 15%, 20%, 25%, or 30% alpha cells. The composition of engineered hypoimmunogenic cells may further comprise less than 20%. 15%, 10%, 5%, 4%, 3%. 2%, or 1% of delta cells. The composition of engineered hypoimmunogenic cells may further comprise less than 20%, 15%. 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%. or 1% of non-endocrine cells. In an embodiment, the composition of engineered hypoimmunogenic cells comprises between about 50%-90% beta cells, 10%-30% alpha cells, l%-20% delta cells, and 1%-20% non-endocrine cells. In another embodiment, the composition of engineered hypoimmunogenic cells comprises between about 60%-75% beta cells, 20-25% alpha cells, 5-10% delta cells, and 2-7% non-endocrine cells.

[0020] In any of the methods provided herein, the subject may not be administered an immunosuppressive regimen. In a particular embodiment, the subject is not administered an immunosuppressive regimen before, during, or after administering to the subject the composition. In any of the methods provided herein, the subject may not be administered an immunosuppressive regimen during or after administering the composition.Brief Description of the Drawings

[0021] FIGS. 1A-1B provide results of studies of allogeneic transplant studies evaluating nonhuman primate (NHP) recipient’s immune response to the allogeneic NHP primary islet cells.Quantification of BLI of luciferase expression is provided for transplanted B2M-7-; CIITA- -; CD-I 7":NHP primary islet cells (FIG.1A quantification; FIG. IB corresponding BLI image).

[0022] FIGS.2A-2D provide results of i.m. injection allogeneic transplant studies in NHPs evaluating immune response. Interferon gamma (IFNg) levels are provided for NHPs transplanted with B2M CIITA7; CD477gNHP primary islet cells (FIG.2A). Donor-specific antibodies (DSA) IgM levels (FIG.2B) and IgG levels (FIG. 2C) are provided NHPs transplanted with B2M7; CIITA ; CD47tg NHP primary islet cells. DSA IgG levels are also provided for a sensitized NHP transplanted with B2M-'-; CIITA-7-; CD47 / g NHP primary islet cells with elevated IgG levels prior to transplantation (FIG.2D).

[0023] FIG. 3 provides results of Natural Killer (NK) cell mediated cell killing in vitro of B2M- / _; CIITA-'; CD47 / g NHP primary' islet cells.

[0024] FIGS.4A-4D show phenotyping and allogeneic transplantation of B2M-7-; CIITA-7-; CD47'grhesus macaque primary islet cells. FIG.4A shows immunofluorescence staining of somatostatin, insulin, and glucagon (top panel) and CD47, MHC class I, and DAPI (bottom panel) before and after B2M-7-; CIITA-7-; CD47';editing. FIG.4B shows MHC class I, MHC class II, and rhesus CD47 expression in rhesus macaque islets before and after B2M-7-; CIITA-7-; CD47'!:editing. FIG.4C shows insulin release from in vitro rhesus macaque islets before and after B2M-7-; CIITA-7-; CD47":editing. FIG.4D shows the composition of rhesus macaque islets before and after B2M-7-; CIITA- -; CD47,gediting.

[0025] FIG. 5 shows blood glucose measurements for a diabetic non-human primate (NHP) transplanted with allogeneic B2M-7-; CIITA-7-; CD47fg NHP primary islet cells. Blood was collected in the morning (blood glucose AM) and in the afternoon (blood glucose PM). Diabetic: > 127 mg / dL; Impaired fasting glucose: > 80-127 mg / dL; Normal: < 80 mg / dL: and Hypoglycemia: < 30 mg / dL.

[0026] FIG. 6 shows blood glucose measurements for the diabetic non-human primate (NHP) transplanted with allogeneic B2M-7-; CIITA-7-; CD47tg NHP primary islet cells extended to day 111 post STZ. Blood was collected in the morning (blood glucose AM) and in the afternoon (blood glucose PM). Hyperglycemia (diabetic): > 127 mg / dL; Impaired fasting glucose: > 80-127 mg / dL; Normal: < 80 mg / dL; and Hypoglycemia: < 30 mg / dL.

[0027] FIG. 7 shows blood glucose measurements for the diabetic non-human primate (NHP) transplanted with allogeneic B2M-7-; CIITA-'-; CD47fg NHP primary islet cells extended to day' 226 post STZ. Blood was collected in the morning (blood glucose AM) and in the afternoon (blood glucose PM). Hyperglycemia (diabetic): > 127 mg / dL; Impaired fasting glucose: > 80-127 mg / dL; Normal: < 80 mg / dL; and Hypoglycemia: < 30 mg / dL.

[0028] FIG. 8A shows administration of daily exogenous insulin (U / day) over time. FIG.8B shows morning and evening blood glucose levels (mg / dL) over time. FIG.8C shows serum c-peptidelevels (ng / mL) over time. FIG. 8D shows weight (kg) over time. Asterisks indicate c-peptide measurement time points.

[0029] FIG. 9 shows C-peptide measurements for a diabetic non-human primate (NHP) transplanted with allogeneic B2M / _; CIITA / _; CD47ig NHP primary islet cells. Pre-STZ: C-peptide measurement prior to i.v. injection of streptozotocin (STZ); d50 post STZ: C-peptide measurement on day 50 (d50) post STZ injection; dO (d78 post STZ): C-peptide measurement on day 78 (d78) post STZ injection and day 0 of islet cell transplantation; d7 (d85 post STZ): C-peptide measurement on day 85 (d85) post STZ injection and day 7 post islet cell transplantation; dl4 (d92 post STZ): C-peptide measurement on day 92 (d92) post STZ injection and day 14 (dl4) post islet cell transplantation; d28 (dl06 post STZ): C-peptide measurement on day 106 (d 106) post STZ injection and day 28 (d28) post islet cell transplantation; d42 (dl20 post STZ): C-peptide measurement on day 120 (d 120) post STZ injection and day 42 (d42) post islet cell transplantation; d90 (dl72 post STZ): C-peptide measurement on day 172 (dl72) post STZ injection and day 90 (d90) post islet cell transplantation.

[0030] FIG. 10 shows glucose tolerance measurements for a diabetic non-human primate (NHP) transplanted with allogeneic B2M_ / ‘; CUT A CD47(g NHP primary islet cells. Pre-STZ: glucose tolerance measurement prior to i.v. injection of streptozotocin (STZ); d50 (post STZ): glucose tolerance measurement on day 50 (d50) post STZ injection; dl03 (d25 after cell transplant): glucose tolerance measurement on day 103 (dl 03) post STZ injection and day 25 (d25) post islet cell transplantation; merged: Pre-STZ, d50, and dl03.

[0031] FIGS. HA UL show cellular and antibody-mediated responses against B2M / _; CIITA / _; CD47':rhesus macaque primary islet cells. FIG. 11A shows ELISpot assays with recipient monkey PBMCs drawn at scheduled timepoints. FIGS. 11B-11E show killing assays with recipient cynomolgus monkey T cells (FIG. 11B), PBMCs (FIG. 11C), NK cells (FIG. 11D) and macrophages (FIG. HE).Percent target cell killing is shown on the y axis. FIGS. 11F-11I show Ig levels including total serum IgM (FIG. HF), IgG (FIG. 11G), donor specific antibody (DSA) IgM (FIG. 11H) and DSA IgG (FIG. HI). FIGS. 11J-11L show antibody -dependent cellular cytotoxicity (ADCC) assays with decomplemented recipient cynomolgus monkey serum andNK cells (FIG. 11 J) or macrophages (FIG. HK) and CDC assays with complete recipient monkey serum (FIG. HL). Percent target cell killing is shown on the y axis.

[0032] FIGS. 12A and 12B show rhesus macaque B2M / _; CIITA CD47 / gprimary islet cell killing by cynomolgus NK cells or macrophages in response to treatment with anti-CD47 antibody (magrolimab).

[0033] FIGS. 13A-13C show immunohistochemical stains of pancreas islets and the muscle primary islet transplantation site. FIG. 13A shows the pancreas from a healthy cynomolgus monkey. FIG. 13B shows tire pancreas of the recipient cynomolgus monkey. FIG. 13C shows the muscular implant site of the recipient cynomolgus monkey.

[0034] FIGS. 14A-14B show the characteristics of the donor islet cells and gene edited islet cells. FIG. 14A shows the donor islet cells on day 1 after isolation and stained with dithizone (DTZ) prior to dissociation or gene editing. FIG. 14B shows the cell type composition of the islets (alpha, beta, delta, and non-endocrine cells) in the HPC-beta cell DP and in unmodified islets.

[0035] FIGS. 15A-15B show various subpopulation of islet cells in the HPC-beta cell DP. FIG. 15A is a schematic of the various subpopulation of islet cells in the HPC-beta cell DP. FIG. 15B shows flow cytometry analyses of the final HPC-beta cell DP for the surface expression of HLA class I, HLA class II, and CD47. Percentages for HLA class I and II knockout and CD47 overexpression are presented.

[0036] FIGS. 16A-16F show adaptive immune responses to each subpopulation of islet cells in HPC-beta cell DP by CD3+ T cells isolated from the transplant recipient’s PBMCs drawn at the scheduled time points (baseline before transplantation) and Days 7 (1 week), 14 (2 weeks), 21 (3 weeks), and 28 (4 weeks), and 6, 8, 12, 16, and 26 weeks after transplantation. FIG.16A shows ELISpot assays with WT islet cells. FIG. 16B shows cytotoxicity assays with WT islet cells. FIG. 16C shows ELISpot assays with dKO islet cells. FIG. 16D shows cytotoxicity assays with dKO islet cells. FIG. 16E shows ELISpot assays with HIP islet cells. FIG. 16F shows cytotoxicity assays with HIP islet cells.

[0037] FIGS. 17A-17F show adaptive immune responses to each subpopulation of islet cells in HPC-beta cell DP by donor-specific antibodies in sera obtained from the transplant recipient at the scheduled time points (baseline before transplantation and Days 7 (1 week), 14 (2 weeks), 21 (3 weeks), and 28 (4 weeks), and 6, 8, 12, 16, and 26 weeks after transplantation. FIG.17A shows the level of donor specific antibody (DSA) IgM bound to WT islet cells. FIG.17B shows the level of DSA IgG bound to WT islet cells. FIG. 17C shows the level of DSA IgM bound to dKO islet cells. FIG. 17D shows the level of DSA IgG bound to dKO islet cells. FIG. 17E shows the level of DSA IgM bound to HIP islet cells. FIG. 17F shows the level of DSA IgG bound to HIP islet cells.

[0038] FIGS. 18A-18C show normalized cell indices from complement-dependent cytotoxicity (CDC) assays using complement-containing serum obtained from the transplant recipient at baseline (before transplantation), Days 7, 14, 21. and 28, and weeks 6, 8, 12, 16. and 26 after transplantation and tested against each subpopulation of islet cells in HPC-beta cell DP. FIG. 18A shows the normalized cell indices of WT islet cells. FIG. 18B shows the normalized cell indices of dKO islet cells. FIG. 18C shows the normalized cell indices of HIP islet cells.

[0039] FIGS. 19A-19C show normalized cell indices from antibody -dependent cellular cytotoxicity (ADCC) assays using de-complemented serum obtained from the transplant recipient at baseline before transplantation, Days 7, 14, 21, and 28. and weeks 6, 8, 12, 16. and 26 after transplantation, and tested against each subpopulation of islet cells in HPC-beta cell DP. FIG.19A shows the normalized cell indices of WT islet cells. FIG. 19B shows the normalized cell indices of dKO islet cells. FIG. 19C shows the normalized cell indices of HIP islet cells.

[0040] FIGS.20A-20C show the innate immune response by NK cells obtained from the transplant recipient at baseline before transplantation, Days 7, 14, 21, and 28, and weeks 6, 8, 12. 16, and 26 weeks after transplantation and tested against each subpopulation of islet cells in HPC-bcta cell DP.FIG. 20A shows the normalized cell indices of WT islet cells. FIG. 20B shows the normalized cell indices of dKO islet cells. FIG. 20C shows the normalized cell indices of HIP islet cells.

[0041] FIG. 20D shows the innate immune response by NK cells in the presence of an anti-CD47 antibody (Magrolimab) added to HIP islet cells incubated with NK cells obtained at baseline and at Week 12.

[0042] FIGS.20E-20G show imiate immune response by macrophages derived from fresh blood obtained from the transplant recipient at baseline before transplantation, at Days 7, 14. 21. 28, and weeks 6, 8, 12, 16. and 26 after transplantation and tested against each subpopulation of islet cells in HPC-beta cell DP. FIG.20E shows the normalized cell indices of WT islet cells. FIG.20F shows the normalized cell indices of dKO islet cells. FIG.20G shows the normalized cell indices of HIP islet cells.

[0043] FIGS. 21A-21C show the adaptive and innate immune responses by whole PBMCs and serum containing antibodies and complement obtained from the transplant recipient at baseline before transplantation, Days 7, 14. 21, 28, and weeks 6. 8, 12, 16, and 26 after transplantation and tested against each subpopulation of islet cells in HPC-beta cell DP. FIG. 21 A shows the normalized cell indices of WT islet cells. FIG.21B shows the normalized cell indices of dKO islet cells. FIG. 21 C shows the normalized cell indices of HIP islet cells.

[0044] FIG. 22 shows the basal C-peptide levels in the peripheral blood obtained from the transplant recipient at the scheduled time points baseline before transplantation, Days 7 (1 week), 14 (2 weeks), 21 (3 weeks), and 28 (4 weeks), and 6, 8, 12, 16, and 26 weeks after transplantation. Baseline was below the limit of detection and sensitivity was 0.48 pmol / L. Dots / standard deviation represent technical replicates.

[0045] FIGS.23A-23D show the level of stimulated C-peptide in plasma obtained from the transplant recipient in a Mixed Meal Tolerance Test (MMTT) before and at day 28 (FIG. 23A), week 8 (FIG.23B). week 12 (FIG.23C), and weeks 4. 8. 12, 18, and 26 (FIG. 23D) after transplantation. Standard deviation represents technical replicates.

[0046] FIGS. 24A-24B show the MR T2-STIR-weighted trans images showing signal in musculus brachioradialis. FIG. 24A shows the MRI image 28 days after transplantation. FIG. 24B shows the MRI image 8 weeks after transplantation. Red arrows indicate the location of some examples of injected cells.

[0047] FIGS.25A-25C show the total (FIG.25A) and per-kg insulin dose (FIG.25B) administered after islet transplantation and HbAlc levels (FIG.25C) from days 0 to day 84.

[0048] FIGS.26A-26F show adaptive immune responses to each subpopulation of islet cells in HPC-beta cell DP by CD3+ T cells isolated from the transplant recipient’s PBMCs drawn at the scheduled time points (baseline before transplantation) and months 6, 9, and 12 after transplantation.FIG. 26A shows ELISpot assays with WT islet cells. FIG.26B shows cytotoxicity assays with WT islet cells. FIG. 26C shows ELISpot assays with dKO islet cells. FIG.26D shows cytotoxicity assays with dKO islet cells. FIG.26E shows ELISpot assays with HIP islet cells. FIG.26F shows cytotoxicity assays with HIP islet cells.

[0049] FIGS.27A-27F show adaptive immune responses to each subpopulation of islet cells in HPC-beta cell DP by donor-specific antibodies in sera obtained from the transplant recipient at the scheduled time points (baseline before transplantation) and months 6. 9, and 12 after transplantation.FIG. 27A shows the level of donor specific antibody (DSA) IgM bound to WT islet cells. FIG. 27B shows the level of DSA IgG bound to WT islet cells. FIG.27C shows the level of DSA IgM bound to dKO islet cells. FIG.27D shows the level of DSA IgG bound to dKO islet cells. FIG.27E shows the level of DSA IgM bound to HIP islet cells. FIG. 27F shows the level of DSA IgG bound to HIP islet cells.

[0050] FIGS. 28A-28C show normalized cell indices from complement-dependent cytotoxicity (CDC) assays using complement-containing serum obtained from the transplant recipient at baseline (before transplantation), and months 6, 9, and 12 after transplantation and tested against each subpopulation of islet cells in HPC-beta cell DP. FIG.28A shows the normalized cell indices of WT islet cells. FIG. 28B shows the normalized cell indices of dKO islet cells. FIG.28C shows the normalized cell indices of HIP islet cells.

[0051] FIGS.29A-29C show normalized cell indices from antibody -dependent cellular cytotoxicity (ADCC) assays using de-complemented serum obtained from the transplant recipient at baseline before transplantation, and months 6, 9, and 12 after transplantation, and tested against each subpopulation of islet cells in HPC-beta cell DP. FIG.29A shows the normalized cell indices of WT islet cells. FIG.29B shows the normalized cell indices of dKO islet cells. FIG.29C shows the normalized cell indices of HIP islet cells.

[0052] FIGS.30A-30C show the iimate immune response by NK cells obtained from the transplant recipient at baseline before transplantation, and 6, 9. and 12 months after transplantation and tested against each subpopulation of islet cells in HPC-beta cell DP. FIG. 30A shows the normalized cell indices of WT islet cells. FIG.30B shows the normalized cell indices of dKO islet cells. FIG.30C shows the normalized cell indices of HIP islet cells.

[0053] FIGS.30D-30F show innate immune response by macrophages derived from fresh blood obtained from the transplant recipient at baseline before transplantation, at months 6. 9, and 12 after transplantation and tested against each subpopulation of islet cells in HPC-beta cell DP. FIG. 30Dshows the normalized cell indices of WT islet cells. FIG.30E shows the normalized cell indices of dKO islet cells. FIG. 30F shows the normalized cell indices of HIP islet cells.

[0054] FIGS.31A-31C show the adaptive and innate immune responses by whole PBMCs and serum containing antibodies and complement obtained from the transplant recipient at baseline before transplantation, and 6, 9, and 12 months after transplantation and tested against each subpopulation of islet cells in HPC-beta cell DP. FIG.31 A shows the normalized cell indices of WT islet cells. FIG.31B shows the normalized cell indices of dKO islet cells. FIG.31 C shows the normalized cell indices of HIP islet cells.

[0055] FIG. 32 shows the basal C-peptide levels in the peripheral blood obtained from the transplant recipient at the scheduled time points baseline before transplantation, and 6. 9, and 12 months after transplantation. Baseline was below the limit of detection and sensitivity was 0.48 pmol / L.Dots / standard deviation represent technical replicates.

[0056] FIG. 33 shows the level of stimulated C-peptide in plasma obtained from the transplant recipient in a Mixed Meal Tolerance Test (MMTT) before and at months 6 and 12 after transplantation.Detailed Description

[0057] Provided herein are methods involving dosing a subject with engineered islets that include beta cells that are engineered to evade the immune system (also referred to herein as a modified immune-evasive beta cell or a hypoimmunogenic (HIP) beta cell). In some embodiments, the engineered islets can be engineered primary islets. In some embodiments, the engineered islets can be engineered islet cells that have been differentiated from pluripotent stem cells. In some embodiments, the engineered islet cells, including engineered beta cells, exhibit features that allow them to evade immune recognition. In some embodiments, the engineered islets cells, including engineered beta cells, are hypoimmunogenic (also referred to as hypoimmune or HIP. In some aspects, the engineered islet cells, including engineered beta cells, are not subject to an innate immune cell rejection. In some aspects, the engineered islets cells, including engineered beta cells, provided herein exhibit reduced innate immune cell rejection and / or adaptive immune cell rejection (e.g. hypoimmunogenic cells). For example, in some embodiments, the engineered islet cells, including engineered beta cells, exhibit reduced susceptibility to NK cell-mediated lysis and / or macrophage engulfment. In some embodiments, the engineered islets and cells are useful as a source of universally compatible cells or tissues (e.g. universal donor cells or tissues) that are transplanted into a recipient subject. Such hypoimmunogenic cells retain cell-specific characteristics and features upon administration to a subject (e.g. transplantation or engraftment). In some embodiments, the engineered islet cells cluster into effective endocrine organoids, termed pseudo islet grafts (p-islets), when transplanted or engrafted in a subject. Thus, in some embodiments, the engineered islets are HIP pseudo-islets (HIP p-islets). In some embodiments, an effective endocrineorganoid provides stable endocrine function via production and secretion of insulin, thereby enabling insulin independence in the subject. In some embodiments, stable endocrine function and insulin independence occurs in the absence of immunosuppression. In some embodiments, the engineered islet cells, including engineered beta cells, can be used as a source of cells for allogeneic therapy regardless of the subject's genetic make-up.

[0058] In some embodiments, the provided methods are for treating a beta cell related disorder (e.g. diabetes) in a subject, such as to improve glucose tolerance in the subject. In particular embodiments, the methods are for treating Type I diabetes in a subject, such as to improve glucose tolerance in the subject. In other embodiments, the methods improve graft function of the provided islet cells. In some embodiments, the methods restore glucose metabolism in a subject.

[0059] Patients with type 1 diabetes mellitus (T1DM) or unpaired awareness of hypoglycemia (1AH) lack basic hypoglycemia-induced defense mechanisms, and are thus at increased risk for severe hypoglycemic events (Hwang et al., J Clin Invest (2018) 128:1485-195; Lin et al.. J Diabetes Investig (2020) 11:1388-1402). Current therapies for T1DM patients include intensive insulin treatment.However, these treatments can lead to sever hypoglycemia, which is associated with altered mental state, seizures, cardiac arrhythmias and even death (Bomstein et al.. Nat Rev Endocrinol (2022) 18:389-390).

[0060] Pancreatic islet transplantation has been shown to be superior to insulin therapies, with improved patient survival and quality’ of life (Boughton et al., Diabetes Obes Metab (2021) 23:1389-1396). However, transplantation of pancreatic islets in patients with T1DM is severely hampered by the requirement for continuous immunosuppression. Systemic immunosuppression to prevent the rejection of allogeneic islet grafts in patients comes with considerable morbidity’, including chronic kidney injury, infections and cancer, and a graft survival of only 4.4 to 5.9 years (Hering et al., Diabetes Care (2016) 39:1230-1240; Lemos et al., Diabetes Care (2021) 44:e67-e68; Marfil-Garza et al., Lancet Diabetes Endocrinol (2022) 10:519-532). Moreover, despite receiving immunosuppression, T1DM patients frequently become sensitized to the allogeneic transplant and develop elevated panel reactive antibodies, complicating any subsequent transplants. There is thus a need for improved methods for pancreatic islet transplantation, including for treating diabetes.

[0061] The provided embodiments address these needs. The provided embodiments relate to primary islets that have been engineered to be hypoimmune, thereby reducing or eliminating the need for immunosuppression. Particularly, results herein establish that allogeneic transplantation of primary, hypoimmune engineered, beta islet cells into a fully immunocompetent, diabetic non-human primate model provided stable endocrine function, and enabled insulin independence without inducing any detectable immune response in the absence of immunosuppression. Thus, the present disclosure demonstrates that hypoimmune primary beta islet cells provide a novel and curative cell therapy for T1DM, and can do so with reduced or no requirement for immunosuppression.

[0062] In some embodiments, the engineered islets, including engineered beta cells, described herein are hypoimmunogenic when administered (e.g. transplanted or grafted), and in some embodiments, evade immune rejection. Non-limiting examples of modifications that result in evading immune rejection include reduced expression of major histocompatibility complex (MHC) human leukocyte antigen (HLA) class I antigens and HLA class II antigens, and increased expression of one or more tolerogenic factors, such as CD47. In some embodiments, the engineered islets, including engineered beta cells, are administered in an MHC -mismatched allogenic subject.

[0063] In some embodiments, the engineered islet cells, including engineered beta cells, contain modifications that (a) reduce expression of one or more major histocompatibility complex (MHC) class I molecules and / or one or more of MHC class II molecules; and (b) increase expression of one or more tolerogenic factors in the engineered islets, relative to a control or a wild-type beta cell. In some embodiments, the modifications make the cells hypoimmune, which in some aspects allow the cells to evade immune rejections compared to control or wild-type islet cells, such as primary human islet cells beta cells. For purposes herein, the terms engineered islets can be used interchangeably with the term hypoimmune derived islets.

[0064] The engineered islets include engineered cells, such as engineered beta cells, that utilize expression of tolerogenic factors and are also modulated (e.g. reduced or eliminated) for expression (e.g. surface expression) of one or more MHC class I molecules and / or one or more MHC class II molecules. In some embodiments, the modification that reduces expression of one or more MHC class I molecules is a modification that reduces expression of [3-2 microglobulin (B2M). In some embodiments, the modification that reduces expression of one or more MHC class II molecules is a modification that reduces expression of CIITA. In some embodiments, the engineered cells comprising the modifications described herein (including reduced or eliminated expression of MHC class I molecules or MHC class II molecules and increased expression of CD47 or other tolerogenic factor) survive, engraft, persist, and function following administration (e.g. transplant or engraftment). In some embodiments, cells of the engineered islets exhibit enhanced survival and / or enhanced engraftment and / or function for a longer term in comparison to control or wild-type islets, such as unmodified islet cells that do not comprise the modifications rendering the cells hypoimmune.

[0065] In some embodiments, the engineered islets are administered via intramuscular injection (e.g. intramuscular injection to the forearm).

[0066] In some embodiments, genome editing technologies utilizing rare-cutting endonucleases (e.g. the CRISPR / Cas, TALEN, zinc finger nuclease, meganuclease, and homing endonuclease systems) are used to reduce or eliminate expression of immune genes (e.g. by deleting genomic DNA of critical immune genes) as described herein, such as genes involved in regulating expression of MHC class I molecules or MHC class II molecules, in islet cells used to derive the engineered islets. In certain embodiments, genome editing technologies or other gene modulation technologies are used to inserttolerance -inducing (tolerogenic) factors (e.g. CD47) into a target genomic locus of islet cells used to derive the engineered islets, thus producing engineered islets that can evade immune recognition upon engrafting into a recipient subject. Therefore, the engineered islets exhibit modulated expression (e.g. reduced or eliminated expression) of one or more genes and factors that affect expression of MHC class I molecules and / or MHC class II molecules, modulated expression (e.g. reduced or and modulated expression (e.g. ovcrcxprcssion) of tolerogenic factors, such as CD47, and provide for reduced recognition by the recipient subject’s immune system. In some embodiments, the modified cells can also exhibit modulated expression (e.g. reduced expression) of CD 142, which, in some aspects, can also be reduced by genome editing technologies (e.g. the CRISPR / Cas, TALEN, zinc finger nuclease, meganuclease, and homing endonuclease systems) to reduce or eliminate expression of CD 142 (e.g. by deleting genomic DNA of critical immune genes). In some embodiments, the engineered islets can exhibit modulated expression (e.g. increased expression) of one or more complement inhibitors selected from CD46, CD59, CD55 and CD35, which, in some aspects, can also be increased by genome editing technologies to insert or integrate an exogenous polynucleotide encoding the one or more complement inhibitors into a genomic locus in the engineered islets.

[0067] In some embodiments, the beta cell related disorder is a metabolic disorder. In some embodiments, the metabolic disorder is familial hypercholesterolemia, Gaucher disease. Hunter syndrome. Krabbe disease, maple syrup urine disease, metachromatic leukodystrophy, mitochondrial encephalopathy, lactic acidosis, stroke-like episodes (MELAS). Niemann-Pick disease, phenylketonuria (PKU), porphyria, Tay-Sachs disease, Wilson's disease, Type I diabetes. Type II diabetes, obesity, hypertension, dyslipidemia, or carbohydrate intolerance. In some embodiments, the beta cell related disorder is Type I diabetes.

[0068] The practice of the particular embodiments will employ, unless indicated specifically to the contrary', conventional methods of chemistry, biochemistry', organic chemistry, molecular biology', microbiology', recombinant DNA techniques, genetics, immunology', and cell biology' that are within the skill of the art, many of which arc described below for the purpose of illustration. Such techniques arc explained fully in the literature. See e.g. Sambrook, et al., Molecular Cloning: A Laboratory Manual (3rd Edition, 2001); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Maniatis et al., Molecular Cloning: A Laboratory Manual (1982); Ausubel et al., Current Protocols in Molecular Biology (John Wiley and Sons, updated July 2008); Short Protocols in Molecular Biology : A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley -Interscience; Glover, DNA Cloning: A Practical Approach, vol. I & II (IRL Press, Oxford, 1985); Anand, Techniques for the Analysis of Complex Genomes, (Academic Press, New York, 1992);Transcription and Translation (B. Hames & S. Higgins, Eds.. 1984); Perbal. A Practical Guide to Molecular Cloning (1984); Harlow and Lane, Antibodies, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1998) Current Protocols in Immunology Q. E. Coligan, A. M. Kruisbeek, D. H.Margulies. E. M. Shevach and W. Strober, eds., 1991); Annual Review of Immunology; as well as monographs in journals such as Advances in Immunology.

[0069] All publications, including patent documents, scientific articles and databases, referred to in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were individually incorporated by reference. If a definition set forth herein is contrary to or otherw ise inconsistent with a definition set forth in the patents, applications, published applications and other publications that are herein incorporated by reference, the definition set forth herein prevails over the definition that is incorporated herein by reference.

[0070] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. Those skilled in the art will recognize that several embodiments are possible within the scope and spirit of the present disclosure. The following description illustrates the disclosure and. of course, should not be construed in any way as limiting the scope of the inventions described herein.I. METHODS AND DOSING OF A BETA CELL THERAPY

[0071] In some aspects, provided herein is a method of treating a beta cell related disorder in a subject, the method comprising administering to a subject engineered islets as described. The engineered islets administered to a subject according to the methods provided herein include cells that have been modified to evade immune rejection. In some embodiments, the engineered islets are administered as an islet cluster. In particular embodiments, tire engineered islets include engineered beta cells. In some embodiments, the engineered beta cell is in a composition comprising additional islet cells. In some embodiments, the islets, such as islet cluster, further comprises alpha cells and / or delta cells. In some embodiments, the islets, such as islet cluster, further comprises epsilon cells and / or PP cells. In some embodiments, cells of the engineered islets include the same hypoimmune modifications. In particular embodiments, cells of the engineered islets include beta cells modified with hypoimmune modifications. Exemplary features of the engineered islets, including engineered or engineered islets, for use in the provided methods are described in Section II.

[0072] The engineered cells provided herein can be administered to a subject for the treatment of a beta cell related disease or disorder. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.

[0073] In some embodiments, the beta cell related disorder is a metabolic disorder. A metabolic disorder may occur when abnormal chemical reactions in the body of a subject disrupts metabolic processes (e.g. processes related to the metabolism, or breakdown, of energy into sugars and acids or the storage of said energy). In some embodiments, the metabolic disorder affects the breakdown of amino acids, carbohydrates, or lipids in a subject’s body. In some embodiments, the metabolic disorder affects the subject’s mitochondria (e.g. mitochondrial diseases). In some embodiments, the metabolic disorderdevelops when the subject’s organs, such as the liver or pancreas, become disease and / or do not function normally. Exemplar}' metabolic disorders herein may comprise, but are not limited to, any disease or disorder characterized by increased blood pressure, high blood sugar, excess body fat around tire waist, and abnormal cholesterol or triglyceride levels. In some embodiments, the metabolic disorder is familial hypercholesterolemia, Gaucher disease, Hunter syndrome, Krabbe disease, maple syrup urine disease, mctachromatic leukodystrophy, mitochondrial encephalopathy, lactic acidosis, strokc-likc episodes (MELAS), Niemann-Pick disease, phenylketonuria (PKU), porphyria, Tay-Sachs disease, Wilson's disease, Type I diabetes, Type II diabetes, obesity, hypertension, dyslipidemia, or carbohydrate intolerance. In some embodiments, the metabolic disorder is Type II diabetes. In some embodiments, the metabolic disorder is Type I diabetes. In some embodiments, the metabolic disorder is Type I diabetes mellitus.

[0074] In some embodiments, the beta cell disorder is a metabolic disorder. In some embodiments, the metabolic disorder is selected from the group consisting of: familial hypercholesterolemia, Gaucher disease. Hunter syndrome. Krabbe disease, maple syrup urine disease, metachromatic leukodystrophy, mitochondrial encephalopathy, lactic acidosis, stroke-like episodes (MELAS), Niemann-Pick disease, phenylketonuria (PKU), porphyria, Tay-Sachs disease, Wilson's disease. Type I diabetes. Type II diabetes, obesity, hypertension, dyslipidemia, and carbohydrate intolerance. In some embodiments, the disorder is diabetes. In some embodiments, the disorder is Type I diabetes.A. Islet Cells

[0075] In some embodiments, the engineered islets, including engineered beta cells, have the ability to evade the immune system. In some embodiments, the engineered islets, including engineered beta cells, comprises modifications that: (a) reduce expression of one or more of major histocompatibility complex (MHC) class I molecules and / or one or more of MHC class II molecules in the engineered islets, relative to a control or wild-type islet cell; and (b) increase expression of one or more tolerogenic factors in the engineered cell, relative to the control or wild-type islet cell, such as relative to the control or wildtype beta cell. In some embodiments, the engineered islets, including engineered beta cells, comprise modifications that reduce expression of B2M in the engineered cell, relative to the control or wild-type islet cell, such as control or wild-type beta cell. In some embodiments, the engineered islet cell comprises modifications that reduce expression of CIITA in the modified islet cell, relative to the control or wildtype islet cell, such as relative to the control or wild-type beta cell. In some embodiments, the engineered islet cell comprises modifications that increase expression of CD47 in the engineered islet cell, relative to the control or wild-type islet cell, such as relative to the control or wild-ty pe beta cell. In some embodiments, the engineered islet cells, such as engineered beta cell, comprises modifications that: (a) reduce expression of B2M, relative to a control or wild-type islet cell; (b) reduce expression of CIITA,relative to a control or wild-type islet cell; and (c) increase expression of CD47 in the engineered islet cell, relative to the control or wild-type islet cell.

[0076] In some embodiments, the islets are primary islets that have been engineered with a hypoimmune modification as described. In some embodiments, the primary islets are human. In some embodiments, the primary islets are allogeneic. In some embodiments, the primary islets are autologous. In some embodiments, the islet cells, including beta cells, are cells that have been differentiated from stem cells and that are engineered with a hypoimmune modification as described. In some embodiments, the stem cell is selected from the group consisting of a pluripotent stem cell (PSC), an induced pluripotent stem cell (iPSC), an embryonic stem cell, a hematopoietic stem cell, a mesenchymal stem cell, an endothelial stem cell, an epithelial stem cell, an adipose stem cell, a germline stem cell, a lung stem cell, a cord blood stem cell, and a multipotent stem cell. In some embodiments, the stem cell is a pluripotent stem cell (PSC). In some embodiments, the stem cell is an induced pluripotent stem cell (iPSC), mesenchymal stem cell (MSC). hematopoietic stem cell (HSC), or embryonic stem cell (ESC). In some embodiments, the stem cell is in a suspension.

[0077] In some embodiments, the islets cells are primary islet cells (also referred to as pancreatic islet cells). In particular embodiments, the primary islet cells include primary7beta islet cells (pancreatic beta islet cells). In some embodiments, the primary7islets are isolated or obtained from one or more individual donor subjects, such as one or more individual healthy donor (e.g. a subject that is not known or suspected of. e.g. not exhibiting clinical signs of, a disease or infection). In some embodiments, the donor is a cadaver. As will be appreciated by those in the art, methods of isolating or obtaining islets from an individual can be achieved using known techniques.

[0078] In some embodiments, islet cells are obtained (e.g. , harvested, extracted, removed, or taken) from a subject or an individual. In some embodiments, primary' islet cells are produced from a pool of islet cells such that the islet cells are from one or more subjects (e g., one or more human including one or more healthy humans). In some embodiments, the pool of primary islet cells is from 1-100, 1-50, 1-20, 1-10, 1 or more, 2 or more, 3 or more. 4 or more, 5 or more, 10 or more, 20 or more, 30 or more, 40 or more, 50 or more, or 100 or more subjects. In some embodiments, the donor subject is different from the patient (e.g. the recipient subject that is administered the therapeutic cells). In some embodiments, the pool of islet cells does not include cells from the patient. In some embodiments, one or more of the donor subjects from which the pool of islets cells is obtained are different from the patient.

[0079] Additional descriptions of pancreatic islet cells including for use in the present technology are found in W02020 / 018615, the disclosure is herein incorporated by reference in its entirety.

[0080] In some embodiments, the population of engineered primary islet cells, including primary beta islet cells, isolated from one or more individual donors (e.g. healthy donors) are maintainedin culture, in some cases expanded, prior to administration. In certain embodiments, the population of engineered islet cells are cryopreserved prior to administration.

[0081] Exemplary pancreatic islet cell types include, but are not limited to, pancreatic islet progenitor cell, immature pancreatic islet cell, mature pancreatic islet cell, and the like. In some embodiments, pancreatic cells described herein are administered to a subject to treat diabetes.

[0082] In some embodiments, the pancreatic islet cells disclosed herein, such as primary beta islet cells isolated from one or more individual donors (e.g. healthy donors), secretes insulin. In some embodiments, a pancreatic islet cell exhibits at least tw o characteristics of an endogenous pancreatic islet cell, for example, but not limited to, secretion of insulin in response to glucose, and expression of beta islet cell markers.

[0083] In some embodiments, the primary islets (e.g.. the engineered primary islets) are autologous. In particular embodiments, the primary islets are isolated or obtained from a patient (e.g., a patient that is known or suspected of having diabetes (e.g., Type I diabetes) and is need of a treatment). As will be appreciated by those in the art, methods of isolating or obtaining islets from an individual (e.g., a patient) can be achieved using known techniques. In some embodiments, the patient is known or suspected of having autoimmune diabetes mellitus (Type 1 A). In some embodiments where the primary islets (e.g.. the engineered primary islets) are autologous, the patient (from which the primary islets are obtained and who has or is suspected of having diabetes) has antibodies or autoantibodies associated with the patient’s diabetes. In some embodiments where the primary islets are autologous, the patient (from which the primary islets are obtained and who has or is suspected of having diabetes) has antibodies or autoantibodies associated with the patient’s autoimmune diabetes mellitus (Type 1A). Non-limiting examples of antibodies or autoantibodies include, without limitation: islet cell antibodies (ICA (e.g., against cy toplasmic proteins in islet cells)), antibodies to glutamic acid decarboxy lase (GAD-65) (“GAD A’’), insulin autoantibodies (IAA), IA2A to protein ty rosine phosphatase, and zinc transporter 8 (ZnT8).

[0084] In some embodiments, islet cells are obtained (e.g., harvested, extracted, removed, or taken) from a subject (e.g., a patient). In some embodiments, primary islet cells are produced from a pool of islet cells such that the islet cells are from one or more subjects (e.g.. one or more human including one or more healthy humans and the patient). In some embodiments, the pool of primary islet cells is from 1-100, 1-50, 1-20, 1-10, 1 or more, 2 or more, 3 or more, 4 or more, 5 or more. 10 or more, 20 or more. 30 or more, 40 or more, 50 or more, or 100 or more subjects where one or more of the islets are from the patient. In some embodiments, the donor subject is different from the patient (e.g. the recipient subject that is administered the therapeutic cells). In some embodiments, the donor subject is the patient (e.g. the patient is administered the therapeutic cells).

[0085] In some embodiments, the population of engineered primary islet cells, including primary beta islet cells, isolated from the patient and one or more individual donors (e.g. healthy donors)are maintained in culture, in some cases expanded, prior to administration. In certain embodiments, the population of engineered islet cells are cryopreserved prior to administration.

[0086] Exemplary pancreatic islet cell types that are isolated from the patient include, but are not limited to, pancreatic islet progenitor cell, immature pancreatic islet cell, mature pancreatic islet cell, and the like. In some embodiments, pancreatic cells described herein are administered to a subject to treat diabetes.

[0087] In some embodiments, the pancreatic islet cells disclosed herein, such as primary beta islet cells isolated from the patient and one or more individual donors (e.g. healthy donors), secretes insulin. In some embodiments, a pancreatic islet cell exhibits at least tw o characteristics of an endogenous pancreatic islet cell, for example, but not limited to, secretion of insulin in response to glucose, and expression of beta islet cell markers.

[0088] Exemplary' beta islet cell markers or beta islet cell progenitor markers include, but are not limited to, c-peptide, Pdxl, glucose transporter 2 (Glut2), HNF6. VEGF, glucokinase (GCK), prohormone convertase (PC 1 / 3), Cdcpl. NeuroD, Ngn3, Nkx2.2, Nkx6.1, Nkx6.2, Pax4, Pax6, Ptfla, Isll, Sox9, Soxl7. and FoxA2.

[0089] In some embodiments, the primary pancreatic islet cells may be isolated from a primary pancreatic islet, derived from primary pancreatic islet cells within a primary pancreatic islet, or as a component of a primary pancreatic islet. For example, primary pancreatic beta islet cells can be edited as a single beta islet cell, a population of beta islet cells, or as a component of a primary' pancreatic islet (e.g., primary’ pancreatic beta islet cells present within the primary’ pancreatic islet along with other cell ty pes). As another example, primary pancreatic beta islet cells can be administered to a patient as single beta islet cells, a population of beta islet cells, or as a component of a primary pancreatic islet (e.g., primary pancreatic beta islet cells present within the primary pancreatic islet along with other cell types). In embodiments where the pancreatic beta islet cells are present within the pancreatic islet along with other cell types, the other cell types may also be edited by the methods described herein.

[0090] In some embodiments, the primary pancreatic islet cells are dissociated from a primary islet prior to or after engineering, such as genetic engineering. Such dissociated islet cells can be clustered prior to administration to a patient and clusters can include beta islet cells as well as other cell types including but not limited to those from the primary islet. Numbers of islet cells in the cluster can vary, such as about 50. about 100, about 250, about 500. about 750, about 1000. about 1250. about 1500. about 1750. about 2000, about 2250, about 2500, about 2750, about 3000, about 3500. about 4000. about 4500, or about 5000 cells. Patients can be administered about 10, about 20, about 30, about 40, about 50, about 75, about 100, about 125, about 150, about 200, about 250, about 300, about 325, about 350, about 375, about 400, about 425, about 450, about 475, about 500, about 600, about 700, about 800, about 900, or about 1000 clusters.

[0091] In some embodiments, the primary pancreatic islet cells, isolated from one or more individual donors (e.g.. healthy donors), produce insulin in response to an increase in glucose. In some embodiments, the pancreatic islet cells arc beta islet cells. In some embodiments, the beta islet cells arc monitored to assess glucose control abilities. Assays to monitor glucose control may include, but are not limited to, continuous blood glucose level monitoring, monitoring blood glucose levels after a period of fasting, glucose tolerance (e.g., glucose challenge) tests, glucose utilization and oxidation, insulin secretion, such as by a U-PLEX® Meso Scale Discovery (MSD) assay and / or glucose-stimulated insulin secretion (GSIS) assays, measuring the presence of specific transcription factors and pathways (e.g., homeobox transcription factor SIX2, NKX6-1, and PDX1), measuring mitochondrial respiration, and measuring changes in intracellular Ca2+ calcium flux, such as glucose-induced Ca2+ rise, Ca2+-activated exocytosis. Various methods of measuring glucose control are known in the art, such as those described in Velazco-Cruz et al., Cell Reports, 2020, 31. 107687; Pagliuca et al., Cell. 2014. 159(2): 428-439; Davis et al., Cell Reports, 2020, 31(6): 107623: and Alcazar et al.. Cell Transplantation, 2020, 29. the disclosures including the figures, figure legends, and description of methods are incorporated herein by reference in their entirety. In some embodiments, the beta islet cells (e.g., modified beta islet cells) may exhibit GSIS. In some embodiments, the GSIs measured in a perfusion GSIS assay. In some embodiments, the GSIs dynamic GSIS comprising first and second phase dynamic insulin secretion. In some embodiments, the GSIs static GSIS. For example, the static incubation index may be greater than at or about 1. greater than at or about 2, greater than at or about 5. greater than at or about 10 or greater than at or about 20. In various embodiments, the pancreatic islet cells secrete insulin in response to an increase in glucose. In some embodiments, the cells have a distinct morphology such as a cobblestone cell morphology and / or a diameter of about 17 pm to about 25 pm.

[0092] In some embodiments, the primary pancreatic islets, or a composition containing the same, provided herein are useful for the treatment of a patient sensitized from one or more antigens present in a previous transplant such as, for example, a cell transplant, a blood transfusion, a tissue transplant, or an organ transplant, hr certain embodiments, the previous transplant is an allogeneic transplant and the patient is sensitized against one or more alloantigens from the allogeneic transplant. Allogeneic transplants include, but are not limited to, allogeneic cell transplants, allogeneic blood transfusions, allogeneic tissue transplants, or allogeneic organ transplants. In some embodiments, the patient is sensitized patient who is or has been pregnant (e.g., having or having had alloimmunization in pregnancy). In certain embodiments, the patient is sensitized from one or more antigens included in a previous transplant, wherein the previous transplant is a modified human cell, tissue or organ. In some embodiments, the modified human cell, tissue or organ is a modified autologous human cell, tissue or organ. In some embodiments, the previous transplant is a non-human cell, tissue or organ. In exemplary embodiments, the previous transplant is a modified non-human cell, tissue, or organ. In certain embodiments, the previous transplant is a chimera that includes a human component. In certainembodiments, the previous transplant is a CAR T-cell. In certain embodiments, the previous transplant is an autologous transplant and the patient is sensitized against one or more autologous antigens from the autologous transplant. In certain embodiments, the previous transplant is an autologous cell, tissue or organ. In certain embodiments, the sensitized patient has an allergy and is sensitized to one or more allergens. In exemplary embodiments, the patient has a hay fever, a food allergy, an insect allergy , a drug allergy’ or atopic dermatitis.

[0093] In some embodiments, the cell used to generate the engineered islet cell is a stem or progenitor cell that is capable of being differentiated (e.g. the stem cell is totipotent, pluripotent, or multipotent). In some embodiments, the cell isolated from embryonic or neonatal tissue. In some embodiments, the cell is an embryonic stem cell. In some embodiments, the cell is an induced pluripotent stem cell derived from somatic cells (e.g. skin or blood cells) and reprogrammed into an embry onic-like pluripotent state. In some embodiments, the induced pluripotent stem cell is derived from a fibroblast. In some embodiments, the cells that are modified as provided herein are pluripotent stems cells or are cells differentiated from pluripotent stem cells. The cell may be a vertebrate cell, for example, a mammalian cell, such as a human cell or a mouse cell. The cell may also be a vertebrate stem cell, for example, a mammalian stem cell, such as a human stem cell or a mouse stem cell. In embodiments, the cell or stem cell is amenable to modification. The cell or stem cell, or a cell derived from such a stem cell, can have therapeutic value, such that the cell or stem cell or a cell derived or differentiated from such stem cell may be used to treat a disease, disorder, defect or injury in a subject in need of treatment for same.

[0094] In some embodiments, the islet cells, including beta cells, that are modified or engineered as provided herein are modified pluripotent stem cells (e.g. modified iPSC). The generation of mammalian (e.g. mouse and human) pluripotent stem cells (generally referred to as iPSCs; miPSCs for murine cells or hiPSCs for human cells) is generally known in the art. As will be appreciated by those in the art, there are a variety’ of different methods for the generation of iPSCs. The original induction was done from mouse embryonic or adult fibroblasts using the viral introduction of four transcription factors, Oct3 / 4, Sox2, c-Myc and Klf4; see Takahashi and Yamanaka Cell 126:663-676 (2006), hereby incorporated by reference in its entirety and specifically for the techniques outlined therein. Since then, a number of methods have been developed; see Seki et al, World J. Stem Cells 7(1): 116-125 (2015) for a review, and Lakshmipathy and Vennuri, editors, Methods in Molecular Biology: Pluripotent Stem Cells, Methods and Protocols, Springer 2013, both of which are hereby expressly incorporated by reference in their entirety', and in particular for the methods for generating hiPSCs (see for example Chapter 3 of the latter reference).

[0095] Generally, iPSCs are generated by the transient expression of one or more reprogramming factors" in the host cell, usually introduced using episomal vectors. Under these conditions, small amounts of the cells are induced to become iPSCs (in general, the efficiency of this stepis low, as no selection markers are used). Without wishing to be bound by theory, it is believed that once the cells are "reprogrammed", and become pluripotent, they lose the episomal vector(s) and produce the factors using the endogenous genes.

[0096] As is also appreciated by those of skill in the art, the number of reprogramming factors that can be used or are used can vary. Commonly, when fewer reprogramming factors are used, the efficiency of the transformation of the cells to a pluripotent state goes down, as well as the "pluripotency", e.g. fewer reprogramming factors may result in cells that are not fully pluripotent but may only be able to differentiate into fewer cell types.

[0097] In some embodiments, a single reprogramming factor, OCT4, is used. In other embodiments, two reprogramming factors, OCT4 and KLF4. are used. In other embodiments, three reprogramming factors, OCT4. KLF4 and SOX2, are used. In other embodiments, four reprogramming factors, OCT4, KLF4, SOX2 and c-Myc, are used. In other embodiments. 5, 6 or 7 reprogramming factors can be used selected from SOKMNLT; SOX2. OCT4 (POU5F1), KLF4. MYC, NANOG, LIN28. and SV40L T antigen. In general, these reprogramming factor genes are provided on episomal vectors such as are known in the art and commercially available.

[0098] In some embodiments, the host cells used for transfecting the one or more reprogramming factors are non-pluripotent stem cells. In general, as is known in the art, iPSCs are made from non-pluripotent cells such as, but not limited to, blood cells, fibroblasts, etc., by transiently expressing the reprogramming factors as described herein. In some embodiments, the non-pluripotent cells, such as fibroblasts, are obtained or isolated from one or more individual subjects or donors prior to reprogramming the cells. In some embodiments, iPSCs are made from a pool of isolated non-pluripotent stems cells, e.g. fibroblasts, obtained from one or more (e.g. two or more, three or more, four or more, five or more, ten or more, twenty or more, fifty or more, or one hundred or more) different donor subjects. In some embodiments, the non-pluripotent cells, such as fibroblasts, are isolated or obtained from a plurality of different donor subjects (e.g. two or more, three or more, four or more, five or more, ten or more, twenty or more, fifty or more, or one hundred or more), pooled together in a batch, reprogrammed as iPSCs and are modified in accord with the provided methods.

[0099] In some embodiments, the iPSCs are derived from, such as by transiently transfecting one or more reprogramming factors into cells from a pool of non-pluripotent cells (e.g. fibroblasts) from one or more donor subjects that are different than the recipient subject (e.g. the patient administered the cells). The non-pluripotent cells (e.g. fibroblasts) to be induced to iPSCs can be obtained from 1. 2, 3, 4, 5. 6, 7, 8, 9. 10, 20, 50, 100 or more donor subjects and pooled together. The non-pluripotent cells (e.g. fibroblasts) can be obtained from 1 or more. 2 or more, 3 or more, 4 or more, 5 or more. 6 or more. 7 or more. 8 or more, 9 or more, 10. or more 20 or more. 50 or more, or 100 or more donor subjects and pooled together. In some embodiments, the non-pluripotent cells (e.g. fibroblasts) are harvested from one or a plurality of individuals, and in some instances, the non-pluripotent cells (e.g. fibroblasts) or thepool of non-pluripotent cells (e.g. fibroblasts) are cultured in vitro and transfected with one or more reprogramming factors to induce generation of iPSCs. In some embodiments, the non-pluripotent cells (e.g. fibroblasts) or the pool of non-pluripotent cells (e.g. fibroblasts) are modified in accord with the methods provided herein. In some embodiments, the modified iPSCs or a pool of modified iPSCs are then subjected to a differentiation process for differentiation into any cells of an organism and tissue.

[0100] The PSCs can be differentiated into beta cells of an organism and tissue. In an aspect, provided herein are modified cells that are differentiated into beta cells from iPSCs for after administration into recipient subjects. Differentiation can be assayed as is known in the art, generally by evaluating the presence of cell-specific markers. As will be appreciated by those in the art, the differentiated modified (e.g. hypoimmunogenic) pluripotent cell derivatives can be transplanted using techniques known in the art that depends on both the cell type and the ultimate use of these cells.Exemplary types of differentiated cells and methods for producing the same are described below. In some embodiments, the iPSCs may be differentiated to beta cells. In some embodiments, the iPSCs are differentiated into beta islet cells. In some embodiments, host cells such as non-pluripotent cells (e.g. fibroblasts) from an individual donor or a pool of individual donors are isolated or obtained, generated into iPSCs in which the iPSCs are then modified to contain modifications (e.g. genetic modifications) described herein and then differentiated into a desired cell type.

[0101] In some embodiments, the cells are beta islet cells derived from modified iPSCs that contain modifications (e.g. genetic modifications) described herein and that are differentiated into beta islet cells. As will be appreciated by those in the art. the methods for differentiation depend on the desired cell type using known techniques. In some embodiments, the cells differentiated into various beta islet cells may be used for after transplantation or engraftment into subjects (e.g. recipients). In some embodiments, pancreatic islet cells are derived from the modified pluripotent cells described herein. Useful methods for differentiating pluripotent stem cells into beta islet cells are described, for example, in U.S. Patent No. 9,683,215; U.S. Patent No. 9,157,062; U.S. Patent No. 8,927,280; U.S. Patent Pub. No. 2021 / 0207099; Hogrcbc ct al., “Targeting the cytoskeleton to direct pancreatic differentiation of human pluripotent stem cells,” Nat. Biotechnol., 2020, 38:460-470; and Hogrebe et al., “Generation of insulin-producing pancreatic beta cells from multiple human stem cell lines,” Nat. Protoc., 2021, the contents of which are herein incorporated by reference in their entirety,

[0102] In some embodiments, the modified pluripotent cells described herein are differentiated into beta-like cells or islet organoids for transplantation to address type I diabetes mellitus (T1DM). Cell systems are a promising way to address T1DM, see, e.g. Ellis et al, Nat Rev Gastroenterol Hepatol. 2017 Oct; 14(10): 612-628. incorporated herein by reference. Additionally, Pagliuca et al. (Cell, 2014, 159(2) :428-39) reports on the successful differentiation of beta-cells from hiPSCs, the contents incorporated herein by reference in its entirety and in particular for the methods and reagents outlined there for the large-scale production of functional human beta cells from human pluripotent stem cells).Furthermore, Vegas et al. shows the production of human beta cells from human pluripotent stem cells followed by encapsulation to avoid immune rejection by the host; Vegas et al., Nat Med, 2016, 22(3):306-l 1, incorporated herein by reference in its entirety and in particular for the methods and reagents outlined there for the large-scale production of functional human (3 cells from human pluripotent stem cells.

[0103] In some embodiments, the method of producing a population of modified pancreatic islet cells from a population of modified pluripotent cells by in vitro differentiation comprises: (a) culturing the population of modified iPSCs in a first culture medium comprising one or more factors selected from the group consisting insulin-like growth factor, transforming growth factor, FGF, EGF, HGF, SHH, VEGF, transforming growth factor -b superfamily, BMP2, BMP7, a GSK inhibitor, an ALK inhibitor, a BMP type 1 receptor inhibitor, and retinoic acid to produce a population of immature pancreatic islet cells; and (b) culturing the population of immature pancreatic islet cells in a second culture medium that is different than the first culture medium to produce a population of modified pancreatic islet cells. In some embodiments, the GSK inhibitor is CHIR-99021, a derivative thereof, or a variant thereof. In some instances, the GSK inhibitor is at a concentration ranging from about 2 mM to about 10 mM. In some embodiments, the ALK inhibitor is SB-431542, a derivative thereof, or a variant thereof. In some instances, the ALK inhibitor is at a concentration ranging from about 1 pM to about 10 pM. In some embodiments, the first culture medium and / or second culture medium are absent of animal serum.

[0104] Differentiation is assayed as is known in the art, generally by evaluating the presence of (3 cell associated or specific markers, including but not limited to, insulin. Differentiation can also be measured functionally, such as measuring glucose metabolism, see generally Muraro et al.. Cell Syst. 2016 Oct 26; 3(4): 385-394. e3, hereby incorporated by reference in its entirety, and specifically for the biomarkers outlined there. Once the beta cells are generated, they can be transplanted (either as a cell suspension, cell clusters, or within a permeable or semipermeable device or gel matrix as discussed herein) into the portal vein / liver, the omentum, the gastrointestinal mucosa, the bone marrow, a muscle, or subcutaneous pouches.

[0105] In some embodiments, the pancreatic islet cells, such as beta islet cells differentiated from iPSCs derived from one or more individual donors (e.g. healthy donors), produce insulin in response to an increase in glucose. In various embodiments, the pancreatic islet cells secrete insulin in response to an increase in glucose. In some embodiments, the cells have a distinct morphology such as a cobblestone cell morphology and / or a diameter of about 17 pm to about 25 pm.

[0106] Once the engineered islets have been generated, they may be assayed for their hypoimmunogenicity and / or retention of pluripotency as is described in W02016183041 and WO2018132783. In some embodiments, hypoimmunogenicity is assayed using a number of techniques as exemplified in Figure 13 and Figure 15 of WO2018132783. These techniques include transplantation into allogeneic hosts and monitoring for hypoimmunogenic pluripotent cell growth (e.g. teratomas) thatescape the host immune system. In some instances, hypoimmunogenic pluripotent cell derivatives are transduced to express luciferase and can then followed using bioluminescence imaging. Similarly, the T cell and / or B cell response of the host annual to such cells are tested to confirm that the cells do not cause an immune reaction in the host animal. T cell responses can be assessed by Elispot, ELISA, FACS, PCR. or mass cytometry (CYTOF). B cell responses or antibody responses are assessed using FACS or Lumincx. Additionally or alternatively, the cells may be assayed for their ability to avoid innate immune responses, e.g. NK cell killing, as is generally shown in Figures 14 and 15 of WO2018132783.

[0107] In some embodiments, the immunogenicity of the cells is evaluated using T cell immunoassays such as T cell proliferation assays, T cell activation assays, and T cell killing assays recognized by those skilled in the art. In some cases, the T cell proliferation assay includes pretreating the cells with interferon-gamma and coculturing the cells with labelled T cells and assaying the presence of the T cell population (or the proliferating T cell population) after a preselected amount of time. In some cases, the T cell activation assay includes coculturing T cells with the cells outlined herein and determining the expression levels of T cell activation markers in the T cells.

[0108] In vivo assays can be performed to assess the immunogenicity of the cells outlined herein. In some embodiments, the survival and immunogenicity of modified iPSCs is determined using an allogeneic humanized immunodeficient mouse model. In some instances, the modified iPSCs are transplanted into an allogeneic humanized NSG-SGM3 mouse and assayed for cell rejection, cell survival, and teratoma formation. In some instances, grafted modified iPSCs or differentiated cells thereof display long-term survival in the mouse model.

[0109] Additional techniques for determining immunogenicity including hypoimmunogenicity of the cells are described in, for example, Deuse et al., Nature Biotechnology, 2019, 37, 252-258 and Han et al., Proc Natl Acad Sci USA, 2019, 116(21), 10441-10446, the disclosures including the figures, figure legends, and description of methods are incorporated herein by reference in their entirety.

[0110] Similarly, the retention of pluripotency may be tested in a number of ways. In one embodiment, pluripotency is assayed by the expression of certain pluripotency-specific factors as generally described herein and shown in Figure 29 of WO2018132783. Additionally or alternatively, the pluripotent cells are differentiated into one or more cell types as an indication of pluripotency.

[0111] Once the modified pluripotent stem cells (modified iPSCs) have been generated, they can be maintained in an undifferentiated state as is known for maintaining iPSCs. For example, the cells can be cultured on Matrigel using culture media that prevents differentiation and maintains pluripotency. In addition, they can be in culture medium under conditions to maintain pluripotency.B. Compositions and Formulations

[0112] In some aspects, the engineered beta islets are provided as a composition or pharmaceutical composition for administration to the subject. In some embodiments, the pharmaceutical composition comprises one or more engineered islets and a pharmaceutically acceptable carrier.

[0113] Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alky l parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohcxanol; 3-pcntanol; and m-crcsol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g. Zn-protein complexes): and / or non-ionic surfactants such as polysorbates (TWEEN™), poloxamers (PLURONICS™) or polyethylene glycol (PEG). In some embodiments, the pharmaceutical composition includes a pharmaceutically acceptable buffer (e.g. neutral buffer saline or phosphate buffered saline). In some embodiments, the pharmaceutical composition can contain one or more excipients for modifying, maintaining or preserving, for example, the pH, osmolarity, viscosity, clarity, color, isotonicity, odor, sterility, stability, rate of dissolution or release, adsorption, or penetration of the composition. In some aspects, a skilled artisan understands that a pharmaceutical composition containing cells may differ from a pharmaceutical composition containing a protein.

[0114] The pharmaceutical composition in some embodiments contains engineered islets as described herein in amounts effective to treat or prevent the beta cell associated disease or disorder, such as a therapeutically effective or prophylactically effective amount. In some embodiments, the pharmaceutical composition contains engineered islets as described herein in amounts effective to treat or prevent the beta cell associated disease or disorder, such as a therapeutically effective or prophylactically effective amount. Therapeutic or prophylactic efficacy in some embodiments is monitored by periodic assessment of treated subjects. For repeated administrations over several days or longer, depending on the condition, the treatment is repeated until a desired suppression of disease symptoms occurs.However, other dosage regimens may be useful and can be determined. The desired dosage can be delivered by a single bolus administration of the composition, by multiple bolus administrations of the composition, or by continuous infusion administration of the composition.

[0115] In some embodiments, the engineered islets are administered using standard administration techniques, formulations, and / or devices. In some embodiments, the engineered islets or composition or a population thereof as described herein arc administered using standard administration techniques, formulations, and / or devices. Provided are formulations and devices, such as syringes and vials, for storage and administration of the compositions. The engineered islets can be administered via localized injection, including catheter administration, systemic injection, localized injection, intravenous injection, or parenteral administration. When administering a therapeutic composition, such as containing engineered islets, it will generally be formulated in a unit dosage injectable form (solution, suspension, emulsion).

[0116] Formulations include those for intravenous, intraperitoneal, or subcutaneous, administration. In some embodiments, the one or more immunosuppressive agents are administered parenterally. The term "parenteral,” as used herein, includes intravenous, intramuscular, subcutaneous, rectal, vaginal, and intraperitoneal administration. In some embodiments, the one or more immunosuppressive agents are administered to a subject using peripheral systemic delivery by intravenous, intraperitoneal, or subcutaneous injection.

[0117] Compositions in some embodiments are provided as sterile liquid preparations, e.g. isotonic aqueous solutions, suspensions, emulsions, or dispersions, which may in some aspects be buffered to a selected pH. Liquid compositions are somewhat more convenient to administer, especially by injection. Liquid compositions can comprise carriers, which can be a solvent or dispersing medium containing, for example, water, saline, phosphate buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol) and suitable mixtures thereof. Sterile injectable solutions can be prepared by incorporating the one or more immunosuppressive agents in a solvent, such as in admixture with a suitable carrier, diluent, or excipient such as sterile water, phy siological saline, glucose, dextrose, or the like.

[0118] In some embodiments, the pharmaceutical composition can be formulated for administration by any route known to those of skill in the art including intramuscular, intravenous, intradermal, intralesional, intraperitoneal injection, subcutaneous, intratumoral, epidural, nasal, oral, vaginal, rectal, topical, local, otic, inhalational, buccal (e.g. sublingual), and transdermal administration or any route. In some embodiments, other modes of administration also are contemplated. In some embodiments, the administration is by bolus infusion, by injection, e.g. intravenous or subcutaneous injections, intraocular injection, periocular injection, subretinal injection, intravitreal injection, transseptal injection, subscleral injection, intrachoroidal injection, intracameral injection, subconjunctival injection, sub-Tenon’s injection, retrobulbar injection, peribulbar injection, or posterior juxtascleral delivery. In some embodiments, administration is by parenteral, intrapulmonary, and intranasal, and. if desired for local treatment, intralesional administration. Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. In some embodiments, theadministration is via the portal vein. In some embodiments, the administration is by injection into the intramuscular space forearm of the subject.

[0119] In some embodiments, compositions also can be administered with other biologically active agents, either sequentially, intermittently or in the same composition. In some embodiments, administration also can include controlled release systems including controlled release formulations and device-controlled release, such as by means of a pump. In some embodiments, the administration is oral. In some embodiments, the administration is intravenous.

[0120] In some embodiments, a pharmaceutically acceptable carrier can include all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration (Gennaro, 2000, Remington: The science and practice of pharmacy, Lippincott, Williams & Wilkins, Philadelphia, PA). Examples of such carriers or diluents include, but are not limited to, water, saline, Ringer's solutions, dextrose solution, and 5% human serum albumin. Liposomes and non-aqueous vehicles such as fixed oils may also be used.Supplementary active compounds can also be incorporated into the compositions. The pharmaceutical carrier should be one that is suitable for the one or more immunosuppressive agents, such as a saline solution, a dextrose solution or a solution comprising human serum albumin. In some embodiments, the pharmaceutically acceptable carrier or vehicle for such compositions is any non-toxic aqueous solution in which the engineered islets can be maintained, or remain viable, for a time sufficient to allow administration of live cells. For example, the pharmaceutically acceptable carrier or vehicle can be a saline solution or buffered saline solution.

[0121] Also provided herein are compositions that are suitable for cryopreserving the engineered islets. In some embodiments, the engineered islets are cryopreserved in a cry opreservation medium. In some embodiments, the cry opreservation medium is a serum free cry opreservation medium. In some embodiments, the composition comprising the engineered islets or population thereof comprises a cryoprotectant. In some embodiments, the cryoprotectant is or comprises DMSO and / or s glycerol. In some embodiments, the cryopreservation medium is between at or about 5% and at or about 10% DMSO (v / v). In some embodiments, the cryopreservation medium is at or about 5% DMSO (v / v). In some embodiments, the cryopreservation medium is at or about 6% DMSO (v / v). In some embodiments, the cry opreservation medium is at or about 7% DMSO (v / v). In some embodiments, the cryopreservation medium is at or about 7.5% DMSO (v / v). In some embodiments, the cryopreservation medium is at or about 8% DMSO (v / v). In some embodiments, the cry opreservation medium is at or about 9% DMSO (v / v). In some embodiments, the cryopreservation medium is at or about 10% DMSO (v / v). In some embodiments, the cryopreservation medium contains a commercially available cryopreservation solution (CryoStor™ CS10). CryoStor™ CS10 is a cryopreservation medium containing 10% dimethyl sulfoxide (DMSO). In some embodiments, compositions formulated for cry opreservation can be stored at lowtemperatures, such as ultra-low temperatures, for example, storage with temperature ranges from -40 °C to -150 °C, such as or about 80 °C ± 6.00C.

[0122] In some embodiments, the cryopreserved engineered islets are prepared for administration by thawing. In some cases, the engineered islets can be administered to a subject immediately after thawing. In such an embodiment, the composition comprising the engineered islets is ready -to-use without any further processing. In other cases, the engineered islets are further processed after thawing, such as by resuspension with a pharmaceutically acceptable carrier, incubation with an activating or stimulating agent, or are activated washed and resuspended in a pharmaceutically acceptable buffer prior to administration

[0123] In some embodiments, the composition, including pharmaceutical composition, is sterile.

[0124] In some embodiments, the pharmaceutical composition comprises a engineered islets and a pharmaceutically acceptable carrier comprising 31.25 % (v / v) Plasma-Lyte A, 31.25 % (v / v) of 5% dextrose / 0.45% sodium chloride, 10% dextran 40 (LMD) / 5% dextrose, 20% (v / v) of 25% human serum albumin (HSA), and 7.5% (v / v) dimethylsulfoxide (DMSO).C. Dosing and Administration

[0125] In some embodiments, the engineered islets can be administered by any route known to those of skill in the art including intramuscular, intravenous, intradermal, intralesional, intraperitoneal injection, subcutaneous, kidney capsule, intratumoral, epidural, nasal, oral, vaginal, rectal, topical, local, otic, inhalational, buccal (e.g. sublingual), and transdermal administration or any route. In some embodiments, other modes of administration also are contemplated. In some embodiments, the administration is by bolus infusion, by injection, e.g. intravenous or subcutaneous injections, intraocular injection, periocular injection, subretinal injection, intravitreal injection, trans-septal injection, subscleral injection, intrachoroidal injection, intracameral injection, subconjunctival injection, sub-Tenon’s injection, retrobulbar injection, peribulbar injection, or posterior juxtascleral delivery. In some embodiments, administration is by parenteral, intrapuhnonary. and intranasal, and, if desired for local treatment, intralesional administration. Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. In some embodiments, the administration is via the portal vein. In some embodiments, the administration is by injection into the intramuscular space forearm of the subject. In some embodiments, the administration is by kidney capsule.

[0126] In some embodiments, the engineered islets may be administered at any suitable location in the subject. For example, in some embodiments, the engineered islets are administered to the kidney, forearm, mouth, anus, nose, upper arm, hip, thigh, buttocks, liver, spleen, muscle, subcutaneous tissue, or white adipose tissue of the subject. In some embodiments, the engineered cells are administered to the liver, muscle, or white adipose tissue of die subject. In some embodiments, the white adipose tissue is omentum.

[0127] In particular embodiments, the engineered islets are administered by intramuscular injection. In some embodiments, the engineered islets are administered to the forearm of the subject. In sonic embodiments, the engineered islets arc administered to the intramuscular space of the forearm of the subject.

[0128] In some embodiments, injections into the muscle circumvent early islet loss through an instant blood-mediated inflammatory reaction (IBMIR) that is known to occur after portal vein injections (Bennet et al., Diabetes (1999) 48:1907-1914). The muscle is well vascularized and islet transplantations into striated muscle have been successful clinically (Christoffersson et al. Diabetes (2010) 59:2569-2578; Rafael et al., Am J Transplant (2008) 8:458-462).

[0129] In some aspects, the methods of administration involve implanting engineered islets cells into the subject. In some aspects, the engineered islets may be implanted as dispersed cells or formed into clusters. In some embodiments, the engineered islets are administered as a suspension of a population of islet cells. In some embodiments, the engineered islets are an engineered tissue graft comprising a population of engineered islet cells and a matrix. In some embodiments, the engineered islet cells are in a composition that is administered as a suspension of a population of engineered islet cells.

[0130] The specific amount / dosage regimen of the engineered islets will vary depending on the weight, gender, age and health of the subject; the formulation, the biochemical nature, bioactivity, bioavailability and the side effects of the engineered islets, and the number and identity of the engineered cells. The dose for administration can depend on a number of various factors including the patient's condition and response to the therapy , and can be determined by one skilled in the art.

[0131] In some embodiments, the dose of engineered islets is administered in an amount from or from about 1000 islet equivalent units (IEQ) to at or about 1 x 106 IEQ, such as from or from about 1000 IEG to at or about 500.000 IEQ, at or about 1000 IEQ to at or about 250,000 IEQ, at or about 1000 IEQ to at or about 100,000 IEQ, at or about 1000 IEQ to at or about 50,000 IEQ, at or about 1000 IEQ to at or about 25,000 IEQ, at or about 1000 IEQ to at or about 10000 IEQ, at or about 1000 IEQ to at or about 5000 IEQ, at or about 5000 IEQ to at or about 1 x 106 IEQ, at or about 5000 IEQ to at or about 500,000 IEQ, at or about 5000 IEQ to at or about 250,000 IEQ. at or about 5000 IEQ to at or about 100,000 IEQ, at or about 5000 IEQ to at or about 50,000 IEQ, at or about 5000 IEQ to at or about 250000 IEQ. at or about 5000 IEQ to at or about 10000 IEQ, at or about 10000 IEQ to at or about 1 x 106 IEQ. at or about 10000 IEQ to at or about 500000 IEQ, at or about 10000 IEQ to at or about 250000 IEQ, at or about 10000 IEQ to at or about 100000 IEQ, at or about 10000 IEQ to at or about 50000 IEQ, at or about 10000 IEQ to at or about 250000 IEQ, at or about 25000 IEQ to at or about 1 x 106 IEQ, at or about 25000 IEQ to at or about 500000 IEQ, at or about 25000 IEQ to at or about 250000 IEQ, at or about 25000 IEQ to at or about 100000 IEQ, at or about 25000 IEQ to at or about 50000 IEQ, at or about 50000 IEQ to at or about 1 x 106 IEQ. at or about 50000 IEQ to at or about 500000 IEQ, at or about 50000 IEQ to at or about 150000 IEQ. at or about 50000 IEQ to at or about 100000 IEQ, at or about 100000 IEQ to at orabout 1 x 106 IEQ. at or about 100000 IEQ to at or about 500000 IEQ, at or about 100000 IEQ to at or about 250000 IEQ. at or about 250000 IEQ to at or about 1 x 106 IEQ, at or about 250000 IEQ to at or about 500000 IEQ, or at or about 500000 IEQ to at or about 1 x 106 IEQ. In some embodiments, the modified SB-beta cells are administered in an amount that is at or about 50,000 IEQ, at or about 100,000 IEQ, at or about 200.000 IEQ, at or about 300,000 IEQ, at or about 400,000 IEQ, or at or about 500,000 IEQ, or any value betw een any of the foregoing. IEQ provides a standardized estimate of islet volume, with one IEQ corresponding to the volume of a perfectly spherical islet with a diameter of 150 pm (Ricordi et al. Acta Diabetol. Lat. 27, 185-195 (1990).

[0132] In some embodiments, the dose of engineered islets administered to a subject is administered per kg of body weight of the subject. In some embodiments, the engineered islets are administered in a dosage amount of from at or about 500 lEQ / kg of body weight to at or about 10000 lEQ / kg. from at or about 500 lEQ / kg to at or about 5000 lEQ / kg. from at or about 500 lEQ / kg to at or about 2500 lEQ / kg, from at or about 500 lEQ / kg to at or about 1000 lEQ / kg, from at or about 1000 lEQ / kg to at or about 10000 lEQ / kg, from at or about 1000 lEQ / kg to at or about 5000 lEQ / kg, from at or about 1000 lEQ / kg to at or about 2500 lEQ / kg. from at or about 2500 lEQ / kg to at or about 10000 lEQ / kg. from at or about 2500 lEQ / kg to at or about 5000 lEQ / kg, or from at or about 5000 lEQ / kg to at or about 10000 lEQ / kg.

[0133] Any therapeutically effective amount of cells described herein can be included in the pharmaceutical composition, depending on the indication being treated. Non-limiting examples of the cells include primary’ islet cells (e.g. engineered hypoimmunogenic islet cells) as described. In some embodiments, the pharmaceutical composition includes at least about 1 x 107, 2 x 107, 3 x 107, 4 x 107, 5 x 107, 6 x 107, 7 x 107, 8 x 107, 9 x 107, 1 x 108, 2 x 108, 3 x 108cells. In some embodiments, the pharmaceutical composition includes up to about 1 x 107, 2 x 107, 3 x 107. 4 x 107, 5 x 107, 6 x 107, 7 x 107, 8 x 107, 9 x 107, 1 x 108, 2 x 108, 3 x 108cells. In some embodiments, the pharmaceutical composition includes up to about 1 x 107cells. In some embodiments, the pharmaceutical composition includes up to about 3 x 108cells. In some embodiments, the pharmaceutical composition includes at least about 1 x 107-3 x 107, 2 x 107-4 x 107, 3 x 107-5 x 107, 4 x 107-6 x 107, 5 x 107-7 x 107, 6 x 107-8 x 107, 7 x 107-9 x 107, 8 x 107-l x 108, 9 x 10 -2 x 108, or 1 x 108-3 x 108cells. In exemplary embodiments, the pharmaceutical composition includes from about 1 x 107to about 3 x 108cells. In some embodiments, the pharmaceutical composition includes at least about 25 x 106to at least about 25 x 107cells, hi some embodiments, the pharmaceutical composition includes at least about 80 x 106to at least about 80 x 107cells. In another exemplary embodiment, the pharmaceutical composition includes about 25 x 106to about 80 x 106cells. In some embodiments, the pharmaceutical composition includes from about 25 x 106to about 80 x 107cells.

[0134] In some embodiments, the pharmaceutical composition is administered as a single dose of from about 1.25 x 105to about 1.2 x 107engineered hypoimmunogenic islet cells per kg body weight.In some embodiments, the pharmaceutical composition is administered as a single dose of from about 1.25 x IO5to about 1.25 x 106, about 1.5 x 10sto about 1.5 x 106, about 2.0 x 105to about 2.0 x 106, about 2.5 x 105to about 2.5 x 106, about 3.0 x 105to about 3.0 x 106, about 3.5 x 105to about 3.5 x 106. about 4.0 x 105to about 4.0 x 106, about 4.5 x 105to about 4.5 x 106, about 5.0 x 105to about 5.0 x 106. about 5.5 x 105to about 5.5 x 106, about 6.0 x 105to about 6.0 x 106, about 6.5 x 105to about 6.5 x 106. about 7.0 x 105to about 7.0 x 106, about 7.5 x 105to about 7.5 x 106, about 8.0 x 105to about 8.0 x 106. about 8.5 x 105to about 8.5 x 106, about 9.0 x 105to about 9.0 x 106, about 1.0 x 106to about 1.0 x 107, or about 1.2 x 106to about 1.2 x 107cells per kg body weight. In many embodiments, the dose is at a range that is lower than from about 1.25 x 10sto about 1.2 x 107cells per kg body weight. In many embodiments, the dose is at a range that is higher than from about 1.25 x 105to about 1.2 x 10" cells per kg body weight. In some embodiments, the dose is administered intravenously.

[0135] In some embodiments, the pharmaceutical composition includes islet equivalents (IEQ). In some embodiments, the pharmaceutical composition includes at least about 6,500 IEQ, 50,000 IEQ, 100,500 IEQ, 200.000 IEQ, 300,000 IEQ. 400,000 IEQ, 500.000 IEQ, or 600.000 IEQ. In some embodiments, the pharmaceutical composition includes up to about 6,500 IEQ, 50,000 IEQ, 100.500 IEQ, 200.000 IEQ, 300,000 IEQ. 400,000 IEQ, 500.000 IEQ, or 600.000 IEQ. In some embodiments, the pharmaceutical composition includes up to about 6,500 IEQ. In some embodiments, the pharmaceutical composition includes up to about 600,000 IEQ. In some embodiments, the pharmaceutical composition includes at least about 6,500 IEQ, 50,000 IEQ, 100.500 IEQ, 200,000 IEQ.300.000 IEQ, 400,000 IEQ. 500,000 IEQ, or 600,000 IEQ. In exemplary embodiments, the pharmaceutical composition includes from about 6,500 to about 600,000 IEQ.

[0136] In some embodiments, the pharmaceutical composition is administered as a single dose of from about 80 lEQ / kg to about 24,000 lEQ / kg. In some embodiments, the pharmaceutical composition is administered as a single dose of from about 80 lEQ / kg to about 800 lEQ / kg, about 100 lEQ / kg to about 1,000 lEQ / kg, about 200 lEQ / kg to about 2,000 lEQ / kg, about 300 lEQ / kg to about 3,000 lEQ / kg, about 400 lEQ / kg to about 4000 lEQ / kg, about 500 lEQ / kg to about 5,000 lEQ / kg, about 1,000 lEQ / kg to about 10,000 lEQ / kg, about 5,000 lEQ / kg to about 15,000 lEQ / kg, about 10,000 lEQ / kg to about 20,000 lEQ / kg, or about 14,000 lEQ / kg to about 24,000 lEQ / kg. In many embodiments, the dose is at a range that is lower than from about 80 lEQ / kg to about 24,000 lEQ / kg. In many embodiments, the dose is at a range that is higher than from about 80 lEQ / kg to about 24,000 lEQ / kg. In some embodiments, the dose is administered intravenously.

[0137] In some embodiments, the pharmaceutical composition is administered as a single dose of from about 500 to about 1500 islets per cluster. In some embodiments, the pharmaceutical composition is administered as a single dose of from about 500, 1000, or 1500 islets per cluster.D. Subjects1. Beta Cell Related Disorders

[0138] The modified cells provided herein can be administered to any suitable subjects (e.g. patients) including, for example, a candidate for a cellular therapy for the treatment of a beta cell related disease or disorder. Candidates for cellular therapy include any subject having a beta cell related disease or disorder that may potentially benefit from the therapeutic effects of the subject modified beta cells and one or more immunosuppressive agents provided herein. In some embodiments, the subject is an allogenic recipient of the administered modified beta cells. In some embodiments, the provided modified beta cells and one or more immunosuppressive agents are effective for use in allogeneic cell therapy. A subject who benefits from the therapeutic effects of the subject modified beta cells and one or more immunosuppressive agents provided herein exhibit an elimination, reduction, or amelioration of the beta cell related disease or disorder. In some aspects, the subject has. or has an increased risk of developing, a beta cell related disorder.

[0139] In some embodiments, the beta cell related disorder is a metabolic disorder. A metabolic disorder may occur when abnormal chemical reactions in the body of a subject disrupts metabolic processes (e.g. processes related to the metabolism, or breakdown, of energy into sugars and acids or the storage of said energy). In some embodiments, the metabolic disorder affects the breakdown of amino acids, carbohydrates, or lipids in a subject’s body. In some embodiments, the metabolic disorder affects the subject’s mitochondria (e.g. mitochondrial diseases). In some embodiments, the metabolic disorder develops when the subject's organs, such as the liver or pancreas, become disease and / or do not function normally. Exemplar}' metabolic disorders herein may comprise, but are not limited to, any disease or disorder characterized by increased blood pressure, high blood sugar, excess body fat around tire waist, and abnonnal cholesterol or triglyceride levels. In some embodiments, the metabolic disorder is familial hypercholesterolemia, Gaucher disease, Hunter syndrome, Krabbe disease, maple syrup urine disease, metachromatic leukodystrophy, mitochondrial encephalopathy, lactic acidosis, stroke-like episodes (MELAS), Niemann-Pick disease, phenylketonuria (PKU), porphyria, Tay-Sachs disease, Wilson's disease. Type I diabetes, Type II diabetes, obesity, hypertension, dyslipidemia, or carbohydrate intolerance. In some embodiments, the metabolic disorder is Type II diabetes. In some embodiments, the metabolic disorder is Type I diabetes. In some embodiments, the metabolic disorder is Type I diabetes mellitus.

[0140] In some embodiments, the subject has been diagnosed with the beta cell related disease or disorder (e.g. Type I diabetes) prior to the administration of the one or more immunosuppressive agents and / or the modified beta cell or composition, such as any of the immunosuppressive agents and / or the compositions comprising a modified beta cell described herein. In some embodiments, the subject has been diagnosed with the beta cell related disease or disorder between about 1 year and about 5 years priorto the administration of the one or more immunosuppressive agents and / or the modified beta cell or composition. In some embodiments, the subject has been diagnosed with the beta cell related disease or disorder at least about 1 year prior to the administration of the one or more immunosuppressive agents and / or the modified beta cell or composition, such as at least about any of 2 years, 3 years, 4 years, 5 years, or more, prior to the administration of the one or more immunosuppressive agents and / or the modified beta cell or composition. In some embodiments, the subject has been diagnosed with the beta cell related disease or disorder less than about 5 years prior to the administration of the one or more immunosuppressive agents and / or the modified beta cell or composition, such as less than about any of 4 years, 3 years, 2 years, 1 year, or less, prior to the administration of the one or more immunosuppressive agents and / or the modified beta cell or composition. In some embodiments, the subject has been diagnosed with Type I diabetes at least about 1 year prior to the administration of the one or more immunosuppressive agents and / or the modified beta cell or composition, such as at least about any of 2 years. 3 years. 4 years, 5 years, or more, prior to the administration of the one or more immunosuppressive agents and / or the modified beta cell or composition. In some embodiments, the subject has been diagnosed with Type I diabetes less than about 5 years prior to the administration of the one or more immunosuppressive agents and / or the modified beta cell or composition, such as less than about any of 4 years. 3 years. 2 years. 1 year, or less, prior to the administration of the one or more immunosuppressive agents and / or the modified beta cell or composition.2. Inclusion Criteria

[0141] In some embodiments, the subject displays one or more inclusion criteria prior to administration of the dose of engineered hypoimmunogenic islets. The term “inclusion criteria’’ as used herein refers to clinical phenotypes of the subject that qualify said subject for application of the methods and uses provided herein.

[0142] In some embodiments, the subject is a juvenile, a teenager, middle aged, or elderly. In some embodiments, the subject is a juvenile. In some embodiments, the subject is between the ages of about 1 month old and about 18 years old, such as between about 1 month and about 1 year, between about 6 months and about 5 years, between about 2 years and about 10 years, or between about 8 years and about 15 years. In some embodiments, the subject is older than about 1 month old, such as older than any of about 2 months. 3 months. 4 months. 5 months. 6 months. 7 months. 8 months. 9 months, 10 months. 11 months, 1 year. 2 years. 3 years. 4 years. 5 years. 6 years. 7 years. 8 years. 9 years. 10 years, 11 years, 12 years. 13 years, 14 years, 15 years. 16 years, 17 years 18 years old. or older. In some embodiments, the subject is younger than about 18 years old, such as younger than any of about 17 years, 16 years. 15 years, 14 years, 13 years. 12 years, 11 years. 10 years, 9 years, 8 years, 7 years, 6 years, 5 vears, 4 vears, 3 vears, 2 vears, 1 vear. 11 months, 10 months. 9 months. 8 months. 7 months. 6 months. 5 months, 4 months, 3 months, 2 months, 1 month old or younger. In some embodiments, the subject isbetween the ages of about 18 years old to about 90 years old, such as between about 18 years old and about 40 years old. between about 20 years old and about 60 years old, between about 50 years old and about 80 years old. or between about 60 years old and about 90 years old. In some embodiments, the subject is older than about 18 years old, such as older than about any of 20 years old, 25 years old, 30 years old, 35 years old. 40 years old, 45 years old, 50 years old, 55 years old, 60 years old, 65 years old, 70 years old, 75 years old, 80 years old, 85 years old, 90 years old, or older. In some embodiments, the subject is younger than about 90 years old, such as younger than about any of 85 years old, 80 years old, 75 years old, 70 years old, 65 years old, 60 years old, 55 years old, 50 years old, 45 years old, 40 years old, 35 years old, 30 years old, 25 years old, 20 years old, 18 years old, or younger.

[0143] In some embodiments, the subject to be treated is characterized by one or more of the following: diagnosed before the age of 18 years: involved in intensive diabetes management; between the ages of 18-45; and body weight < 80 kg. In some embodiments, the subject to be treated is diagnosed before the age of 18 years. In some embodiments, the subject to be treated is involved in intensive diabetes management. In some embodiments, the intensive diabetes management comprises selfmonitoring of subcutaneous glucose level by continuous glucose monitoring or by intermittent scanning glucose monitoring no less than a mean of three times per day averaged over each week. In some embodiments, intensive diabetes management comprises administration of three or more insulin injections per day or insulin pump therapy. In some embodiments, the intensive diabetes management comprises self-monitoring of subcutaneous glucose level by continuous glucose monitoring or by intermittent scanning glucose monitoring no less than a mean of three times per day averaged over each week and administration of three or more insulin injections per day or insulin pump therapy. In some embodiments, the subject to be treated is between the ages of 18-45. In some embodiments, the subject to be treated is < 80 kg.3. Exclusion Criteria

[0144] In some embodiments, the subject does not display any one of exclusion criteria prior to the administration of the dose of engineered hypoimmunogenic islets. The tenn “exclusion criteria” as used herein refers to clinical phenotypes of the subject that disqualify said subject for application of the methods and uses provided herein.

[0145] In some embodiments, the subject is not characterized by having the following: any previous organ transplantation; any history of malignancy; use of any investigational agent(s) within 4 weeks of administering the dose of engineered hypoimmunogenic islets; use of any anti-diabetic medication other than insulin within 4 weeks of administering the dose of engineered hypoimmunogenic islets; active infections including Tuberculosis, HIV. HBV and HCV; liver function test value for AST, ALT, GGT or ALP exceeding the respective reference interval; serological evidence of infection with HTLVI or HTLVII; pregnancy, nursing, intention for pregnancy; chronic kidney disease grade 3 or worse(GFR < 60 ml / niin as estimated by creatine measurement); medical history of cardiac disease or symptoms at screening consistent with cardiac disease; administration of live attenuated vaccines < 6 months before administering the dose of engineered hypoimmunogenic islets; untreated proliferative diabetic retinopathy; ongoing psychiatric illness; ongoing substance abuse, drug or alcohol or treatment noncompliance; and known hypersensitivity to ciprofloxacin, gentamicin, or amphotericin.

[0146] In some embodiments, the subject has not had any previous organ transplantation. In some embodiments, the subject has not had any history of malignancy. In some embodiments, the subject has not used any investigational agent(s) within 4 weeks of receiving the dose of engineered hypoimmunogenic islets. In some embodiments, the subject has not used any anti-diabetic medication other than insulin within 4 weeks of receiving the dose of engineered hypoimmunogenic islets. In some embodiments, the subject has not had any active infections including Tuberculosis, HIV, HBV and HCV. In some embodiments, the subject has not had a liver function test value for AST, ALT, GGT or ALP exceeding the respective reference interval. In some embodiments, the subject has not had serological evidence of infection with HTLVI or HTLVII. In some embodiments, the subject is not pregnant, nursing or intending to be pregnant. In some embodiments, the subject does not have chronic kidney disease grade 3 or worse (GFR < 60 l / min as estimated by creatine measurement). In some embodiments, the subject does not have any medical history of cardiac disease or symptoms at screening consistent with cardiac disease. In some embodiments, the subject has not received administration of live attenuated vaccines < 6 months before receiving the dose of engineered hypoimmunogenic islets. In some embodiments, the subject does not have untreated proliferative diabetic retinopathy. In some embodiments, the subject does not have ongoing psychiatric illness. In some embodiments, the subject does not have ongoing substance abuse, drug or alcohol or treatment noncompliance. In some embodiments, the subject does not have known hypersensitivity to ciprofloxacin, gentamicin, or amphotericin.E. Outcomes of the Method

[0147] Provided herein are methods relating to administering to a subject engineered islets, generally including engineered beta islet cells. In some embodiments, the provided methods are useful for treating a beta cell related disorder (e.g.. Type I diabetes) in a subject, promoting engraftment or survival of a beta cell in a subject, and / or restoring glucose metabolism in a subject.

[0148] In some embodiments, the provided methods may improve glucose tolerance in a subject. Glucose tolerance may be measured by any suitable method, such as those described herein (e.g. insulin secretion assays). In some embodiments, the engineered islets exhibits glucose-stimulated insulin secretion (GSIS). Thus, in some embodiments, the improved glucose tolerance is measured in a GSIS perfusion assay. Glucose intolerance is related to insulin resistance, and can cause diabetes (e.g. Type 1 diabetes and Type II diabetes). Therefore, in some embodiments, provided is a method of treating a betacell related disorder (e.g. diabetes) comprising administering provided engineered islets to a subject. In some embodiments, the subject is a diabetic patient. In some embodiments, the subject has Type I diabetes. In some embodiments, the subject has Type II diabetes. Specifically, in some embodiments, provided is a method of improving glucose tolerance in a subject, the method comprising administering engineered islets as described herein to a subject. In some embodiments, glucose tolerance is improved relative to the subject’s glucose tolerance prior to administration of the engineered islets. In some embodiments, the engineered islets reduce exogenous insulin usage in the subject. In some embodiments, glucose tolerance is improved as measured by HbAlc levels. In some embodiments, the subject is fasting. In some embodiments, the engineered islets improve insulin secretion in the subject. In some embodiments, insulin secretion is improved relative to the subject’s insulin secretion prior to administration of the engineered islets.

[0149] In some embodiments, the methods disclosed herein further include monitoring a patient for insulin-independence. In some embodiments, "insulin-independence” or "insulin-independent” is achieved in a subject (e.g., an islet cell recipient) that is able to titrate off insulin therapy for at least 1 week and meets one or more, e.g., all, of the following criteria: (i) fasting capillary glucose level does not exceed 140 mg / dL (7.8 mmol / L) more than three times in 1 week (based on measuring capillary glucose levels a minimum of 7 tunes in a seven day period); (ii) 2-hours post-prandial capillary glucose does not exceed 180 mg / dL (10.0 mmol / L) more than three times in 1 week (based on measuring capillary glucose levels a minimum of 21 times in a seven day period); and (iii) evidence of endogenous insulin production defined as fasting or stimulated C-peptide levels >0.5 ng / mL (0.16 pmol / L). In some embodiments, the subject is characterized by one of (i)-(iii). In some embodiments, the subject is characterized by two of (i)-(iii). In some embodiments, the subject is characterized by each of (i)-(iii).

[0150] In some embodiments, the subject is monitored at about 1 month, 2 month, 3 month, 4 month, 5 month, 6 month, 7 month, 8 month, 9 month, 10 month, 11 month, or 12 or more months after administration of any of the cells provided herein (e.g., a dose of engineered hypoimmunogenic islet cells). In some embodiments, the methods disclosed herein include monitoring a subject for up to one year for insulin-independence after administration of any of the cells provided herein (e.g.. a dose of engineered hypoimmunogenic islet cells).

[0151] In some embodiments, the subject has reduced insulin dependence (e.g. dose of exogenous insulin is reduced by 10% or more, such as 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more), compared to the amount of exogenous insulin required for a subject administered non-hypoimmunogenic islets for treating the beta cell disorder or the amount of exogenous insulin required for untreated subjects that have the beta cell disorder. In some embodiments, the reduce insulin dependence is achieved for 1 month, 2 month. 3 month, 4 month. 5 month, 6 month. 7 month, 8 month. 9 month, 10 month, 11 month, or 12 or more months after administration of any of the cells provided herein (e.g.. a dose of engineered hypoimmunogenic islet cells).

[0152] In some embodiments, the subject is insulin-independent. In some embodiments, the insulin independence is achieved for 1 month, 2 month, 3 month, 4 month, 5 month, 6 month, 7 month, 8 month, 9 month, 10 month, 11 month, or 12 or more months after administration of any of the cells provided herein (e.g., a dose of engineered hypoimmunogenic islet cells).

[0153] In some embodiments, the methods disclosed herein further comprise monitoring the patient one or more times or continuously throughout the period for transplantation survival. In some embodiments, the period of graft survival may be about 1, 2, 3. 4, 5, 6, 7, 8, 9, or 10 years or more (e.g., about 1 year or more, about 2 years or more, about 5 years or more, about 7 years or more, or about 10 years or more).

[0154] In some embodiments, the methods disclosed herein further comprise administering one or more additional doses of engineered islets to a subject who, at the end of the monitoring period, is not insulin-independent or insulin-dependent. In some embodiments, the subject is “insulin-dependent” if the subject (e.g.. an islet cell recipient) that does not meet the criteria for insulin-independence, as described above. In some embodiments, the methods disclosed herein further comprise administering one or more additional doses of cells to a subject who, at the end of the monitoring period, has a C-peptide level in a serum sample of less than about 0.2, 0.3, 0.4, or 0.5 ng / ml (e.g.. about 0.3 ng / ml). In some embodiments, a subject having a C-peptide level in a serum sample of less than about 0.2, 0.3, 0.4, or 0.5 ng / ml (e g., about 0.3 ng / ml) is not insulin-independent.

[0155] In some embodiments, administration of the provided engineered islet cells do not induce and adaptive immune response in the subject. In some embodiments, the adaptive immune response is assessed using ELISPOT. For example, the adaptive immune response may be assessed by measuring tire levels of IFNg cytokine secretion by CD8+ T cells. In some embodiments, the levels of IFNg produced following administration of engineered islets is lower than wild type primary islet cells or compared to SC-derived islets cells derived from unmodified pluripotent stem cells, such as by about 400-fold, 300-fold, 200-fold, 100-fold, 50-fold, 25-fold, or 10-fold lower levels of IFNg. hi some embodiments, the adaptive immune response is assessed using flow cytometry. For example, in some embodiments, the adaptive immune response is assessed by measuring the levels donor specific antibody (DSA) IgG or IgM. In some embodiments, the engineered islets exhibit lower levels of DSA levels compared to wild type primary islet cells, such as any of about 2-fold, 1.5-fold, and 1-fold lower levels of DSA compared to a control or wild-type beta cells.

[0156] In some embodiments, the engineered islet cells are hypoimmunogenic and exhibit a reduced or lower immune response compared to islets cells that are not engineered with the modifications. In some embodiments, an immune response against the engineered cells is reduced or lower by at least 5%, 10%, 15%, 20%. 25%. 30%, 35%, 40%. 45%. 50%, 55%, 60%. 65%. 70%, 75%, 80%, 85%. 90%. 91%, 92%, 93%. 94%. 95%, 96%, 97%, 98%. or 99% lower compared to the level of the immune response produced by the administration of immunogenic cells (e.g. a population of cells ofthe same or similar cell type or phenotype but that do not contain the modifications, e.g. genetic modifications, of the modified cells). In some embodiments, the administered engineered islets fails to elicit an immune response against the modified cells in the subject.

[0157] In sonic embodiments, the administered engineered islets elicits a decreased or lower level of systemic TH1 activation in the subject. In some instances, the level of systemic THl activation elicited by the cells is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% lower compared to the level of systemic THl activation produced by the administration of immunogenic cells (e.g. a population of cells of the same or similar cell type or phenoty pe but that do not contain the modifications, e.g. genetic modifications, of the modified cells). In some embodiments, the administered engineered islets fails to elicit systemic THl activation in the subject.

[0158] In some embodiments, the administered engineered islets elicits a decreased or lower level of immune activation of peripheral blood mononuclear cells (PBMCs) in the subject. In some instances, the level of immune activation of PBMCs elicited by the cells is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%. 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% lower compared to the level of immune activation of PBMCs produced by the administration of immunogenic cells (e.g. a population of cells of the same or similar cell type or phenoty pe but that do not contain the modifications, e.g. genetic modifications, of the modified cells). In some embodiments, the administered engineered islets fails to elicit immune activation of PBMCs in the subject.

[0159] In some embodiments, the administered engineered islets elicits a decreased or lower level of donor-specific IgG antibodies in the subject. In some instances, the level of donor-specific IgG antibodies elicited by the cells is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% lower compared to the level of donor-specific IgG antibodies produced by the administration of immunogenic cells (e.g. a population of cells of the same or similar cell type or phenotype but that do not contain the modifications, e.g. genetic modifications, of the modified cells). In some embodiments, the administered population of modified cells fails to elicit donor-specific IgG antibodies in the subject.

[0160] In some embodiments, the administered engineered islets elicits a decreased or lower level of IgM and IgG antibody production in the subject. In some instances, the level of IgM and IgG antibody production elicited by the cells is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% lower compared to the level of IgM and IgG antibody production produced by the administration of immunogenic cells (e.g. a population of cells of the same or similar cell type or phenotype but that do not contain the modifications, e.g. genetic modifications, of the modified cells). In some embodiments, the administered engineered islets fails to elicit IgM and IgG antibody production in the subject.

[0161] In some embodiments, the administered engineered islets elicits a decreased or lower level of cytotoxic T cell killing in die subject. In some instances, the level of cytotoxic T cell killing elicited by the cells is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% lower compared to the level of cytotoxic T cell killing produced by the administration of immunogenic cells (e.g. a population of cells of the same or similar cell type or phenotype but that do not contain the modifications, e.g. genetic modifications, of the modified cells). In some embodiments, the administered engineered islets fails to elicit cytotoxic T cell killing in the subject.

[0162] Upon administration of engineered islets described herein the subject exhibits no systemic immune response or a reduced level of systemic immune response compared to responses to cells that are not hypoimmunogenic. In some embodiments, the subject exhibits no adaptive immune response or a reduced level of adaptive immune response compared to responses to cells that are not hypoimmunogenic. In some embodiments, the subject exhibits no innate immune response or a reduced level of innate immune response compared to responses to cells that are not hypoimmunogenic. In some embodiments, the subject exhibits no T cell response or a reduced level of T cell response compared to responses to cells that are not hypoimmunogenic. In some embodiments, the subject exhibits no B cell response or a reduced level of B cell response compared to responses to cells that are not hypoimmunogenic.

[0163] In some embodiments, upon administration of the engineered islets as described herein the subject does not experience any adverse events. In some embodiments, the subject experiences fewer adverse events compared to a subject that is not administered the one or more immunosuppressive agents. In some embodiments, the adverse events are assessed by Common Terminology Criteria for Adverse Events (CTCAE) v5.0. An adverse event may include, but is not limited to, hypo- and hyper-glycemia limits for blood glucose related risks, muscle pain during the administration of the engineered islets local hemorrhage during the administration of the engineered islets and / or the one or more immunosuppressive agents, and / or cytokine release syndrome.

[0164] In some embodiments, the administered engineered islets evade the subject's immune system as evaluated by PBMC and serum. In some embodiments, the engineered islets evade the subject’s immune system at 0, 2, 4, 8. 12, 18, 26, and 52 weeks following administration of the engineered islets to the subject. In some embodiments, the administered engineered islets survive in the subject as evaluated by MRI. In some embodiments, the engineered islets survive within 48 hours following administration of the engineered islets to the subject. In some embodiments, the engineered islets survive 2, 4. 6. 8, 12. 26, and 52 weeks following administration of the engineered islets to the subject. In some embodiments, upon administration of the engineered islets, the subject exhibits a peak c-peptide that is > 0.01 nmol / 1 in response to a mixed meal tolerance test (MMTT). In some embodiments, the peak c-peptide is > 0,01 nmol / 1 in response to a MMTT 4. 8, 12. 18, 26, and 52 weeks followingadministration of the engineered islets to the subject. In some embodiments, the peak c-peptide is measured by area rmder the curve (AUC). In some embodiments, upon administration of the engineered islets, the subject exhibits a non-fasting c-peptide concentration that is > 0.01 mnol / 1. In some embodiments, the non-fasting c-peptide concentration is > 0.01 nmol / 1 at 1, 2, 3, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, and 52 weeks following administration of the engineered islets to the subject. In some embodiments, upon administration of the engineered islets, the subject exhibits decreased insulin requirement per kilogram of body weight (BW). In some embodiments, the insulin requirement per kilogram of BW decreases 1, 2, 3, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, and 52 weeks following administration of the engineered islets to the subject. In some embodiments, upon administration of the engineered islets, the subject exhibits decreased HbAlc. In some embodiments, the HbAlc decrease 2, 4, 6. 8, 10. 12, 14, 16, 18, 20, 26, and 52 weeks following administration of the engineered islets to the subject. In some embodiments, upon administration of the engineered islets, the subject exhibits reductions in glucose variability. In some embodiments, glucose variability is reduced at 4, 8, 12, 18, 26, and 52 weeks following administration of the engineered islets to the subject. In some embodiments, upon administration of the engineered islets, the subject exhibits reductions in hypoglycemia. In some embodiments, hypoglycemia is reduced at 4, 8, 12, 18. 26, and 52 weeks following administration of the engineered islets to the subject. In some embodiments, upon administration of the engineered islets, the subject exhibits reductions in hyperglycemia. In some embodiments, hyperglycemia is reduced at 4, 8, 12, 18, 26, and 52 weeks following administration of the engineered islets to the subject.

[0165] In some aspects of the methods, combinations, kits, and uses provided herein, one or more immunosuppressive agents are administered to a subject. In some embodiments, the goal of immunosuppression may include promoting engraftment and / or promoting survival of the modified beta cell or composition (e.g., composition comprising modified beta cells) in a subject, while simultaneously minimizing drug toxicities, infection, and malignancy in the subject. In some embodiments, the one or more immunosuppressive agents are administered to the subject in combination with a composition comprising a modified beta cell for use in methods of treating beta cell related disorders, including diabetes (e.g., Type I diabetes). In some embodiments, the provided methods of administering one or more immunosuppressive agents and a composition comprising a modified beta cell arc useful for restoring or providing glucose metabolism to a subject in need thereof. In other embodiments, one or more immunosuppressive agents are administered to treat a pre-existing condition that is unrelated to the condition or disease being treated with the engineered islet cells.II. ENGINEERED ISLET CELLS AND GENERATION THEREOF

[0166] Provided herein are compositions comprising an engineered islet that includes islet cells that comprise one or more modifications (termed “engineered islet cell” or “modified islet cell”) that comprises a modification that regulates the expression of one or more target polynucleotide sequences,such as regulates the expression of one or more MHC class I molecules, one or more MHC class II molecules, or one or more MHC class I molecules and one or more MHC class II molecules.

[0167] In some embodiments, the provided engineered islets, also includes a modification to modulate (e.g., increase) expression of one or more tolerogenic factor. In some embodiments, the modulation of expression of the tolerogenic factor (e.g., increased expression), and the modulation of expression of the one or more MHC class I molecules and / or one or more MHC class II molecules (e.g., reduced or eliminated expression) is relative to the amount of expression of said molecule(s) in a cell that does not comprise the modification(s), such as a control cell. In some embodiments, the modulation of expression is relative to the amount of expression of said molecule(s) in a wild-type cell. In some embodiments, the control or wild-type cell is an islet cell that has not been engineered with the modifications. In some embodiments, modulation of expression of the tolerogenic factor (e.g., increased expression), and the modulation of expression of the one or more MHC class I molecules and / or one or more MHC class II molecules (e.g.. reduced or eliminated expression) is relative to the amount of expression of said molecule(s) in a control or wild-type cell of the same cell type that does comprise not the modification(s). In some embodiments, the control or wild-type cell does not express the one or more tolerogenic factor, the one or more MHC class I molecules, and / or the one or more MHC class II molecules. In some embodiments, it is understood that where the control or wild-type cell does not express the tolerogenic factor, the provided engineered islet cell includes a modification to overexpress the one or more tolerogenic factor or increase the expression of the one or more tolerogenic factor from 0%. It is understood that if the islet cell prior to the engineering does not express a detectable amount of the tolerogenic factor, then a modification that results in any detectable amount of an expression of the tolerogenic factor is an increase in the expression compared to the similar beta cell that does not contain the modifications.

[0168] In some embodiments, the provided engineered islets includes a modification to increase expression of one or more tolerogenic factors. In some embodiments, the tolerogenic factor is one or more of DUX4, B2M-HLA-E, CD35, CD52, CD 16, CD52, CD47, CD46, CD55, CD59, CD27, CD200, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, PD-L1, IDO1, CTLA4-Ig, Cl-Inhibitor, IL-10, IL-35, FASL, CCL21, MFGE8, SERPINB9, CD35, IL-39, CD16 Fc Receptor, IL15-RF, and H2-M3 (including any combination thereol). In some embodiments, the tolerogenic factor is one or more of CD47, PD-L1, HLA-E or HLA-G, CCL21, FasL, Serpinb9, CD200, and Mfge8 (including any combmation thereof), hi some embodiments, the modification to increase expression of one or more tolerogenic factors is or includes increased expression of CD47. In some embodiments, the modification to increase expression of one or more tolerogenic factors is or includes increased expression of PD-L1. In some embodiments, the modification to increase expression of one or more tolerogenic factors is or includes increased expression of HLA-E. In some embodiments, the modification to increase expression of one or more tolerogenic factors is or includes increased expression of HLA-G. In some embodiments, the modification to increaseexpression of one or more tolerogenic factors is or includes increased expression of CCL21, PD-L1, FasL, Serpinb9, H2-M3 (HLA-G), CD47, CD200, and Mfge8.

[0169] In some embodiments, the engineered islets includes one or more modifications, such as genomic modifications, that reduce expression of one or more MHC class I molecules and a modification that increases expression of CD47. In other words, the engineered islets comprise exogenous CD47 proteins and exhibit reduced or silenced surface expression of one or more one or more MHC class I molecules. In some embodiments, the engineered islets includes one or more genomic modifications that reduce expression of one or more MHC class II molecules and a modification that increases expression of CD47. In some instances, the engineered islets comprise exogenous CD47 nucleic acids and proteins and exhibit reduced or silenced surface expression of one or more MHC class I molecules. In some embodiments, the engineered islets includes one or more genomic modifications that reduce or eliminate expression of one or more MHC class II molecules, one or more genomic modifications that reduce or eliminate expression of one or more MHC class II molecules, and a modification that increases expression of CD47. In some embodiments, the engineered islets comprise exogenous CD47 proteins, exhibit reduced or silenced surface expression of one or more MHC class 1 molecules and exhibit reduced or lack surface expression of one or more MHC class II molecules. In many embodiments, the engineered islets is a B2Mindel / mdel, ciITA“ldel / indel, CD47tgcell.

[0170] In some embodiments, the engineered islets elicits a reduced level of immune activation or no immune activation upon administration to a recipient subject. In some embodiments, the engineered islets elicits a reduced level of systemic TH1 activation or no systemic TH1 activation in a recipient subject. In some embodiments, the engineered islets elicits a reduced level of immune activation of peripheral blood mononuclear cells (PBMCs) or no immune activation of PBMCs in a recipient subject. In some embodiments, the engineered islets elicits a reduced level of donor-specific IgG antibodies or no donor specific IgG antibodies against the cells upon administration to a recipient subject. In some embodiments, the engineered islets elicits a reduced level of IgM and IgG antibody production or no IgM and IgG antibody production against the cells in a recipient subject. In some embodiments, the engineered islets elicits a reduced level of cytotoxic T cell killing of the cells upon administration to a recipient subject.

[0171] In some embodiments, the engineered islets provided herein comprises a “suicide gene” or “suicide switch”. A suicide gene or suicide switch can be incorporated to function as a “safety switch” that can cause the death of the engineered islets, such as after the engineered islets is administered to a subject and if the engineered islets should grow and divide in an undesired manner. The “suicide gene” ablation approach includes a suicide gene in a gene transfer vector encoding a protein that results in cell killing only when activated by a specific compound. A suicide gene may encode an enzyme that selectively converts a nontoxic compound into highly toxic metabolites. The result is specifically eliminating cells expressing the enzyme. In some embodiments, the suicide gene is the herpesvirusthymidine kinase (HSV-tk) gene and the trigger is ganciclovir. In other embodiments, the suicide gene is the Escherichia coli cytosine deaminase (EC-CD) gene and the trigger is 5 -fluorocytosine (5-FC) (Barese et al, Mol. Therap. 20(10): 1932-1943 (2012), Xu et al, Cell Res. 8:73-8 (1998), both incorporated herein by reference in their entirety y

[0172] In other embodiments, the suicide gene is an inducible Caspase protein. An inducible Caspase protein comprises at least a portion of a Caspase protein capable of inducing apoptosis. In preferred embodiments, the inducible Caspase protein is iCasp9. It comprises the sequence of the human FK506-binding protein, FKBP12, with an F36V mutation, comiected through a series of amino acids to the gene encoding human caspase 9. FKBP12-F36V binds with high affinity to a small-molecule dimerizing agent, API 903. Thus, the suicide function of iCasp9 in the instant invention is triggered by the administration of a chemical inducer of dimerization (CID). I n some embodiments, the CID is the small molecule drug API 903. Dimerization causes the rapid induction of apoptosis. (See WO2011146862; Stasi et al, N. Engl. J. Med 365; 18 (2011): Tey et al, Biol. Blood Marrow Transplant.13:913-924 (2007), each of which are incorporated by reference herein in their entirety.)

[0173] Inclusion of a safety switch or suicide gene allows for controlled killing of the cells in the event of cytotoxicity or other negative consequences to the recipient, thus increasing the safety of cell-based therapies, including those using tolerogenic factors.

[0174] In some embodiments, a safety switch can be incorporated into, such as introduced, into the engineered islets provided herein to provide the ability to induce death or apoptosis of the engineered islets containing the safety switch, for example if the cells grow and divide in an undesired manner or cause excessive toxicity to the host. Thus, the use of safety switches enables one to conditionally eliminate aberrant cells in vivo and can be a critical step for the application of cell therapies in the clinic. Safety sw itches and their uses thereof are described in, for example, Duzgune, Origins of Suicide Gene Therapy (2019); Duzgune (eds), Suicide Gene Therapy. Methods in Molecular Biology, vol. 1895 (Humana Press, New York, NY) (for HSV-tk, cytosine deaminase, nitroreductase, purine nucleoside phosphorylase, and horseradish peroxidase); Zhou and Brenner, Exp Hematol 44(11) : 1013-1019 (2016) (for iCaspase9); Wang et al., Blood 18(5): 1255-1263 (2001) (for huEGFR); U.S. Patent Application Publication No. 20180002397 (for HER1); and Philip et al., Bloodl24(8): 1277-1287 (2014) (for RQR8).

[0175] In some embodiments, the safety switch can cause cell death in a controlled manner, for example, in the presence of a drug or prodrug or upon activation by a selective exogenous compound. In some embodiments, the safety switch is selected from the group consisting of herpes simplex virus thymidine kinase (HSV-tk), cytosine deaminase (CyD), nitroreductase (NTR), purine nucleoside phosphory lase (PNP), horseradish peroxidase, inducible caspase 9 (iCasp9), rapamycin-activated caspase 9 (rapaCasp9), CCR4. CD16, CD19, CD20. CD30, EGFR. GD2. HER1, HER2. MUCL PSMA, and RQR8.

[0176] In some embodiments, the safety switch may be a transgene encoding a product with cell killing capabilities when activated by a drug or prodrug, for example, by turning a non-toxic prodrug to a toxic metabolite inside the cell. In these embodiments, cell killing is activated by contacting a engineered islets with the drug or prodrug. In some cases, the safety switch is HSV-tk, which converts ganciclovir (GCV) to GCV-triphosphate, thereby interfering with DNA synthesis and killing dividing cells. In some cases, the safety switch is CyD or a variant thereof, which converts the antifungal drug 5-fluorocytosine (5-FC) to cytotoxic 5 -fluorouracil (5-FU) by catalyzing the hydrolytic deamination of cytosine into uracil. 5-FU is further converted to potent anti-metabolites (5- FdUMP, 5-FdUTP. 5-FUTP) by cellular enzymes. These compounds inhibit thymidylate synthase and the production of RNA and DNA, resulting in cell death. In some cases, the safety switch is NTR or a variant thereof, which can act on the prodrug CB 1954 via reduction of the nitro groups to reactive N-hydroxylamine intermediates that are toxic in proliferating and nonproliferating cells. In some cases, the safety switch is PNP or a variant thereof, which can turn prodrug 6-methylpurine deoxyriboside or fludarabine into toxic metabolites to both proliferating and nonproliferating cells. In some cases, the safety switch is horseradish peroxidase or a variant thereof, which can catalyze indole-3 -acetic acid (IAA) to a potent cytotoxin and thus achieve cell killing.

[0177] In some embodiments, the safety switch may be an iCasp9. Caspase 9 is a component of the intrinsic mitochondrial apoptotic pathway which, under physiological conditions, is activated by the release of cytochrome C from damaged mitochondria. Activated caspase 9 then activates caspase 3. which triggers terminal effector molecules leading to apoptosis. The iCasp9 may be generated by fusing a truncated caspase 9 (without its physiological dimerization domain or caspase activation domain) to a FK506 binding protein (FKBP), FKBP12-F36V. via a peptide linker. The iCasp9 has low dimerindependent basal activity and can be stably expressed in host cells (e.g., human T cells) without impairing their phenotype, function, or antigen specificity. However, in the presence of chemical inducer of dimerization (CID), such as rimiducid (API 903), AP20187, and rapamycin, iCasp9 can undergo inducible dimerization and activate the downstream caspase molecules, resulting in apoptosis of cells expressing the iCasp9. See, e.g., PCT Application Publication No. WO2011 / 146862; Stasi et al., N. Engl. J. Med. 365;18 (2011); Tey et al., Biol. Blood Marrow Transplant 13:913-924 (2007). In particular, the rapamycin inducible caspase 9 variant is called rapaCasp9. See Stavrou et al., Mai. Ther. 26(5): 1266-1276 (2018). Thus, iCasp9 can be used as a safety switch to achieve controlled killing of the host cells.

[0178] In some embodiments, the safety switch may be a membrane-expressed protein which allows for cell depletion after administration of a specific antibody to that protein. Safety switches of this category may include, for example, one or more transgene encoding CCR4. CD16, CD19, CD20, CD30, EGFR, GD2, HER1. HER2, MUC1, PSMA, or RQR8 for surface expression thereof. These proteins may have surface epitopes that can be targeted by specific antibodies. In some embodiments, the safety switch comprises CCR4, which can be recognized by an anti-CCR4 antibody. Non-limiting examples of suitableanti-CCR4 antibodies include mogamulizumab and biosimilars thereof. In some embodiments, the safety switch comprises CD16 or CD30. which can be recognized by an anti-CD16 or anti-CD30 antibody. Non-limiting examples of such anti-CD16 or anti-CD30 antibody include AFM13 and biosimilars thereof. In some embodiments, the safety switch comprises CD19, which can be recognized by an antiCD 19 antibody. Non-limiting examples of such anti-CD19 antibody include MOR208 and biosimilars thereof. In some embodiments, the safety switch comprises CD20, which can be recognized by an anti-CD20 antibody. Non-limiting examples of such anti-CD20 antibody include obinutuzumab, ublituximab, ocaratuzumab, rituximab, rituximab-Rllb, and biosimilars thereof. Cells that express the safety switch are thus CD20-positive and can be targeted for killing through administration of an anti-CD20 antibody as described. In some embodiments, the safety switch comprises EGFR, which can be recognized by an anti-EGFR antibody. Non-limiting examples of such anti -EGFR antibody include tomuzotuximab, RO5083945 (GA201), cetuximab, and biosimilars thereof. In some embodiments, the safety switch comprises GD2, which can be recognized by an anti-GD2 antibody. Non-limiting examples of such anti-GD2 antibody include Hul4.18K322A, Hul4.18-IL2, Hu3F8. dinituximab, c.60C3-Rllc, and biosimilars thereof.

[0179] In some embodiments, the safety switch may be an exogenously administered agent that recognizes one or more tolerogenic factor on the surface of the engineered islets. In some embodiments, the exogenously administered agent is an antibody directed against or specific to a tolerogenic agent, e.g.. an anti-CD47 antibody. By recognizing and blocking a tolerogenic factor on engineered islets, an exogenously administered antibody may block the immune inhibitor}' functions of the tolerogenic factor thereby re-sensitizing the immune system to the engineered islets. For instance, for a engineered islets that overexpresses CD47 an exogenously administered anti-CD47 antibody may be administered to the subject, resulting in masking of CD47 on the engineered islets and triggering of an immune response to the engineered islets. In some embodiments, the anti-CD47 antibody is Magrolimab.

[0180] In some embodiments, the safety switch comprises an anti-CD47 antibody. In some embodiments, the anti-CD47 antibody is Magrolimab. In some embodiments, the safety switch is Magrolimab.

[0181] In some embodiments, the method further comprises introducing an expression vector comprising an inducible suicide switch into the cell.

[0182] In some embodiments, the tolerogenic factor is CD47 and the cell includes an exogenous polynucleotide encoding a CD47 protein. In some embodiments, the cell expresses an exogenous CD47 polypeptide.

[0183] In some embodiments, a method disclosed herein comprises administering to a subject in need thereof a CD47-SIRPa blockade agent, wherein the subject was previously administered a engineered islets engineered to express an exogenous CD47 polypeptide. In some embodiments, the CD47-SIRPa blockade agent comprises a CD47-binding domain. In some embodiments, the CD47-binding domain comprises signal regulatory protein alpha (SIRPa) or a fragment thereof. In some embodiments, the CD47-SIRPa blockade agent comprises an immunoglobulin G (IgG) Fc domain. In some embodiments, the IgG Fc domain comprises an IgGl Fc domain. In some embodiments, the IgGl Fc domain comprises a fragment of a human antibody. In some embodiments, the CD47-SIRPa blockade agent is selected from the group consisting of TTI-621, TTI-622, and ALX148. In some embodiments, the CD47-SIRPa blockade agent is TTI-621, TTI-622, and ALX148. In some embodiments, the CD47-SIRPa blockade agent is TTI-622. In some embodiments, the CD47-SIRPa blockade agent is ALX148. In some embodiments, the IgG Fc domain comprises an IgG4 Fc domain. In some embodiments, the CD47-SIRPa blockade agent is an antibody. In some embodiments, tire antibody is selected from the group consisting of MIAP410, B6H12, and Magrolunab. In some embodiments, the antibody is MIAP410. In some embodiments, the antibody is B6H12. In some embodiments, die antibody is Magrolimab. In some embodiments, the antibody is selected from the group consisting of AO-176, IBI188 (letaplimab), STI-6643, and ZL-1201. In some embodiments, the antibody is AO-176 (Arch). In some embodiments, the antibody is IBI188 (letaplimab) (Innovent). In some embodiments, die antibody is STI-6643 (Sorrento). In some embodiments, the antibody is ZL-1201 (Zai).

[0184] In some embodiments, useful antibodies or fragments thereof that bind CD47 can be selected from a group that includes magrolimab ((Hu5F9-G4)) (Forty Seven, Inc.; Gilead Sciences, Inc.), urabrelimab, CC-90002 (Celgene; Bristol-Myers Squibb), IBI-188 (Innovent Biologies), IBI-322 (Innovent Biologies). TG-1801 (TG Therapeutics; also known as NI-1701, Novimmune SA). ALX148 (ALX Oncology), TJ011133 (also known as TJC4. 1-Mab Biopharma), FA3 3, ZL-1201 (Zai Lab Co.. Ltd), AK117 (Akesbio Australia Pty, Ltd.), AO-176 (Arch Oncology), SRF231 (Surface Oncology), GenSci-059 (GeneScience), C47B157 (lanssen Research and Development), C47B161 (Janssen Research and Development), C47B167 (Janssen Research and Development), C47B222 (Janssen Research and Development), C47B227 (Janssen Research and Development), Vx-1004 (Corvus Pharmaceuticals), HMBD004 (Hummingbird Bioscience Pte Ltd), SHR-1603 (Hengrui). AMMS4-G4 (Beijing Institute of Biotechnology ), RTX-CD47 (University of Groningen), and IMC-002. (Samsung Biologies; ImmuneOncia Therapeutics). In some embodiments, the antibody or fragment thereof does not compete for CD47 binding with an antibody selected from a group that includes magrolimab, urabrelimab, CC-90002, IBI-188, IBI-322, TG-1801 (NI-1701), ALX148, TJ011133, FA3M3, ZL1201, AK117, AO-176, SRF231, GenSci-059, C47B157, C47B161, C47B167, C47B222, C47B227, Vx-1004, HMBD004, SHR-1603, AMMS4-G4. RTX-CD47, and IMC-002. In some embodiments, the antibody or fragment thereof competes for CD47 binding with an antibody selected from magrolimab, urabrelimab. CC-90002, IBI-188, IBI-322. TG-1801 (NI-1701). ALX148, TJ011133, FA3M3, ZL1201, AK117, AO-176, SRF231, GenSci-059, C47B157. C47B161, C47B167, C47B222, C47B227, Vx-1004, HMBD004, SHR-1603, AMMS4-G4, RTX-CD47, and IMC-002. In some embodiments, the antibody or fragment thereof that binds CD47 is selected from a group that includes a single-chain Fv fragment (scFv) againstCD47, a Fab against CD47. a VHH nanobody against CD47, a DARPin against CD47. and variants thereof. In some embodiments, the scFv against CD47. a Fab against CD47. and variants thereof are based on the antigen binding domains of any of the antibodies selected from a group that includes magrolimab, urabrelimab, CC -90002, IBI-188, IBI-322, TG-1801 (NI-1701), ALX148, TJ011133, FA3M3, ZL1201, AK117, AO-176. SRF231, GenSci-059, C47B157, C47B161, C47B167, C47B222, C47B227, Vx-1004, HMBD004, SHR-1603, AMMS4-G4, RTX-CD47, and IMC-002.

[0185] In some embodiments, the CD47 antagonist provides CD47 blockade. Methods and agents for CD47 blockade are described in PCT / US2021 / 054326, which is incorporated by reference in its entirety.

[0186] In some embodiments, the engineered islets is derived from a source cell already comprising one or more of the desired modifications. In some embodiments, in view of the teachings provided herein one of ordinary skill in the art will readily appreciate how to assess what modifications are required to arrive at the desired final form of a engineered islets and that not all reduced or increased levels of target components are achieved via active engineering. In some embodiments, the modifications of the engineered islets may be in any order, and not necessarily the order listed in the descriptive language provided herein.

[0187] Once altered, the presence of expression of any of the molecule described herein can be assayed using known techniques, such as Western blots, ELISA assays, FACS assays, flow cytometry, and the like.A. Targets Having Reduced Expression Genes

[0188] In some embodiments, the engineered islets comprise a modification (e.g. genetic modifications) of one or more target polynucleotide or protein sequences (also interchangeably referred to as a target gene) that regulate (e.g. reduce or eliminate) the expression of one or more of: one or more MHC class I molecules, one or more MHC class II molecules, MIC-A, MIC-B, TXIP. CTLA-4 and / or PD-1. In some embodiments, the engineered islets comprise a modification of one or more gene that regulates (e.g. reduce or eliminate) one or more MHC class I molecules and / or one or more MHC class II molecules. In some embodiments, the one or more MHC class I molecules and / or one or more MHC class II molecules is any one or more of HLA-A, HLA-B, HLA-C, HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ and / or HLA-DR. In some embodiments, the modification to the target gene is a modification that reduces or eliminates any one or more of B2M, TAP I, NLRC5, CIITA, RFX5, RFXANK. RFXAP, NFY-A, NFY-B or NFY-C. In some embodiments, the engineered islets comprise a modification that reduces or eliminates expression of one or more of B2M, TAP I, NLRC5, CIITA. RFX5, RFXANK, RFXAP. NFY-A, NFY-B, NFY-C, MIC-A, MIC-B, TXIP, CTLA-4 and / or PD-1. Any of a variety of methods known to a skilled artisan can be used to reduce or eliminate expression of any such target genes, including any of variety of know n gene editing technologies.

[0189] In some embodiments, the provided the engineered islets comprise a modification (e.g. genetic modifications) of one or more target polynucleotide or protein sequences (also interchangeably referred to as a target gene) that regulate (c.g. reduce or eliminate) the expression of cither one or more MHC class I molecules, one or more MHC class II molecules, or one or more MHC class I molecules and one or more MHC class II molecules, hr some embodiments, the beta cell to be modified is an unmodified cell or non- modified cell (e.g., control cell) or a wild-type beta cell, such as non-engineered islets, that has not previously been introduced with the one or more modifications. In some embodiments, a genetic editing system is used to modify one or more target polynucleotide sequences that regulate (e.g. reduce or eliminate) the expression of either one or more MHC class I molecules, one or more MHC class II molecules, or one or more MHC class I molecules and one or more MHC class II molecules. In certain embodiments, the genome of the cell has been altered to reduce or delete components required or involved in facilitating HLA expression, such as expression of one or more MHC class I molecules and / or one or more MHC class II molecules on the surface of the cell. For instance, in some embodiments, expression of a beta-2 -microgloublin (B2M), a component of one or more MHC class I molecules, is reduced or eliminated in the cell, thereby reducing or elimination the protein expression (e.g. cell surface expression) of one or more MHC class I molecules by the modified cell. Thus, in some embodiments, expression can be reduced via a gene, and / or function thereof, RNA expression and function, protein expression and function, localization (such as cell surface expression), and longevity.

[0190] In some embodiments, an MHC in humans is also called a human leukocyte antigen (HLA). For instance, a human MHC class I is also known as an HLA class I and a human MHC class II is also known as an HLA class II. Thus, reference to MHC is intended to include the corresponding human HLA molecules, unless stated otherwise.

[0191] In some embodiments, reduced expression of a target is such that expression in a engineered islets is reduced to a level that is about 60% or less (such as about any of 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, 4% or less, 3% or less, 2% or less, or 1% or less) than a corresponding level of expression (e.g., protein expression compared with protein expression) of the target in a source cell prior to being modified to reduce expression of the target. In some embodiments, reduced expression of a target is such that expression in a engineered islets is reduced to a level that is about 60% or less (such as any of about 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less. 15% or less, 10% or less, 5% or less, 4% or less, 3% or less, 2% or less, or 1% or less) than a corresponding level of expression (e.g., protein expression compared with protein expression) of the target in a reference cell or a reference cell population (such as a cell or population of the same cell type or a cell having reduced or eliminated immunogenic response). In some embodiments, reduced expression of a target is such that expression in a engineered islets is reduced to a level that is at or lessthan a measured level of expression (such as a level known to exhibit reduced or eliminated immunogenic response due to the presence of the target). In some embodiments, the level of a target is assessed in a engineered islets, a reference cell, or reference cell population in a stimulated or nonstimulated state. In some embodiments, the level of a target is assessed in a engineered islets, a reference cell, or reference cell population in a stimulated state such that the target is expressed (or will be if it is a capability of the cell in response to the stimulus). In some embodiments, the stimulus represents an in vivo stimulus.

[0192] In some embodiments, the provided a engineered islets comprise a modification, such as a genetic modification, of one or more target polynucleotide sequences (also interchangeably referred to as a target gene) that regulate (e.g., reduce or eliminate) the expression of either one or more MHC class I molecules, one or more MHC class II molecules, or one or more MHC class I molecules and one or more MHC class II molecules. In some embodiments, an MHC in humans is also called a human leukocyte antigen. For instance, a human MHC class I molecule is also known as an HLA class I molecule and a human MHC class II molecules is also known as an HLA class II molecule. In some embodiments, the cell to be modified or modified is an unmodified cell or non- modified cell (e.g., control or wild-type cell) that has not previously been introduced with the one or more modifications. In some embodiments, a genetic editing system is used to modify one or more target polynucleotide sequences that regulate the expression of either one or more MHC class I molecules, one or more MHC class II molecules, or one or more MHC class I molecules and one or more MHC class II molecules. In certain embodiments, the genome of the cell has been altered to reduce or delete components require or involved in facilitating HLA expression, such as expression of one or more MHC class I molecules and / or one or more MHC class II molecules on the surface of the cell. For instance, in some embodiments, expression of a beta-2 -microgloublin (B2M), a component of one or more MHC class I molecules, is reduced or eliminated in the cell, thereby7reducing or elimination the protein expression (e.g. cell surface expression) of one or more MHC class I molecules by the modified cell.

[0193] In sonic embodiments, any of the described modifications in the engineered islets that regulate (e.g. reduce or eliminate) expression of one or more target polynucleotide or protein in the modified cell may be combined together with one or more modifications to overexpress a polynucleotide (e.g. tolerogenic factor, such as CD47) described in Section II. B.

[0194] In some embodiments, reduction of one or more MHC class I molecules and / or one or more MHC class II molecules expression can be accomplished, for example, by one or more of the following: (1) targeting the polymorphic HLA alleles (HLA-A. HLA-B, HLA-C) and one or more MHC class II molecules genes directly; (2) removal of B2M. which will reduce surface trafficking of all MHC class I molecules; and / or (3) deletion of one or more components of the MHC enhanceosomes, such as LRC5, RFX-5, RFXANK, RFXAP. IRF1. NF-Y (including NFY-A, NFY-B, NFY-C). and CIITA that are critical for HLA expression.

[0195] In certain embodiments, HLA expression is interfered with. In some embodiments. HLA expression is interfered with by targeting individual HLAs (e.g., knocking out expression of HLA- A, HLA-B and / or HLA-C), targeting transcriptional regulators of HLA expression (e.g., knocking out expression of NLRC5, CIITA, RFX5, RFXAP, RFXANK, NFY-A, NFY-B, NFY-C and / or IRF-1), blocking surface trafficking of one or more MHC class I molecules (e.g., knocking out expression of B2M and / or TAP 1), and / or targeting with HLA-RAZOR (see, e.g., W02016183041).

[0196] The human leukocytes antigen (HLA) complex is synonymous with human MHC. In some embodiments, the engineered islets disclosed herein is a human cell. In certain aspects, the engineered islets disclosed herein does not express one or more human leukocyte antigens (e.g., HLA-A, HLA-B and / or HLA-C) corresponding to one or more MHC class I molecules and / or one or more MHC class II molecules and are thus characterized as being hypoimmunogenic. For example, in certain aspects, the engineered islets disclosed herein has been modified such that the cell does not express or exhibit reduced expression of one or more of the following MHC class I molecules: HLA-A, HLA-B and HLA-C. In some embodiments, one or more of HLA-A, HLA-B and HLA-C may be "knocked-out" of a cell. A cell that has a knocked-out HLA-A gene, HLA-B gene, and / or HLA-C gene may exhibit reduced or eliminated expression of each knocked-out gene.

[0197] In certain embodiments, the expression of one or more MHC class I molecules and / or one or more MHC class II molecules is modulated by targeting and deleting a contiguous stretch of genomic DNA, thereby reducing or eliminating expression of a target gene selected from the group consisting of B2M, CIITA, andNLRC5.

[0198] In sonic embodiments, the provided engineered islets comprise a modification, such as a genetic modification, of one or more target poly nucleotide sequence that regulate one or more MHC class I. Exemplary' methods for reducing expression of one or more MHC class I molecules are described in sections below. In some embodiments, the targeted polynucleotide sequence is one or both of B2M and NLRC5. In some embodiments, the engineered islets comprise a genetic editing modification to the B2M gene. In some embodiments, the engineered islets comprise a genetic editing modification to the NLRC5 gene. In some embodiments, the engineered islets comprise genetic editing modifications to the B2M and CIITA genes.

[0199] In some embodiments, the provided engineered islets comprise a modification, such as a genetic modification, of one or more target polynucleotide sequence that regulate one or more MHC class II molecules. Exemplary methods for reducing expression of one or more MHC class II molecules are described in sections below. In some embodiments, the engineered islets comprise a genetic editing modification to the CIITA gene.

[0200] In some embodiments, the provided engineered islets comprise a modification, such as a genetic modification, of one or more target polynucleotide sequence that regulate one or more MHC class I molecules and one or more MHC class II molecules. Exemplar}' methods for reducing expression ofone or more MHC class I molecules and one or more MHC class II molecules are described in sections below. In some embodiments, the engineered islets comprise genetic editing modifications to the B2M and NLRC5 genes. In some embodiments, the engineered islets comprise genetic editing modifications to the CIITA and NLRC5 genes. In particular embodiments, the cell comprises genetic editing modifications to die B2M, CIITA and NLRC5 genes.

[0201] In some embodiments, the modification that reduces B2M, CIITA and / or NLRC5 expression reduces B2M, CIITA and / or NLRC5 mRNA expression. In some embodiments, the reduced mRNA expression of B2M, CIITA and / or NLRC5 is relative to an unmodified or wild-type cell of the same cell type that does not comprise the modification. In some embodiments, the mRNA expression of B2M is reduced by more than about 5%, such as reduced by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%. 80%, 90%, or more. In some embodiments, the mRNA expression of B2M, CIITA and / or NLRC5 is reduced by up to about 100%, such as reduced by up to about any of 90%, 80%.70%, 60%, 50%, 40%.30%, 20%, 10%, 5%, or less. In some embodiments, the mRNA expression of B2M. CIITA and / or NLRC5 is reduced by any of about 5%, 10%, 20%, 30%. 40%, 50%, 60%, 70%. 80%, 90%, or 100%. In some embodiments, the mRNA expression of B2M, CIITA and / or NLRC5 is eliminated (e.g.. 0% expression of B2M, CIITA and / or NLRC5 mRNA). In some embodiments, the modification that reduces B2M, CIITA and / or NLRC5 mRNA expression eliminates B2M, CIITA and / or NLRC5 gene activity.

[0202] In some embodiments, the modification that reduces B2M, CIITA and / or NLRC5 expression reduces B2M. CIITA and / or NLRC5 protein expression. In some embodiments, the reduced protein expression of B2M. CIITA and / or NLRC5 is relative to an unmodified or wild-type cell of the same cell ty pe that does not comprise the modification. In some embodiments, the protein expression of B2M, CIITA and / or NLRC5 is reduced by more than about 5%, such as reduced by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the protein expression of B2M, CIITA and / or NLRC5 is reduced by up to about 100%, such as reduced by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, or less. In some embodiments, the protein expression of B2M, CIITA and / or NLRC5 is reduced by any of about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, the protein expression of B2M, CIITA and / or NLRC5 is eliminated (e g., 0% expression of B2M, CIITA and / or NLRC5 protein). In some embodiments, the modification that reduces B2M, CIITA and / or NLRC5 protein expression eliminates B2M, CIITA and / or NLRC5 gene activity.

[0203] In some embodiments, the modification that reduces B2M, CIITA and / or NLRC5 expression comprises inactivation or disruption of the B2M, CIITA and / or NLRC5 gene. In some embodiments, the modification that reduces B2M. CIITA and / or NLRC5 expression comprises inactivation or disruption of one allele of the B2M, CIITA and / or NLRC5 gene. In some embodiments.the modification that reduces B2M, CIITA and / or NLRC5 expression comprises inactivation or disruption comprises inactivation or disruption of both alleles of the B2M, CIITA and / or NLRC5 gene.

[0204] In some embodiments, the modification comprises inactivation or disruption of one or more B2M, CIITA and / or NLRC5 coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption of all B2M, CIITA and / or NLRC5 coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption comprises an indel in the B2M, CIITA and / or NLRC5 gene. In some embodiments, the modification is a frameshift mutation of genomic DNA of the B2M, CIITA and / or NLRC5 gene. In some embodiments, the modification is a deletion of genomic DNA of the B2M, CIITA and / or NLRC5 gene. In some embodiments, the modification is a deletion of a contiguous stretch of genomic DNA of the B2M, CIITA and / or NLRC5 gene. In some embodiments, the B2M, CIITA and / or NLRC5 gene is knocked out.

[0205] In some embodiments, the engineered islets comprise reduced expression of one or more MHC class I, or a component thereof, wherein reduced is as described herein, such as relative to prior to engineering to reduce expression of one or more MHC class I molecules or a component thereof, a reference cell or a reference cell population (such as a cell having a desired lack of an immunogenic response), or a measured value. In some embodiments, the engineered islets is modified to reduce cell surface expression of the one or more MHC class I polypeptides, or a component thereof (such as B2M). Tn some embodiments, cell surface expression of the one or more MHC class I polypeptides, or a component thereof (such as B2M), on the engineered islets is reduced to a level that is about 60% or less (such as about any of 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, 4% or less, 3% or less, 2% or less, or 1% or less) than a level of the one or more MHC class I polypeptides, or a component thereof (such as B2M), cell surface expression prior to being modified to reduce cell surface presentation of the one or more MHC class I polypeptides, or a component thereof (such as B2M). In some embodiments, cell surface expression of the one or more MHC class I polypeptides, or a component thereof (such as B2M), on the modified cell is reduced to a level that is about 60% or less (such as about any of 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, 4% or less, 3% or less, 2% or less, or 1% or less) than a level of the one or more MHC class I polypeptides, or a component thereof (such as B2M), cell surface expression on a reference cell or a reference cell population (such as an average amount of one or more MHC class I polypeptides, or a component thereof (such as B2M), cell surface expression). In some embodiments, there is no cell surface presentation of the one or more MHC class I polypeptides, or a component thereof (such as B2M), on the modified beta bell (including no detectable cell surface expression, including as measured using known techniques, e.g., flow cytometry). In some embodiments, the engineered islets exhibits reduced protein expression of the one or more MHC class I polypeptides, or a component thereof (such as B2M). In some embodiments, protein expression of the one or more MHC class I polypeptides, or acomponent thereof (such as B2M), of the modified cell is reduced to a level that is about 60% or less (such as about any of 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, 4% or less, 3% or less, 2% or less, or 1% or less) than a level of the one or more MHC class I polypeptides, or a component thereof (such as B2M), protein expression prior to being modified to reduce protein expression of the one or more MHC class I polypeptides, or a component thereof (such as B2M). In some embodiments, protein expression of the one or more MHC class I polypeptides, or a component thereof (such as B2M), of the engineered islets is reduced to a level that is about 60% or less (such as about any of 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, 4% or less, 3% or less. 2% or less, or 1% or less) than a level of the one or more MHC class I polypeptides, or a component thereof (such as B2M), prior to being modified to reduce protein expression of the one or more MHC class I polypeptides, or a component thereof (such as B2M). In some embodiments, the engineered islets exhibits no protein expression of the one or more MHC class I polypeptides, or a component thereof (such as B2M), (including no detectable protein expression, including as measured using known techniques, e.g., western blot or mass spectrometry). In some embodiments, the engineered islets does not comprise the one or more MHC class I polypeptides, or a component thereof (such as B2M) (including no detectable protein, including as measured using known techniques, e.g.. western blot or mass spectrometry). In some embodiments, the engineered islets exhibits reduced mRNA expression encoding the one or more MHC class I polypeptides, or a component thereof (such as B2M). In some embodiments, mRNA expression encoding the one or more MHC class I polypeptides, or a component thereof (such as B2M), of the engineered islets is reduced to a level that is about 60% or less (such as about any of 55% or less. 50% or less. 45% or less. 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less. 5% or less, 4% or less. 3% or less, 2% or less, or 1% or less) than a level of mRNA expression encoding the one or more MHC class I polypeptides, or a component thereof (such as B2M), prior to being modified to reduce mRNA expression of the one or more MHC polypeptides, or a component thereof (such as B2M). In some embodiments, mRNA expression encoding the one or more MHC class I polypeptides, or a component thereof (such as B2M), of the engineered islets is reduced to a level that is about 60% or less (such as about any of 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less. 10% or less, 5% or less, 4% or less, 3% or less, 2% or less, or 1% or less) than a level of mRNA expression of a reference cell or a reference cell population. In some embodiments, the engineered islets docs not express mRNA encoding one or more MHC class I polypeptides, or a component thereof (including no detectable mRNA expression, including as measured using known techniques, e.g., sequencing techniques or PCR). In some embodiments, the engineered islets does not comprise mRNA encoding one or more MHC class I polypeptides, or a component thereof (including no detectable mRNA, including as measured using known techniques, e g., sequencing techniques or PCR). In some embodiments, the engineered isletscomprise a gene inactivation or disruption of the one or more MHC class I molecules gene. In some embodiments, the engineered islets comprise a gene inactivation or disruption of the one or more MHC class I molecules gene in both alleles. In some embodiments, the engineered islets comprise a gene inactivation or disruption of the one or more MHC class I molecules gene in all alleles. In some embodiments, the engineered islets is a one or more MHC class I molecules knockout or a one or more MHC class I molecules component (such as B2M) knockout.

[0206] In some embodiments, the engineered islets comprise reduced expression of one or more MHC class II molecules, wherein reduced is as described herein, such as relative to prior to engineering to reduce one or more MHC class II molecules expression, a reference cell or a reference cell population (such as a cell having a desired lack of an immunogenic response), or a measured value. In some embodiments, the engineered islets is engineered to reduced cell surface expression of the one or more MHC class II polypeptides. In some embodiments, cell surface expression of the one or more MHC class II polypeptides on the engineered islets is reduced to a level that is about 60% or less (such as about any of 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less. 25% or less. 20% or less.15% or less. 10% or less, 5% or less, 4% or less, 3% or less, 2% or less, or 1% or less) than a level of the one or more MHC class II polypeptides cell surface expression prior to being modified to reduce cell surface presentation of the one or more MHC class II polypeptides. In some embodiments, cell surface expression of the one or more MHC class II polypeptides on the engineered islets is reduced to a level that is about 60% or less (such as about any of 55% or less. 50% or less. 45% or less. 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, 4% or less, 3% or less. 2% or less, or 1% or less) than a level of the one or more MHC class II polypeptides cell surface expression on a reference cell or a reference cell population (such as an average amount of one or more MHC class II polypeptides cell surface expression). In some embodiments, there is no cell surface presentation of the one or more MHC class II polypeptides on the engineered islets (including no detectable cell surface expression, including as measured using known techniques, e.g., flow cytometry). In some embodiments, the engineered islets exhibits reduced protein expression of the one or more MHC class II polypeptides. In some embodiments, protein expression of the one or more MHC class II polypeptides of the engineered islets is reduced to a level that is about 60% or less (such as about any of 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less. 5% or less, 4% or less, 3% or less, 2% or less, or 1% or less) than a level of the one or more MHC class II polypeptides protein expression prior to being modified beta to reduce protein expression of the one or more MHC class II polypeptides. In some embodiments, protein expression of the MHC class II polypeptides of the engineered islets is reduced to a level that is about 60% or less (such as about any of 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, 4% or less, 3% or less, 2% or less, or 1% or less) than a level of the one or more MHC class II polypeptides prior to being modified to reduce proteinexpression of the one or more MHC class II polypeptides. In some embodiments, the engineered islets exhibits no protein expression of the one or more MHC class II polypeptides (including no detectable protein expression, including as measured using known techniques, e.g., western blot or mass spectrometry ). In some embodiments, the engineered islets does not comprise the one or more MHC class II polypeptides (including no detectable protein, including as measured using known techniques, e.g., western blot or mass spectrometry). In some embodiments, the engineered islets exhibits reduced mRNA expression encoding the one or more MHC class II polypeptides. In some embodiments, mRNA expression encoding the one or more MHC class II polypeptides of the engineered islets is reduced to a level that is about 60% or less (such as about any of 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less. 4% or less, 3% or less, 2% or less, or 1% or less) than a level of mRNA expression encoding the one or more MHC class II polypeptides prior to being modified beta to reduce mRNA expression of the one or more MHC class II polypeptides. In some embodiments, mRNA expression encoding the one or more MHC class II polypeptides of the engineered islets is reduced to a level that is about 60% or less (such as about any of 55% or less. 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less. 10% or less, 5% or less, 4% or less, 3% or less, 2% or less, or 1% or less) than a level of mRNA expression of a reference cell or a reference cell population. In some embodiments, the engineered islets does not express mRNA encoding one or more MHC class II polypeptides (including no detectable mRNA expression, including as measured using known techniques, e.g., sequencing techniques or PCR). In some embodiments, the engineered islets does not comprise mRNA encoding one or more MHC class II polypeptides (including no detectable mRNA, including as measured using known techniques, e.g., sequencing techniques or PCR). In some embodiments, the engineered islets comprise a gene inactivation or disruption of the one or more MHC class II molecules gene. In some embodiments, the engineered islets comprise a gene inactivation or disruption of the one or more MHC class II molecules gene in both alleles. In some embodiments, the engineered islets comprise a gene inactivation or disruption of the one or more MHC class II molecules in all alleles. In some embodiments, the engineered islets is a one or more MHC class II molecules knockout.1. Methods of Reducing Expression

[0207] In some embodiments, the cells provided herein are modified, such as genetically modified, to reduce expression of the one or more target polynucleotides as described. In some embodiments, the cell that is engineered (e.g.. modified) with the one or more modifications to reduce (e.g. eliminate) expression of a polynucleotide or protein is any source cell as described herein. In some embodiments, the source cell is any cell described herein. In certain embodiments, the cells (e.g., beta cells) disclosed herein comprise one or more modifications, such as genetic modifications, to reduce expression of one or more target polynucleotides. Non-limiting examples of the one or more targetpolynucleotides include any as described above, such as one or more of MHC class I molecules, or a component thereof, one or more MHC class II molecules, CIITA. B2M. NLRC5, HLA-A, HLA-B, HLA-C, LRC5, RFX-ANK, RFX5, RFX-AP, NFY-A, NFY-B, NFY-C, IRF1, and TAPI. In some embodiments, the one or more modifications, such as genetic modifications, to reduce expression of the one or more target polynucleotides is combined with one or more modifications to increase expression of a desired transgcnc, such as any described herein. In some embodiments, the one or more modifications, such as genetic modifications, create engineered islets drat are immune-privileged or hypoimmuno genic cells. By modulating (e.g., reducing or deleting) expression of one or a plurality of the target polynucleotides, such cells exhibit decreased immune activation when engrafted into a recipient subject. In some embodiments, the cell is considered hypoimmunogenic, e.g., in a recipient subject or patient upon administration.

[0208] Any method for reducing expression of a target polynucleotide may be used. In some embodiments, the modifications (e.g.. genetic modifications) result in permanent elimination or reduction in expression of the target polynucleotide. For instance, in some embodiments, the target polynucleotide or gene is disrupted by introducing a DNA break in the target polynucleotide, such as by using a targeting endonuclease. In other embodiments, the modifications (e.g.. genetic modifications) result in transient reduction in expression of the target polynucleotide. For instance, in some embodiments gene repression is achieved using an inhibitory nucleic acid that is complementary to the target polynucleotide to selectively suppress or repress expression of the gene, for instance using antisense techniques, such as by RNA interference (RNAi). short interfering RNA (siRNA), short hairpin (shRNA), and / or ribozymes.

[0209] In some embodiments, the target polynucleotide sequence is a genomic sequence. In some embodiments, the target polynucleotide sequence is a human genomic sequence. In some embodiments, the target polynucleotide sequence is a mammalian genomic sequence. In some embodiments, the target polynucleotide sequence is a vertebrate genomic sequence.

[0210] In some embodiments, any of gene editing technologies can be used to reduce expression of the one or more target polynucleotides or target proteins as described. In some embodiments, the gene editing technology can include systems involving nucleases, integrases, transposases, recombinases. In some embodiments, the gene editing technologies can be used for knock-out or knock-dow n of genes. In some embodiments, the gene-editing technologies can be used for knock-in or integration of DNA into a region of the genome. In some embodiments, the gene editing technology mediates single-strand breaks (SSB). In some embodiments, the gene editing technology mediates double-strand breaks (DSB), including in connection with non-homologous end-joining (NHEJ) or homology-directed repair (HDR). In some embodiments, the gene editing technology can include DNA-based editing or primeediting. In some embodiments, the gene editing technology can include Programmable Addition via Sitespecific Targeting Elements (PASTE).

[0211] In some embodiments, gene disruption is carried out by induction of one or more doublestranded breaks and / or one or more single-stranded breaks in the gene, ty pically in a targeted manner. In some embodiments, the double-stranded or single-stranded breaks arc made by a nuclease, c.g., an endonuclease, such as a gene-targeted nuclease. In some embodiments, the targeted nuclease is selected from zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALENs), and RNA-guided nucleases such as a CRISPR-associated nuclease (Cas), specifically designed to be targeted to the sequence of a gene or a portion thereof. In some embodiments, the targeted nuclease generates doublestranded or single-stranded breaks that then undergo repair through error prone non-homologous end joining (NHEJ) or, in some cases, precise homology directed repair (HDR) in which a template is used. In some embodiments, the targeted nuclease generates DNA double strand breaks (DSBs). In some embodiments, the process of producing and repairing the breaks is typically error prone and results in insertions and deletions (indels) of DNA bases from NHEJ repair. In some embodiments, the genetic modification may induce a deletion, insertion or mutation of the nucleotide sequence of the target gene. In some cases, the genetic modification may result in a frameshift mutation, which can result in a premature stop codon. In examples of nuclease-mediated gene editing the targeted edits occur on both alleles of the gene resulting in a biallelic disruption or edit of the gene. In some embodiments, all alleles of the gene are targeted by the gene editing. In some embodiments, genetic modification with a targeted nuclease, such as using a CRISPR / Cas system, leads to complete knockout of the gene.

[0212] In some embodiments, the nuclease, such as a rare-cutting endonuclease, is introduced into a cell containing the target polynucleotide sequence. The nuclease may be introduced into the cell in the form of a nucleic acid encoding the nuclease. The process of introducing the nucleic acids into cells can be achieved by any suitable technique. Suitable techniques include calcium phosphate or lipid -mediated transfection, electroporation, and transduction or infection using a viral vector. In some embodiments, the nucleic acid that is introduced into the cell is DNA. In some embodiments, the nuclease is introduced into the cell in the form of a protein. For instance, in the case of a CRISPR / Cas system a ribonuclcoprotcin (RNP) may be introduced into the cell.

[0213] In some embodiments, the modification (e.g., genetic modification) occurs using a CRISPR / Cas system. Any CRISPR / Cas system that is capable of altering a target polynucleotide sequence in a cell can be used. Such CRISPR-Cas systems can employ a variety of Cas proteins (Haft et al. PloS Comput Biol. 2005; 1 (6)e60). The molecular machinery of such Cas proteins that allows the CRISPR / Cas system to alter target polynucleotide sequences in cells include RNA binding proteins, endo- and exo-nucleases, helicases, and polymerases. In some embodiments, the CRISPR / Cas system is a CRISPR type I system. In some embodiments, the CRISPR / Cas system is a CRISPR type II system. In some embodiments, the CRISPR / Cas system is a CRISPR type V system.

[0214] The CRISPR / Cas systems includes targeted systems that can be used to alter any target polynucleotide sequence in a cell. In some embodiments, a CRISPR / Cas system provided hereinincludes a Cas protein and one or more, such as at least one to tw o. ribonucleic acids (e.g., guide RNA (gRNA)) that are capable of directing the Cas protein to and hybridizing to a target motif of a target polynucleotide sequence.

[0215] In some embodiments, a Cas protein comprises one or more amino acid substitutions or modifications. In some embodiments, the one or more amino acid substitutions comprises a conservative amino acid substitution. In some instances, substitutions and / or modifications can prevent or reduce proteoly tic degradation and / or extend the half-life of the polypeptide in a cell. In some embodiments, the Cas protein can comprise a peptide bond replacement (e.g., urea, thiourea, carbamate, sulfonyl urea, etc.). In some embodiments, the Cas protein can comprise a naturally occurring amino acid. In some embodiments, the Cas protein can comprise an alternative amino acid (e.g., D-amino acids, beta-amino acids, homocysteine, phosphoserine, etc.). In some embodiments, a Cas protein can comprise a modification to include a moiety (e.g., PEGylation, glycosylation, lipidation, acetylation, end-capping, etc.).

[0216] In some embodiments, a Cas protein comprises a core Cas protein. Exemplary Cas core proteins include, but are not limited to, Casl, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8,Cas9, Casl2a, and Cas 13. In some embodiments, a Cas protein comprises a Cas protein of an E. coli subtype (also known as CASS2). Exemplary Cas proteins of the E. Coli subtype include, but are not limited to Csel, Cse2, Cse3, Cse4, and Cas5e. In some embodiments, a Cas protein comprises a Cas protein of the Ypest subtype (also known as CASS3). Exemplary Cas proteins of the Ypest subtype include, but are not limited to Csy 1, Csy2, Csy3, and Csy4. In some embodiments, a Cas protein comprises a Cas protein of the Nmeni subty pe (also known as CASS4). Exemplary Cas proteins of the Nmeni subtype include, but are not limited to Csnl and Csn2. In some embodiments, a Cas protein comprises a Cas protein of the Dvulg subtype (also known as CASS1). Exemplary Cas proteins of the Dvulg subty pe include Csdl, Csd2, and Cas5d. In some embodiments, a Cas protein comprises a Cas protein of the Tneap subty pe (also known as CASS7). Exemplary' Cas proteins of the Tneap subty pe include, but are not limited to, Cstl, Cst2, Cas5t. In some embodiments, a Cas protein comprises a Cas protein of the Hmari subtype. Exemplary' Cas proteins of the Hmari subtype include, but are not limited to Cshl, Csh2, and Cas5h. In some embodiments, a Cas protein comprises a Cas protein of the Apem subtype (also known as CASS5). Exemplary' Cas proteins of the Apern subtype include, but are not limited to Csal, Csa2, Csa3, Csa4, Csa5, and Cas5a. In some embodiments, a Cas protein comprises a Cas protein of the Mtube subtype (also known as CASS6). Exemplary' Cas proteins of the Mtube subtype include, but are not limited to Csml, Csm2, Csm3, Csm4, and Csm5. In some embodiments, a Cas protein comprises a RAMP module Cas protein. Exemplary RAMP module Cas proteins include, but are not limited to, Cmrl, Cmr2, Cmr3, Cmr4, Cmr5, and Cmr6. See, e.g., Klompe et al., Nature 571, 219-225 (2019); Strecker et al., Science 365, 48-53 (2019).

[0217] In some embodiments, the methods for genetically modifying cells to knock out, knock down, or otherwise modify' one or more genes comprise using a site-directed nuclease, including, for example, zinc finger nucleases (ZFNs), transcription activator-likc effector nucleases (TALENs), meganucleases, transposases, and clustered regularly interspaced short palindromic repeat (CRISPR) / Cas systems

[0218] ZFNs are fusion proteins comprising an array of site-specific DNA binding domains adapted from zinc finger-containing transcription factors attached to the endonuclease domain of the bacterial FokI restriction enzyme. A ZFN may have one or more (e.g., 1, 2, 3. 4, 5, 6, 7, 8, 9. 10, or more) of the DNA binding domains or zinc finger domains. See, e.g., Carroll et al., Genetics Society of America (2011) 188:773-782; Kim et al., Proc. Natl. Acad. Sci. USA (1996) 93:1156-1160. Each zinc finger domain is a small protein structural motif stabilized by one or more zinc ions and usually recognizes a 3- to 4-bp DNA sequence. Tandem domains can thus potentially bind to an extended nucleotide sequence that is unique within a cell’s genome.

[0219] Various zinc fingers of known specificity can be combined to produce multi-finger polypeptides which recognize about 6, 9, 12. 1 . or 18-bp sequences. Various selection and modular assembly techniques are available to generate zinc fingers (and combinations thereol) recognizing specific sequences, including phage display, yeast one-hybrid systems, bacterial one-hybrid and two-hybrid systems, and mammalian cells. Zinc fingers can be engineered to bind a predetermined nucleic acid sequence. Criteria to engineer a zinc finger to bind to a predetermined nucleic acid sequence are known in the art. See, e.g., Sera et al., Biochemistry (2002) 41:7074-7081; Liu et al., Bioinformatics (2008) 24:1850-1857.

[0220] ZFNs containing FokI nuclease domains or other dimeric nuclease domains function as a dimer. Uius, a pair of ZFNs are required to target non-palindromic DNA sites. The two individual ZFNs must bind opposite strands of the DNA with their nucleases properly spaced apart. See Bitinaite et al., Proc. Natl. Acad. Sci. USA (1998) 95:10570-10575. To cleave a specific site in the genome, a pair of ZFNs are designed to recognize two sequences flanking the site, one on the forward strand and the other on the reverse strand. Upon binding of the ZFNs on either side of the site, the nuclease domains dimerize and cleave the DNA at the site, generating a DSB with 5' overhangs. HDR can then be utilized to introduce a specific mutation, with the help of a repair template containing the desired mutation flanked by homology arms. The repair template is usually an exogenous double-stranded DNA vector introduced to the cell. See Miller et al., Nat. Biotechnol. (2011) 29:143-148; Hockemeyer et al., Nat. Biotechnol. (2011) 29:731-734.

[0221] TALENs are another example of an artificial nuclease which can be used to edit a target gene. TALENs are derived from DNA binding domains termed TALE repeats, which usually comprise tandem arrays with 10 to 30 repeats that bind and recognize extended DNA sequences. Each repeat is 33 to 35 amino acids in length, with two adjacent amino acids (termed the repeat-variable di-residue, or RVD) conferring specificity for one of the four DNA base pairs. Thus, there is a one-to-one correspondence between the repeats and the base pairs in the target DNA sequences.

[0222] TALENs are produced artificially by fusing one or more TALE DNA binding domains (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) to a nuclease domain, for example, a FokI endonuclease domain. See Zhang, Nature Biotech. (2011) 29: 149-153. Several mutations to FokI have been made for its use in TALENs; these, for example, improve cleavage specificity or activity . See Cermak et al., Nucl. Acids Res. (2011) 39:e82; Miller et al., Nature Biotech. (2011) 29:143-148; Hockemeyer et al., Nature Biotech. (2011) 29:731-734; Wood et al., Science (2011) 333:307; Doyon et al., Nature Methods (2010) 8:74-79; Szczepek et al., Nature Biotech (2007) 25:786-793; Guo et al., J. Mol. Biol. (2010) 200:96. The FokI domain functions as a dimer, requiring two constructs with unique DNA binding domains for sites in the target genome with proper orientation and spacing. Both the number of amino acid residues between the TALE DNA binding domain and the FokI nuclease domain and the number of bases between the two individual TALEN binding sites appear to be important parameters for achieving high levels of activity. Miller et al.. Nature Biotech. (2011) 29:143-148.

[0223] By combining engineered TALE repeats with a nuclease domain, a site-specific nuclease can be produced specific to any desired DNA sequence. Similar to ZFNs. TALENs can be introduced into a cell to generate DSBs at a desired target site in the genome, and so can be used to knock out genes or knock in mutations in similar, HDR-mediated pathways. See Boch, Nature Biotech. (201 1) 29:135-136; Boch et al., Science (2009) 326:1509-1512; Moscou et al.. Science (2009) 326:3501.

[0224] Meganucleases are enzymes in the endonuclease family which are characterized by their capacity to recognize and cut large DNA sequences (from 14 to 40 base pairs). Meganucleases are grouped into families based on their structural motifs which affect nuclease activity and / or DNA recognition. The most widespread and best known meganucleases are the proteins in the LAGLIDADG family, which owe their name to a conserved amino acid sequence. See Chevalier et al., Nucleic Acids Res. (2001) 29(18): 3757-3774. On the other hand, the GIY-YIG family members have a GIY-YIG module, which is 70-100 residues long and includes four or five conserved sequence motifs with four invariant residues, tw o of which are required for activity. See Van Roey et al., Nature Struct. Biol. (2002) 9:806-811. The His-Cys family meganucleases are characterized by a highly conserved series of histidines and cysteines over a region encompassing several hundred amino acid residues. See Chevalier et al., Nucleic Acids Res. (2001) 29(18):3757-3774. Members of the NHN family are defined by motifs containing two pairs of conserved histidines surrounded by asparagine residues. See Chevalier et al.. Nucleic Acids Res. (2001) 29(18):3757-3774.

[0225] Because the chance of identifying a natural meganuclease for a particular target DNA sequence is low due to the high specificity requirement, various methods including mutagenesis and high throughput screening methods have been used to create meganuclease variants that recognize unique sequences. Strategies for engineering a meganuclease with altered DNA-binding specificity, e.g., to bindto a predetermined nucleic acid sequence are known in the art. See, e.g., Chevalier et al., Mol. Cell. (2002) 10:895-905; Epinatet al., Nucleic Acids Res (2003) 31:2952-2962; Silva et al., J Mol. Biol. (2006) 361:744-754; Seligman et al., Nucleic Acids Res (2002) 30:3870-3879; Sussman et al., J Mol Biol (2004) 342:31-41; Doyon et al., J Am Chem Soc (2006) 128:2477-2484; Chen et al., Protein Eng Des Sei (2009) 22:249-256; Arnould et al., J Mol Biol. (2006) 355:443-458; Smith et al., Nucleic Acids Res. (2006) 363 (2): 283 -294.

[0226] Like ZFNs and TALENs, Meganucleases can create DSBs in the genomic DNA. which can create a frame-shift mutation if improperly repaired, e.g., via NHEJ, leading to a decrease in the expression of a target gene in a cell. Alternatively, foreign DNA can be introduced into the cell along with the meganuclease. Depending on the sequences of the foreign DNA and chromosomal sequence, this process can be used to modify the target gene. See Silva et al.. Current Gene Therapy (2011) 11:11-27.

[0227] Transposases are enzymes that bind to the end of a transposon and catalyze its movement to another part of the genome by a cut and paste mechanism or a replicative transposition mechanism. By linking transposases to other systems such as the CRISPER / Cas system, new gene editing tools can be developed to enable site specific insertions or manipulations of the genomic DNA. There are two known DNA integration methods using transposons which use a catalytically inactive Cas effector protein and Tn7-like transposons. The transposase-dependent DNA integration does not provoke DSBs in the genome, which may guarantee safer and more specific DNA integration.

[0228] The CRISPR system was originally discovered in prokaryotic organisms (e.g., bacteria and archaea) as a system involved in defense against invading phages and plasmids that provides a form of acquired immunity. Now it has been adapted and used as a popular gene editing tool in research and clinical applications.

[0229] CRISPR / Cas systems generally comprise at least two components: one or more guide RNAs (gRNAs) and a Cas protein. The Cas protein is a nuclease that introduces a DSB into the target site. CRISPR-Cas systems fall into two major classes: class 1 systems use a complex of multiple Cas proteins to degrade nucleic acids; class 2 systems use a single large Cas protein for the same purpose. Class 1 is divided into types I, III, and IV; class 2 is divided into types II, V, and VI. Different Cas proteins adapted for gene editing applications include, but are not limited to, Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c. Cas9. Casio, Casl2. Casl2a (Cpfl), Casl2b (C2cl), Casl2c (C2c3), Casl2d (CasY), Casl2e (CasX), Casl2f (C2cl0), Casl2g. Casl2h. Casl2i. Casl2k (C2c5), Casl3, Casl3a (C2c2). Casl3b. Casl3c, Casl3d, C2c4, C2c8, C2c9, Cmr5, Csel, Cse2, Csfl, Csm2. Csn2. CsxlO, Csxll, Csyl, Csy2. Csy3. and Mad7. The most widely used Cas9 is a type II Cas protein and is described herein as illustrative. These Cas proteins may be originated from different source species. For example, Cas9 can be derived from S. pyogenes or S. aureus.

[0230] In the original microbial genome, the type II CRISPR system incorporates sequences from invading DNA between CRISPR repeat sequences encoded as arrays within the host genome. Transcripts from the CRISPR repeat array s arc processed into CRISPR RNAs (crRNAs) each harboring a variable sequence transcribed from die invading DNA, known as the “protospacer” sequence, as well as part of the CRISPR repeat. Each crRNA hybridizes with a second transactivating CRISPR RNA (tracrRNA), and these two RNAs fonn a complex with the Cas9 nuclease. The protospacer-encoded portion of the crRNA directs the Cas9 complex to cleave complementary target DNA sequences, provided that they are adjacent to short sequences known as “protospacer adjacent motifs’’ (PAMs).

[0231] Since its discovery, the CRISPR system has been adapted for inducing sequence specific DSBs and targeted genome editing in a wide range of cells and organisms spanning from bacteria to eukaryotic cells including human cells. In its use in gene editing applications, artificially designed, synthetic gRNAs have replaced the original crRNA:tracrRNA complex. For example, the gRNAs can be single guide RNAs (sgRNAs) composed of a crRNA, a tetraloop, and a tracrRNA. The crRNA usually comprises a complementary region (also called a spacer, usually about 20 nucleotides in length) that is user-designed to recognize a target DNA of interest. The tracrRNA sequence comprises a scaffold region for Cas nuclease binding. The crRNA sequence and the tracrRNA sequence are linked by the tetraloop and each have a short repeat sequence for hybridization with each other, thus generating a chimeric sgRNA. One can change the genomic target of the Cas nuclease by simply changing the spacer or complementary region sequence present in the gRNA. The complementary region will direct the Cas nuclease to the target DNA site through standard RNA-DNA complementary base pairing rules.

[0232] In order for the Cas nuclease to function, there must be a PAM immediately downstream of the target sequence in the genomic DNA. Recognition of the PAM by the Cas protein is thought to destabilize the adjacent genomic sequence, allowing interrogation of the sequence by the gRNA and resulting in gRNA-DNA pairing when a matching sequence is present. The specific sequence of PAM varies depending on the species of the Cas gene. For example, the most commonly used Cas9 nuclease derived from S. pyogenes recognizes a PAM sequence of 5’-NGG-3’ or, at less efficient rates, 5‘-NAG-3’, where “N” can be any nucleotide. Other Cas nuclease variants with alternative PAMs have also been characterized and successfully used for genome editing, which are summarized in Table la below. Table la. Exemplary Cas nuclease variants and their PAM sequences>R = A or G; Y = C or T; W = A or T; V = A or C or G; N = any base

[0233] In some embodiments, Gas nucleases may comprise one or more mutations to alter their activity, specificity, recognition, and / or other characteristics. For example, the Cas nuclease may have one or more mutations that alter its fidelity to mitigate off-target effects (e.g., eSpCas9, SpCas9-HFl, HypaSpCas9, HeFSpCas9, and evoSpCas9 high-fidelity variants of SpCas9). For another example the Cas nuclease may have one or more mutations that alter its PAM specificity.

[0234] In some embodiments, a Cas protein comprises any one of the Cas proteins described herein or a functional portion thereof. As used herein, "functional portion" refers to a portion of a peptide which retains its ability to complex with at least one ribonucleic acid (e.g., guide RNA (gRNA)) and cleave a target polynucleotide sequence. In some embodiments, the functional portion comprises a combination of operably linked Cas9 protein functional domains selected from the group consisting of a DNA binding domain, at least one RNA binding domain, a helicase domain, and an endonuclease domain. In some embodiments, the functional portion comprises a combination of operably linked Casl2a (also known as Cpfl) protein functional domains selected from the group consisting of a DNA binding domain, at least one RNA binding domain, a helicase domain, and an endonuclease domain. In some embodiments, the functional domains form a complex. In some embodiments, a functional portion of the Cas9 protein comprises a functional portion of a RuvC-like domain. In some embodiments, a functional portion of the Cas9 protein comprises a functional portion of the HNH nuclease domain. In some embodiments, a functional portion of the Casl2a protein comprises a functional portion of a RuvC-like domain.

[0235] In some embodiments, suitable Cas proteins include, but are not limited to, CasO, Cas 12a (i.e. Cpfl), Cas 12b, Casl2i, CasX, and Mad7.

[0236] In some embodiments, exogenous Cas protein can be introduced into the cell in polypeptide form. In certain embodiments, Cas proteins can be conjugated to or fused to a cellpenetrating polypeptide or cell-penetrating peptide. As used herein, "cell-penetrating polypeptide" and "cell-penetrating peptide" refers to a polypeptide or peptide, respectively, which facilitates the uptake of molecule into a cell. The cell-penetrating polypeptides can contain a detectable label.

[0237] In certain embodiments, Cas proteins can be conjugated to or fused to a charged protein (e.g., that carries a positive, negative or overall neutral electric charge). Such linkage may be covalent. In some embodiments, the Cas protein can be fused to a superpositively charged GFP to significantlyincrease the ability of the Cas protein to penetrate a cell (Cronican et al. ACS Chem Biol. 2010; 5(8):747-52). In certain embodiments, the Cas protein can be fused to a protein transduction domain (PTD) to facilitate its entry into a cell. Exemplary' PTDs include Tat, oligoarginine, and penetratin. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a cell-penetrating peptide. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a PTD. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a tat domain. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to an oligoarginine domain. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a penetratin domain. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a superpositively charged GFP. In some embodiments, the Cas 12a protein comprises a Casl2a polypeptide fused to a cell-penetrating peptide. In some embodiments, the Casl2a protein comprises a Casl2a polypeptide fused to a PTD. In some embodiments, the Cas 12a protein comprises a Casl2a polypeptide fused to a tat domain. In some embodiments, the Casl2a protein comprises a Casl2a polypeptide fused to an oligoarginine domain. In some embodiments, the cas!2a protein comprises a Casl2a polypeptide fused to a penetratin domain. In some embodiments, the Casl2a protein comprises a Cas 12a polypeptide fused to a superpositively charged GFP.

[0238] In some embodiments, the Cas protein can be introduced into a cell containing the target polynucleotide sequence in the form of a nucleic acid encoding the Cas protein. The process of introducing the nucleic acids into cells can be achieved by any suitable technique. Suitable techniques include calcium phosphate or lipid-mediated transfection, electroporation, and transduction or infection using a viral vector. In some embodiments, the nucleic acid comprises DNA. In some embodiments, the nucleic acid comprises a modified DNA, as described herein. In some embodiments, the nucleic acid comprises mRNA. In some embodiments, the nucleic acid comprises a modified mRNA. as described herein (e.g., a synthetic, modified mRNA).

[0239] In some embodiments, the Cas protein is complexed with one to two ribonucleic acids (e.g., guide RNA (gRNA)). In some embodiments, the Cas protein is complexed with two ribonucleic acids. In some embodiments, the Cas protein is complexed with one ribonucleic acid. In some embodiments, the Cas protein is encoded by a modified nucleic acid, as described herein (e.g., a synthetic, modified mRNA).

[0240] In provided embodiments, a CRISPR / Cas system generally includes two components: one or more guide RNA (gRNA) and a Cas protein. In some embodiments, the Cas protein is complexed with the one or more, such as one to two, ribonucleic acids (e.g., guide RNA (gRNA)). In some embodiments, the Cas protein is complexed with two ribonucleic acids. In some embodiments, the Cas protein is complexed with one ribonucleic acid. In some embodiments, the Cas protein is encoded by a modified nucleic acid, as described herein (e.g.. a synthetic, modified mRNA).

[0241] In some embodiments, gRNAs are short synthetic RNAs composed of a scaffold sequence for Cas binding and a user-designed spacer or com piemen tary portion designated crRNA. ThecRNA is composed of a crRNA targeting sequence (herein after also called a gRNA targeting sequence; usually about 20 nucleotides in length) that defines the genomic target to be modified and a region of crRNA repeat (e.g. GUUUUAGAGCUA; SEQ ID NO: 19). One can change the genomic target of the Cas protein by simply changing the complementary portion sequence (e.g. gRNA targeting sequence) present in the gRNA. In some embodiments the scaffold sequence for Cas binding is made up of a tracrRNA sequence (e.g.UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUG CUUU; SEQ ID NO: 20) that hybridizes to the crRNA through its anti-repeat sequence. The complex between crRNA:tracrRNA recruits the Cas nuclease (e.g. Cas9) and cleaves upstream of a protospacer-adjacent motif (PAM). In order for the Cas protein to function, there must be a PAM immediately downstream of the target sequence in the genomic DNA. Recognition of the PAM by the Cas protein is thought to destabilize the adjacent genomic sequence, allowing interrogation of the sequence by the gRNA and resulting in gRNA-DNA pairing when a matching sequence is present. The specific sequence of PAM varies depending on the species of the Cas gene. For example, the most commonly used Cas9 nuclease, derived from S. pyogenes, recognizes a PAM sequence of NGG. Other Cas9 variants and other nucleases with alternative PAMs have also been characterized and successfully used for genome editing. Thus, the CRISPR / Cas system can be used to create targeted DSBs at specified genomic loci that are complementary to the gRNA designed for the target loci. The crRNA and tracrRNA can be linked together with a loop sequence (e.g. a tetraloop; GAAA, SEQ ID NO: 21) for generation of a gRNA that is a chimeric single guide RNA (sgRNA; Hsu et al. 2013). sgRNA can be generated for DNA-based expression or by chemical synthesis.

[0242] In some embodiments, the complementary portion sequences (e.g. gRNA targeting sequence) of the gRNA will vary depending on the target site of interest. In some embodiments, the gRNAs comprise complementary portions specific to a sequence of a gene set forth in Table lb. In some embodiments, the genomic locus targeted by the gRNAs is located within 4000 bp, within 3500 bp. within 3000 bp, within 2500 bp, within 2000 bp. within 1500 bp, within 1000 bp, or within 500 bp of any of the loci as described.

[0243] The methods disclosed herein contemplate the use of any ribonucleic acid that is capable of directing a Cas protein to and hybridizing to a target motif of a target polynucleotide sequence. In some embodiments, at least one of the ribonucleic acids comprises tracrRNA. In some embodiments, at least one of the ribonucleic acids comprises CRISPR RNA (crRNA). In some embodiments, a single ribonucleic acid comprises a guide RNA that directs the Cas protein to and hybridizes to a target motif of the target polynucleotide sequence in a cell. In some embodiments, at least one of the ribonucleic acids comprises a guide RNA that directs the Cas protein to and hybridizes to a target motif of the target polynucleotide sequence in a cell. In some embodiments, both of the one to two ribonucleic acids comprise a guide RNA that directs the Cas protein to and hybridizes to a target motif of the targetpolynucleotide sequence in a cell. The ribonucleic acids provided herein can be selected to hybridize to a variety of different target motifs, depending on the particular CRISPR / Cas system employed, and the sequence of the target polynucleotide, as will be appreciated by those skilled in the art. The one to two ribonucleic acids can also be selected to minimize hybridization with nucleic acid sequences other than the target polynucleotide sequence. In some embodiments, the one to two ribonucleic acids hybridize to a target motif that contains at least tw o mismatches when compared w ith all other genomic nucleotide sequences in the cell. In some embodiments, the one to two ribonucleic acids hybridize to a target motif that contains at least one mismatch when compared with all other genomic nucleotide sequences in the cell. In some embodiments, the one to two ribonucleic acids are designed to hybridize to a target motif immediately adjacent to a deoxyribonucleic acid motif recognized by the Cas protein. In some embodiments, each of the one to two ribonucleic acids are designed to hybridize to target motifs immediately adjacent to deoxyribonucleic acid motifs recognized by the Cas protein which flank a mutant allele located between the target motifs. In some embodiments, each of the one to two ribonucleic acids comprises guide RNAs that directs the Cas protein to and hybridizes to a target motif of the target polynucleotide sequence in a cell.

[0244] In some embodiments, one or two ribonucleic acids (e.g., guide RNAs) are complementary to and / or hybridize to sequences on the same strand of a target polynucleotide sequence. In some embodiments, one or two ribonucleic acids (e.g., guide RNAs) are complementary to and / or hybridize to sequences on the opposite strands of a target polynucleotide sequence. In some embodiments, the one or two ribonucleic acids (e.g., guide RNAs) are not complementary to and / or do not hybridize to sequences on the opposite strands of a target polynucleotide sequence. In some embodiments, the one or two ribonucleic acids (e.g., guide RNAs) are complementary to and / or hybridize to overlapping target motifs of a target polynucleotide sequence. In some embodiments, the one or two ribonucleic acids (e.g., guide RNAs) are complementary to and / or hybridize to offset target motifs of a target polynucleotide sequence.

[0245] In some embodiments, nucleic acids encoding Cas protein and nucleic acids encoding the at least one to two ribonucleic acids are introduced into a cell via viral transduction (e.g., lentiviral transduction). In some embodiments, the Cas protein is complexed w ith 1-2 ribonucleic acids. In some embodiments, the Cas protein is complexed with two ribonucleic acids. In some embodiments, the Cas protein is complexed w itli one ribonucleic acid. In some embodiments, the Cas protein is encoded by a modified nucleic acid, as described herein (e.g., a synthetic, modified mRNA).

[0246] Exemplary gRNA targeting sequences useful for CRISPR / Cas-based targeting of genes described herein are provided in Table lb. The sequences can be found in W02016183041 filed May 9, 2016, the disclosure including the Tables, Appendices, and Sequence Listing is incorporated herein by reference in its entirety.Table lb. Exemplary gRNA targeting sequences useful for targeting genes

[0247] In some embodiments, it is within the level of a skilled artisan to identify new loci and / or gRNA targeting sequences for use in methods of genetic disruption to reduce or eliminate expression of a gene as described. For example, for CRISPR / Cas systems, when an existing gRNA targeting sequence for a particular locus (e.g., within a target gene, e.g. set forth in Table lb) is known, an "inch worming" approach can be used to identify additional loci for targeted insertion of transgenes by scanning the flanking regions on either side of the locus for PAM sequences, which usually occurs about every 100 base pairs (bp) across the genome. The PAM sequence will depend on the particular Cas nuclease used because different nucleases usually have different corresponding PAM sequences. The flanking regions on either side of the locus can be between about 500 to 4000 bp long, for example, about 500 bp, about 1000 bp. about 1500 bp, about 2000 bp, about 2500 bp. about 3000 bp, about 3500 bp, or about 4000 bp long. When a PAM sequence is identified within the search range, a new guide can be designed according to the sequence of that locus for use in genetic disruption methods. Although the CRISPR / Cas system is described as illustrative, any gene-editing approaches as described can be used in this method of identifying new loci, including those using ZFNs, TALENS, meganucleases and transposases.

[0248] Additional exemplary Cas9 guide RNA sequences useful for CRISPR / Cas-based targeting of genes described herein are provided in Table 2.Tabic 2. Additional exemplary Cas9 guide RNA sequences useful for targeting genes

[0249] In some embodiments, the cells described herein are made using Transcription Activator-Like Effector Nucleases (TALEN) methodologies. By a "TALE-nuclease" (TALEN) is intended a fusion protein consisting of a nucleic acid-binding domain typically derived from a Transcription Activator Like Effector (TALE) and one nuclease catalytic domain to cleave a nucleic acid target sequence. The catalytic domain is preferably a nuclease domain and more preferably a domain having endonuclease activity, like for instance I-TevI, ColE7, NucA and Fok-I. In a particular embodiment, the TALE domain can be fused to a mcganuclcasc like for instance I-CrcI and I-Onul or functional variant thereof. In a more preferred embodiment, said nuclease is a monomeric TALE -Nuclease. A monomeric TALE-Nuclease is a TALE-Nuclease that does not require dimerization for specific recognition and cleavage, such as the fusions of engineered TAL repeats with the catalytic domain of I-TevI described in WO2012138927. Transcription Activator like Effector (TALE) are proteins from the bacterial species Xanthomonas comprise a plurality of repeated sequences, each repeat comprising di-residues in position 12 and 13 (RVD) that are specific to each nucleotide base of the nucleic acid targeted sequence. Binding domains with similar modular base -per-base nucleic acid binding properties (MBBBD) can also be derived from new modular proteins recently discovered by the applicant in a different bacterial species. The new modular proteins have the advantage of displaying more sequence variability than TAL repeats. Preferably, RVDs associated with recognition of the different nucleotides are HD for recognizing C, NG for recognizing T. NI for recognizing A, NN for recognizing G or A, NS for recognizing A, C. G or T, HG for recognizing T. IG for recognizing T, NK for recognizing G, HA for recognizing C, ND for recognizing C, HI for recognizing C, HN for recognizing G, NA for recognizing G, SN for recognizing G or A and YG for recognizing T. TL for recognizing A, VT for recognizing A or G and SW for recognizing A. In another embodiment, critical amino acids 12 and 13 can be mutated towards other amino acid residues in order to modulate their specificity' towards nucleotides A. T, C and G and in particular to enhance this specificity. TALEN kits are sold commercially.

[0250] In some embodiments, the cells are manipulated using zinc finger nuclease (ZFN). A "zinc finger binding protein" is a protein or polypeptide that binds DNA, RNA and / or protein, preferably in a sequence -specific manner, as a result of stabilization of protein structure through coordination of a zinc ion. The term zinc finger binding protein is often abbreviated as zinc finger protein or ZFP. The individual DNA binding domains arc typically referred to as "fingers." A ZFP has least one finger, ty pically two fingers, three fingers, or six fingers. Each finger binds from two to four base pairs of DNA, typically three or four base pairs of DNA. A ZFP binds to a nucleic acid sequence called a target site ortarget segment. Each finger typically comprises an approximately 30 amino acid, zinc-chelating, DNA-binding subdomain. Studies have demonstrated that a single zinc finger of this class consists of an alpha helix containing the two invariant histidine residues coordinated with zinc along with the two cysteine residues of a single beta turn (see, e.g., Berg & Shi, Science 271:1081-1085 (1996)).

[0251] In some embodiments, the cells described herein are made using a homing endonuclease. Such homing endonucleases are well-known to the art (Stoddard 2005). Homing endonucleases recognize a DNA target sequence and generate a single- or double-strand break. Homing endonucleases are highly specific, recognizing DNA target sites ranging from 12 to 45 base pairs (bp) in length, usually ranging from 14 to 40 bp in length. The homing endonuclease may for example correspond to a LAGLID ADG endonuclease, to an HNH endonuclease, or to a GIY-YIG endonuclease. In some embodiments, the homing endonuclease can be an I-Crel variant.

[0252] In some embodiments, the cells described herein are made using a meganuclease.Meganucleases are by definition sequence-specific endonucleases recognizing large sequences (Chevalier, B. S. and B. L. Stoddard, Nucleic Acids Res., 2001, 29, 3757-3774). They can cleave unique sites in living cells, thereby enhancing gene targeting by 1000-fold or more in the vicinity of the cleavage site (Puchta et al., Nucleic Acids Res., 1993, 21, 5034-5040; Rouet et al., Mol. Cell. BioL, 1994, 14, 8096-8106; Choulika et al.. Mol. Cell. Biol., 1995, 15, 1968-1973; Puchta et al., Proc. Natl. Acad. Sci. USA, 1996, 93, 5055-5060; Sargent et al.. Mol. Cell. Biol.. 1997. 17, 267-77; Donoho et al., Mol. Cell. Biol, 1998, 18. 4070-4078; Elliott et al.. Mol. Cell. Biol.. 1998. 18, 93-101; Cohen-Tannoudji et al., Mol. Cell. Biol., 1998, 18, 1444-1448).

[0253] In some embodiments, the gene editing technology is associated with base editing. Base editors (Bes) are typically fusions of a Cas (“CRISPR-associated”) domain and a nucleobase modification domain (e.g., a natural or evolved deaminase, such as a cytidine deaminase that include APOBEC1 (“apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1”), CD A (“cytidine deaminase”), and AID (“activation-induced cytidine deaminase”)) domains. In some cases, base editors may also include proteins or domains that alter cellular DNA repair processes to increase the efficiency and / or stability of die resulting single-nucleotide change.

[0254] In some aspects, currently available base editors include cytidine base editors (e.g., BE4) that convert target C*G to T«A and adenine base editors (e.g., ABE7.10) that convert target A«T to G*C. In some aspects, Cas9-targeted deamination was first demonstrated in connection with a Base Editor (BE) system designed to induce base changes without introducing double-strand DNA breaks. Further Rat deaminase APOBEC1 (rAPOBECl) fused to deactivated Cas9 (dCas9) was used to successfully convert cytidines to thymidines upstream of the PAM of the sgRNA. In some aspects, this first BE system was optimized by changing the dCas9 to a “nickase” Cas9 D10A, which nicks the strand opposite the deaminated cytidine. Without being bound by theory, this is expected to initiate long-patch baseexcision repair (BER), where the deaminated strand is preferentially used to template the repair to produce a U:A base pair, which is then converted to T:A during DNA replication.

[0255] In some embodiments, the base editor is a nucleobase editor containing a first DNA binding protein domain that is catalytically inactive, a domain having base editing activity , and a second DNA binding protein domain having nickase activity', where the DNA binding protein domains are expressed on a single fusion protein or are expressed separately (e.g., on separate expression vectors). In some embodiments, the base editor is a fusion protein comprising a domain having base editing activity (e.g., cytidine deaminase or adenosine deaminase), and two nucleic acid programmable DNA binding protein domains (napDNAbp), a first comprising nickase activity and a second napDNAbp that is catalytically inactive, wherein at least the two napDNAbp are joined by a linker. In some embodiments, the base editor is a fusion protein that comprises a DNA domain of a CRISPR-Cas (e.g., Cas9) having nickase activity (nCas; nCas9). a catalytically inactive domain of a CRISPR-Cas protein (e.g., Cas9) having nucleic acid programmable DNA binding activity' (dCas; e.g.. dCas9), and a deaminase domain, wherein the dCas is joined to the nCas by a linker, and the dCas is immediately adjacent to the deaminase domain. In some embodiments, the base editor is a adenine-to-thymine or “ATBE” (or thymine-to-adenine or “TABE”) transversion base editors. Exemplary base editor and base editor systems include any as described in patent publication Nos. US20220127622, US20210079366, US20200248169, US20210093667, US20210071163, W02020181202, WO2021158921, WO2019126709, W02020181178. W02020181195, WO2020214842. W02020181193, which are hereby incorporated in their entirety.

[0256] In some embodiments, the gene editing technology is target-primed reverse transcription (TPRT) or “prime editing”. In some embodiments, prime editing mediates targeted insertions, deletions, all 12 possible base-to-base conversions, and combinations thereof in human cells yvithout requiring DSBs or donor DNA templates.

[0257] Prime editing is a genome editing method that directly writes new genetic information into a specified DNA site using a nucleic acid programmable DNA binding protein (“napDNAbp”) working in association with a polymerase (i.e., in the form of a fusion protein or otherwise provided in trans with the napDNAbp). wherein the prime editing system is programmed with a prime editing (PE) guide RNA (“PEgRNA”) that both specifies the target site and templates the synthesis of the desired edit in the form of a replacement DNA strand by way of an extension (either DNA or RNA) engineered onto a guide RNA (e.g., at the 5' or 3' end, or at an internal portion of a guide RNA). The replacement strand containing the desired edit (e.g., a single nucleobase substitution) shares the same sequence as the endogenous strand of the target site to be edited (with the exception that it includes the desired edit). Through DNA repair and / or replication machinery, the endogenous strand of the target site is replaced by the newly synthesized replacement strand containing the desired edit. In some cases, prime editing may¬ be thought of as a "search-and- replace” genome editing technology since the prime editors search andlocate the desired target site to be edited, and encode a replacement strand containing a desired edit which is installed in place of the corresponding target site endogenous DNA strand at the same time. For example, prime editing can be adapted for conducting precision CRISPR / Cas-based genome editing in order to bypass double stranded breaks. In some embodiments, the homologous protein is or encodes for a Cas protein-reverse transcriptase fusions or related systems to target a specific DNA sequence with a guide RNA, generate a single strand nick at the target site, and use the nicked DNA as a primer for reverse transcription of an engineered reverse transcriptase template that is integrated with the guide RNA. In some embodiments, the prime editor protein is paired with two prime editing guide RNAs (pegRNAs) that template the synthesis of complementary DNA flaps on opposing strands of genomic DNA, resulting in the replacement of endogenous DNA sequence between the PE-induced nick sites with pegRNA-encoded sequences.

[0258] In some embodiments, the gene editing technology is associated with a prime editor that is a reverse transcriptase, or any DNA polymerase known in the art. Thus, in one aspect, the prime editor may comprise Cas9 (or an equivalent napDNAbp) which is programmed to target a DNA sequence by associating it with a specialized guide RNA (i.e ., PEgRNA) containing a spacer sequence that anneals to a complementary protospacer in the target DNA. Such methods include any disclosed in Anzalone et al., (doi.org / 10.1038 / s41586-019-1711-4), or in PCT publication Nos. WO2020191248, WO2021226558, or W02022067130, which are hereby incorporated in their entirety.

[0259] In some embodiments, the gene editing technology is Programmable Addition via Sitespecific Targeting Elements (PASTE). In some aspects, PASTE is platform in which genomic insertion is directed via a CRISPR-Cas9 nickase fused to both a reverse transcriptase and serine integrase. As described in loannidi et al. (doi.org / 10.1101 / 2021.11.01.466786). PASTE does not generate double stranded breaks, but allows for integration of sequences as large as ~36 kb. In some embodiments, the serine integrase can be any known in the art. In some embodiments, the serine integrase has sufficient orthogonality such that PASTE can be used for multiplexed gene integration, simultaneously integrating at least two different genes at least two genomic loci. In some embodiments, PASTE has editing efficiencies comparable to or better than those of homology directed repair or non-homologous end joining based integration, with activity in nondividing cells and fewer detectable off-target events.

[0260] In some embodiments, the cells provided herein are made using RNA silencing or RNA interference (RNAi) to knockdown (e.g., decrease, eliminate, or inhibit) the expression of a polypeptide. Useful RNAi methods include those that utilize synthetic RNAi molecules, short interfering RNAs (siRNAs). PlWI-interacting NRAs (piRNAs), short hairpin RNAs (shRNAs), microRNAs (miRNAs), and other transient knockdown methods recognized by those skilled in the art. Reagents for RNAi including sequence specific shRNAs. siRNA, miRNAs and the like are commercially available. For instance, a target polynucleotide, such as any described above, e.g. CIITA, B2M, or NLRC5, can be knocked down in a cell by RNA interference by introducing an inhibitory nucleic acid complementary toa target motif of the target polynucleotide, such as an siRNA, into the cells. In some embodiments, a target polynucleotide, such as any described above, e.g. CIITA. B2M. or NLRC5, can be knocked down in a cell by transducing a shRNA-expressing virus into the cell. In some embodiments, RNA interference is employed to reduce or inhibit the expression of at least one selected from the group consisting of CIITA, B2M, and NLRC5.

[0261] In some embodiments, the modification, such as the genetic modification, reduces or eliminates, such as knocks out, the expression of one or more MHC class I molecules genes and / or one or more MHC class II molecule genes by targeting the accessory chain B2M. B2M, TAP I, NLRC5, CIITA, HLA-A, HLA-B, HLA-C, HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, HLA-DR, RFX5, RFXANK, RFXAP, NFY-A, NFY-B and / or NFY-C and any combination thereof. In some embodiments, decreased or eliminated expression of one or more MHC class I molecules and / or one or more MHC class II molecules is a modification that reduces expression of, e.g., knocks out, one or more of the following B2M. B2M. TAP I, NLRC5, CIITA, HLA-A, HLA-B. HLA-C. HLA-DP. HLA-DM, HLA-DOA. HLA-DOB, HLA-DQ. HLA-DR. RFX5, RFXANK. RFXAP, NFY-A, NFY-B and / or NFY-C.2. Exemplary Target Polynucleotides and Methods for Reducing Expression a. MHC Class I molecules

[0262] In certain embodiments, the modification, such as the genetic modification, reduces or eliminates, such as knocks out, the expression of one or more MHC class I molecules genes by targeting the accessory chain B2M. In some embodiments, the genetic modification occurs using a CRISPR / Cas system. By reducing or eliminating, such as knocking out, expression of B2M. surface trafficking of one or more MHC class I molecules is blocked and such cells exhibit immune tolerance when engrafted into a recipient subject. In some embodiments, the cell is considered hypoimmunogenic, e.g., in a recipient subject or patient upon administration.

[0263] In sonic embodiments, the target polynucleotide sequence provided herein is a variant of B2M. In some embodiments, the target polynucleotide sequence is a homolog of B2M. In some embodiments, the target polynucleotide sequence is an ortholog of B2M.

[0264] In some embodiments, decreased or eliminated expression of one or more MHC class I molecules is a modification that reduces expression of one or more of the following MHC class I molecules - HLA-A. HLA-B, and HLA-C. In some embodiments, decreased or eliminated expression of B2M reduces or eliminates expression of one or more of the following MHC class I molecules - HLA-A. HLA-B. and HLA-C. In some embodiments, decreased or eliminated expression of B2M reduces or eliminates expression of an HLA-A protein. In some embodiments, decreased or eliminated expression of B2M reduces or eliminates expression of an HLA-B protein. In some embodiments, decreased or eliminated expression of B2M reduces or eliminates expression of an HLA-C protein. In someembodiments, decreased or eliminated expression of B2M reduces or eliminates expression of one or more of the following MHC class I molecules - HLA-A, HLA-B. and HLA-C, by knocking out a gene encoding said molecule. In some embodiments, the gene encoding an HLA-A protein is knocked out to reduce or eliminate expression of said HLA-A protein. In some embodiments, the gene encoding an HLA-B protein is knocked out to reduce or eliminate expression of said HLA-B protein. In some embodiments, the gene encoding an HLA-C protein is knocked out to reduce or eliminate expression of said HLA-C protein.

[0265] In some embodiments, the engineered islets comprise a modification (e.g.. genetic modification) targeting the B2M gene. In some embodiments, the modification (e.g., genetic modification) targeting the B2M gene is by using a targeted nuclease system that comprises a Cas protein or a polynucleotide encoding a Cas protein, and at least one guide ribonucleic acid sequence for specifically targeting the B2M gene. In some embodiments, the at least one guide ribonucleic acid sequence (e.g. gRNA targeting sequence) for specifically targeting the B2M gene is selected from the group consisting of SEQ ID NOS: 81240-85644 of Appendix 2 or Table 15 of W02016 / 18304L the disclosure is incorporated by reference in its entirety. In some embodiments, the gRNA targeting sequence for specifically targeting the B2M gene is CGUGAGUAAACCUGAAUCUU (SEQ ID NO: 29).

[0266] In some embodiments, an exogenous nucleic acid or transgene encoding a polypeptide as disclosed herein (e.g., a chimeric antigen receptor, CD47, or another tolerogenic factor disclosed herein) is inserted at the B2M gene. Exemplar}’ transgenes for targeted insertion at the B2M locus include any as described herein.

[0267] Assays to test whether the B2M gene has been inactivated are known and described herein. In one embodiment, the resulting genetic modification of the B2M gene is assessed by PCR. In some embodiments, the reduction of one or more MHC class I, such as HLA-I, expression can be assay s by flow cytometry, such as by FACS analysis. In another embodiment, B2M protein expression is detected using a Western blot of cells ly sates probed with antibodies to the B2M protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the inactivating modification, such as genetic modification. In some embodiments, the reduction in one or more MHC class I molecules expression is assessed using an immunoaffinity technique, such as immunohistochemistry or immunocytochemistry.

[0268] In some embodiments, the reduction of one or more MHC class I molecules expression or function (HLA I when the cells are derived from human cells) in the engineered islets can be measured using techniques known in the art; for example, FACS techniques using labeled antibodies that bind the HLA complex; for example, using commercially available HLA-A. B, C antibodies that bind to the alpha chain of the human major histocompatibility HLA Class I antigens. In addition, the cells can be tested to confirm that the HLA I complex is not expressed on the cell surface. This may be assayed by FACSanalysis using antibodies to one or more HLA cell surface components as discussed above. In addition to the reduction of HLA I (or MHC class I), the engineered islets provided herein have a reduced susceptibility to macrophage phagocytosis and NK cell killing. Methods to assay for hypoimmunogenic phenotypes of the engineered islets are described further below.

[0269] In some embodiments, the modification (e.g., genetic modification) that reduces B2M expression reduces B2M mRNA expression. In some embodiments, the reduced mRNA expression of B2M is relative to an unmodified or wild-type cell of tire same cell type that does not comprise the modification. In some embodiments, the mRNA expression of B2M is reduced by more than about 5%, such as reduced by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the mRNA expression of B2M is reduced by up to about 100%, such as reduced by up to about any of 90%. 80%, 70%, 60%, 50%. 40%, 30%, 20%, 10%. 5%, or less. In some embodiments, the mRNA expression of B2M is reduced by any of about 5%, 10%, 20%, 30%. 40%, 50%, 60%, 70%, 80%. 90%, or 100%. In some embodiments, the mRNA expression of B2M is eliminated (e.g.. 0% expression of B2M mRNA). In some embodiments, the modification that reduces B2M mRNA expression eliminates B2M gene activity.

[0270] In some embodiments, the modification (e.g.. genetic modification) that reduces B2M expression reduces B2M protein expression. In some embodiments, the reduced protein expression of B2M is relative to an unmodified or wild-type cell of the same cell type that does not comprise the modification. In some embodiments, the protein expression of B2M is reduced by more than about 5%, such as reduced by more than about any of 10%. 20%, 30%, 40%, 50%. 60%, 70%, 80%, 90%. or more. In some embodiments, the protein expression of B2M is reduced by up to about 100%. such as reduced by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%. or less. In some embodiments, the protein expression of B2M is reduced by any of about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%. 80%, 90%, or 100%. In some embodiments, the protein expression of B2M is eliminated (e.g., 0% expression of B2M protein). In some embodiments, the modification that reduces B2M protein expression eliminates B2M gene activity .

[0271] In some embodiments, the modification (e.g., genetic modification) that reduces B2M expression comprises inactivation or disruption of the B2M gene. In some embodiments, the modification that reduces B2M expression comprises inactivation or disruption of one allele of the B2M gene. In some embodiments, the modification that reduces B2M expression comprises inactivation or disruption comprises inactivation or disruption of both alleles of the B2M gene.

[0272] In some embodiments, the modification (e.g., genetic modification) comprises inactivation or disruption of one or more B2M coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption of all B2M coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption comprises an indel in the B2M gene. In some embodiments, the modification is a frameshift mutation of genomic DNA of the B2M gene. Insome embodiments, the modification is a deletion of genomic DNA of the B2M gene. In some embodiments, the modification is a deletion of a contiguous stretch of genomic DNA of the B2M gene. In some embodiments, the B2M gene is knocked out.a. MHC Class II molecules

[0273] In certain aspects, the modification, such as genetic modification, reduces or eliminates, such as knocks out, the expression of one or more MHC class II molecules genes by targeting Class II molecules transactivator (CUT A) expression. In some embodiments, the genetic modification occurs using a CRISPR / Cas system. CIITA is a member of the LR or nucleotide binding domain (NBD) leucine-rich repeat (LRR) family of proteins and regulates the transcription of one or more MHC class II molecules by associating with the MHC enhanceosome. By reducing or eliminating, such as knocking out, expression of CIITA. expression of one or more MHC class II molecules is reduced thereby also reducing surface expression. In some cases, such cells exhibit immune tolerance when engrafted into a recipient subject. In some embodiments, the cell is considered hypoimmunogenic, e g., in a recipient subject or patient upon administration.

[0274] In some embodiments, the target polynucleotide sequence is a variant of CIITA. In some embodiments, the target polynucleotide sequence is a homolog of CIITA. In some embodiments, the target polynucleotide sequence is an ortholog of CIITA.

[0275] In some embodiments, decreased or eliminated expression of one or more MHC class II molecules is a modification that reduces expression of one or more of the following MHC class II molecules - HLA-DP, HLA-DM. HLA-DOA. HLA-DOB, HLA-DQ. and HLA-DR. In some embodiments, reduced or eliminated expression of CIITA reduces or eliminates expression of one or more of the following MHC class II molecules - HLA-DP. HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, and HLA-DR. In some embodiments, decreased or eliminated expression of CIITA reduces or eliminates expression of an HLA-DP protein. In some embodiments, decreased or eliminated expression of CIITA reduces or eliminates expression of an HLA-DM protein. In some embodiments, decreased or eliminated expression of CIITA reduces or eliminates expression of an HLA-DOA protein. In some embodiments, decreased or eliminated expression of CIITA reduces or eliminates expression of an HLA-DOB protein. In some embodiments, decreased or eliminated expression of CIITA reduces or eliminates expression of an HLA-DQ protein. In some embodiments, decreased or eliminated expression of CIITA reduces or eliminates expression of an HLA-DR protein. In some embodiments, decreased or eliminated expression of CIITA reduces or eliminates expression of one or more of the following MHC class II molecules - HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, and HLA-DR. by knocking out a gene encoding said molecule. In some embodiments, the gene encoding an HLA-DP protein is knocked out to reduce or eliminate expression of said HLA-DP protein. In some embodiments, the gene encoding an HLA-DM protein is knocked out to reduce or eliminate expression of said HLA-DM protein. In someembodiments, the gene encoding an HLA-DOA protein is knocked out to reduce or eliminate expression of said HLA-DOA protein. In some embodiments, the gene encoding an HLA-DOB protein is knocked out to reduce or eliminate expression of said HLA-DOB protein. In some embodiments, the gene encoding an HLA-DQ protein is knocked out to reduce or eliminate expression of said HLA-DQ protein. In some embodiments, the gene encoding an HLA-DR protein is knocked out to reduce or eliminate expression of said HLA-DR protein.

[0276] In some embodiments, the engineered islets comprise a modification (e.g.. genetic modification) targeting the CIITA gene. In some embodiments, the modification targeting the CIITA gene is by a targeted nuclease system that comprises a Cas protein or a polynucleotide encoding a Cas protein, and at least one guide ribonucleic acid sequence for specifically targeting the CIITA gene. In some embodiments, the at least one guide ribonucleic acid sequence (e.g. gRNA targeting sequence) for specifically targeting the CIITA gene is selected from the group consisting of SEQ ID NOS: 5184-36352 of Appendix 1 or Table 12 of WO2016183041, the disclosure is incorporated by reference in its entirety. In some embodiments, the gRNA targeting sequence for specifically targeting the CIITA gene is GAUAUUGGCAUAAGCCUCCC (SEQ ID NO: 30).

[0277] In some embodiments, an exogenous nucleic acid or transgene encoding a polypeptide as disclosed herein (e.g., a chimeric antigen receptor, CD47. or another tolerogenic factor disclosed herein) is inserted at the CIITA gene. Exemplary transgenes for targeted insertion at the B2M locus include any as described in herein.

[0278] Assays to test whether the CIITA gene has been inactivated are known and described herein. In one embodiment, the resulting genetic modification of the CIITA gene is assessed by PCR. In some embodiments, the reduction of one or more MHC class II molecules, such as HLA-II, expression can be assays by flow cytometry, such as by FACS analysis. In another embodiment, CIITA protein expression is detected using a Western blot of cells lysates probed with antibodies to the CIITA protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the inactivating modification, such as genetic modification. In some embodiments, the reduction in one or more MHC class II molecules expression is assessed using an immunoalTinity technique, such as immunohistochemistry or immunocytochemistry.

[0279] In some embodiments, the reduction of the one or more MHC class II molecules expression or function (HLA II when the cells are derived from human cells) in the engineered islets can be measured using techniques known in the art, such as Western blotting using antibodies to the protein, FACS techniques. RT-PCR techniques, etc. In some embodiments, the engineered islets can be tested to confirm that the HLA II complex is not expressed on the cell surface. Methods to assess surface expression include methods known in the art (See Figure 21 of WO2018132783, for example) and generally is done using either Western Blots or FACS analysis based on commercial antibodies that bind to human HLA Class II HLA-DR. DP and most DQ antigens. In addition to the reduction of one ormore HLA class II molecules (or one or more MHC class II molecules), the engineered islets provided herein have a reduced susceptibility to macrophage phagocytosis and NK cell killing. Methods to assay for hypoimmunogenic phenoty pes of the engineered islets are described further below.

[0280] In some embodiments, the modification (e.g., genetic modification) that reduces CIITA expression reduces CIITA mRNA expression. In some embodiments, the reduced mRNA expression of CIITA is relative to an unmodified or wild-type cell of the same cell type drat does not comprise the modification. In some embodiments, the mRNA expression of CIITA is reduced by more than about 5%, such as reduced by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the mRNA expression of CIITA is reduced by up to about 100%. such as reduced by up to about any of 90%. 80%, 70%, 60%, 50%. 40%, 30%, 20%, 10%. 5%, or less. In some embodiments, the mRNA expression of CIITA is reduced by any of about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%.90%, or 100%. In some embodiments, the mRNA expression of CIITA is eliminated (e.g.. 0% expression of CIITA mRNA). In some embodiments, the modification that reduces CIITA mRNA expression eliminates CIITA gene activity.

[0281] In some embodiments, the modification (e.g., genetic modification) that reduces CIITA expression reduces CIITA protein expression. In some embodiments, the reduced protein expression of CIITA is relative to an unmodified or wild-type cell of the same cell type that does not comprise the modification. In some embodiments, the protein expression of CIITA is reduced by more than about 5%, such as reduced by more than about any of 10%. 20%, 30%, 40%, 50%. 60%, 70%, 80%, 90%. or more. In some embodiments, the protein expression of CIITA is reduced brup to about 100%, such as reduced by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%. or less. In some embodiments, the protein expression of CIITA is reduced by any of about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%. 80%, 90%, or 100%. In some embodiments, the protein expression of CIITA is eliminated (e.g., 0% expression of CIITA protein). In some embodiments, the modification that reduces CIITA protein expression eliminates CIITA gene activity’.

[0282] In some embodiments, the modification (e.g., genetic modification) that reduces CIITA expression comprises inactivation or disruption of the CIITA gene. In some embodiments, the modification that reduces CIITA expression comprises inactivation or disruption of one allele of the CIITA gene. In some embodiments, the modification that reduces CIITA expression comprises inactivation or disruption comprises inactivation or disruption of both alleles of the CIITA gene.

[0283] In some embodiments, the modificationU(e.g.. genetic modification) comprises inactivation or disruption of one or more CIITA coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption of all CIITA coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption comprises an indel in the CIITA gene. In some embodiments, the modification is a frameshift mutation of genomic DNA of the CIITA gene. In some embodiments, the modification is a deletion of genomic DNA of the CIITA gene. In someembodiments, the modification is a deletion of a contiguous stretch of genomic DNA of the CIITA gene. In some embodiments, the CIITA gene is knocked out.B. Overexpression of Polynucleotides

[0284] In some embodiments, the engineered islets is genetically modified or engineered, such as by introduction of one or more modifications into a beta cell to overexpress a desired polynucleotide in the cell. In some embodiments, the islet cells to be modified or engineered is an unmodified cell or non-engineered cell (e.g. unengineered islets or non-engineered islet cells, e.g., control or wild-type cell) that has not previously been introduced with the one or more modifications. In some embodiments, the engineered islet cells are genetically modified to include one or more exogenous polynucleotides encoding an exogenous protein (also interchangeably used with the term “transgene”). As described, in some embodiments, the engineered islet cells are modified to increase expression of certain genes that are tolerogenic (e.g.. immune) factors that affect immune recognition and tolerance in a recipient. The one or more polynucleotides, e.g. exogenous polynucleotides, may be expressed (e.g. overexpressed) in the engineered islets together with one or more genetic modifications to reduce expression of a target polynucleotide described herein, such as an one or more MHC class I molecules and / or one or more MHC class II molecules. In some embodiments, the provided engineered islets do not trigger or activate an immune response upon administration to a recipient subject.

[0285] In some embodiments, the engineered islets includes 1, 2, 3, 4, 5, 6, 7. 8, 9, 10 or more different ovcrcxprcsscd polynucleotides. In some embodiments, the engineered islets includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different overexpressed polynucleotides. In some embodiments, the overexpressed polynucleotide is an exogenous polynucleotide. In some embodiments, the engineered islets includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different exogenous polynucleotides. In some embodiments, the engineered islets includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different exogenous polynucleotides. In some embodiments, the overexpressed polynucleotide is an exogenous polynucleotide that is expressed episomally in the beta cell. In some embodiments, the overexpressed polynucleotide is an exogenous polynucleotide that is inserted or integrated into one or more genomic loci of the engineered islets.

[0286] In some embodiments, expression of a polynucleotide is increased, i.e. the polynucleotide is overexpressed, using a fusion protein containing a DNA-targeting domain and a transcriptional activator. Targeted methods of increasing expression using transactivator domains are known to a skilled artisan.

[0287] In some embodiments, the modified beta contains one or more exogenous polynucleotides in which the one or more exogenous polynucleotides are inserted or integrated into a genomic locus of the cell by non-targeted insertion methods, such as by transduction with a lentiviral vector. In some embodiments, the lentiviral vector comprises a pigg Bac transposon. Duringtransposition, the piggyback transposon recognizes transposon-specific inverted terminal repeats (ITRs) in a lentiviral vector, to allow for the efficient movement and integration of the vector contents into TTAA chromosomal sites. In some embodiments, the one or more exogenous polynucleotides are inserted or integrated into the genome of the cell, such as beta cell, by targeted insertion methods, such as by using homolog}7directed repair (HDR). Any suitable method can be used to insert the exogenous polynucleotide into the genomic locus of the modified cell, such as beta cell, by HDR including the gene editing methods described herein (e.g., a CRISPR / Cas system). In some embodiments, the one or more exogenous polynucleotides are inserted into one or more genomic locus, such as any genomic locus described herein (e.g. Table 4). In some embodiments, the exogenous polynucleotides are inserted into the same genomic loci. In some embodiments, the exogenous polynucleotides are inserted into different genomic loci. In some embodiments, the tw o or more of the exogenous polynucleotides are inserted into the same genomic loci, such as any genomic locus described herein (e.g. Table 4). In some embodiments, two or more exogenous polynucleotides are inserted into a different genomic loci, such as two or more genomic loci as described herein (e.g., Table 4).

[0288] Exemplary polynucleotides or overexpression, and methods for overexpressing the same, are described in the following subsections.1. Tolerogenic Factor

[0289] In some embodiments, expression of a tolerogenic factor is overexpressed or increased in the cell, e.g. engineered islets. In some embodiments, the engineered islets includes increased expression, i.e. overexpression, of at least one tolerogenic factor. In some embodiments, the tolerogenic factor is any factor that promotes or contributes to promoting or inducing tolerance to the engineered islets by the immune system (e g. imiate or adaptive immune system).

[0290] In some embodiments, the one or more tolerogenic factors is selected from the group consisting of CD47, A20 / TNFAIP3, Cl -Inhibitor, CCL21. CCL22, CD16, CD16 Fc receptor, CD24. CD27, CD35, CD39, CD46, CD52, CD55, CD59, CD200, CR1, CTLA4-Ig, DUX4. FasL. H2-M3, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, PD-L1, IDO1, IL-10, IL15-RF. IL-35, MANF, Mfge8. PD-1. PD-L1, or Serpinb9. In some embodiments, the tolerogenic factor is DUX4, B2M-HLA-E, CD35, CD52, CD 16, CD52, CD47, CD46, CD55, CD59, CD27. CD200. HLA-C, HLA-E, HLA-E heavy chain, HLA-G, PD-L1, IDO1, CTLA4-Ig. Cl-Inhibitor, IL-10, IL-35, FASL, CCL21, MFGE8, SERPINB9, CD35, IL-39, CD16 Fc Receptor, IL15-RF, and H2-M3. In some embodiments, the tolerogenic factor is CD47, PD-L1, HLA-E or HLA-G, CCL21. FasL, Serpinb9, CD200 or Mfge8, or any combination thereof. In some embodiments, the cell, such as a beta cell, includes at least one exogenous polynucleotide that includes a polynucleotide that encodes for a tolerogenic factor. For instance, in some embodiments, at least one of the exogenous polynucleotides is a polynucleotide that encodes CD47. Provided herein are cells that do not trigger or activate an immune response upon administration to a recipient subject. Asdescribed above, in some embodiments, the cells, such as beta cells, are modified to increase expression of genes and tolerogenic (e.g., immune) factors that affect immune recognition and tolerance in a recipient.

[0291] In sonic embodiments, the expression (e.g., surface expression) of a tolerogenic factor is increased by about 10% or higher compared to a cell of the same cell type that does not comprise the modification, such as increased by any of about 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or higher, compared to a cell of the same cell type that does not comprise the modification. In some embodiments, the expression of a tolerogenic factor is increased by about 99% or lower compared to a cell of the same cell type that does not comprise the modification, such as increased by any of about 95%, 90%, 85%. 80%, 75%, 70%, 65%. 60%, 55%, 50%, 45%, 40%, 35%. 30%, 25%, 20%, 15%. 10%, or lower, compared to a cell of the same cell type that does not comprise the modification. In some embodiments, the expression of a tolerogenic factor is increased by between about 10% and about 100% compared to a cell of the same cell type that does not comprise the modification, such as between any of about 10% and about 40%, about 20% and about 60%, about 50% and about 80%, and about 70% and about 100%, compared to a cell of the same cell type that does not comprise the modification.

[0292] In some embodiments, the expression (e.g.. surface expression) of a tolerogenic factor is increased by about 2-fold or higher compared to a cell of the same cell type that does not comprise the modification, such as any of about 4-fold or higher, 6-fold or higher, 8-fold or higher, 10-fold or higher.15-fold or higher, 20-fold or higher. 30-fold or higher, 40-fold or higher, 50-fold or higher. 60-fold or higher, 70-fold or higher. 80-fold or higher, 90-fold or higher, 100-fold or higher, 150-fold or higher, and 200-fold or higher compared to a cell of tire same cell type that does not comprise the modification. In some embodiments, the expression of a tolerogenic factor is increased by about 200-fold or lower compared to a cell of the same cell ty pe that does not comprise the modification, such as any of about 150-fold or lower, 100-fold or lower, 90-fold or lower, 80-fold or lower, 70-fold or lower, 60-fold or lower, 50-fold or lower, 40-fold or lower, 30-fold or lower, 15 -fold or lower, 10-fold or lower, 8-fold or lower, 6-fold or lower, 4-fold or lower, and 2-fold or lower compared to a cell of the same cell type that does not comprise the modification. In some embodiments, the expression of a tolerogenic factor is increased by between about 2-fold and about 200-fold compared to a cell of the same cell type that does not comprise the modification, such as between any of about 2-fold and about 20-fold, about 10-fold and about 50-fold, about 30-fold and about 70-fold, about 50-fold and about 100-fold, about 80-fold and about 150-fold, and about 120-fold and about 200-fold, compared to a cell of the same cell type that does not comprise the modification.

[0293] In some embodiments, the present disclosure provides a cell, such as a beta cell, or population thereof that has been modified to express the tolerogenic factor (e.g.. immunomodulatory polypeptide), such as CD47. In some embodiments, the present disclosure provides a method for alteringa cell genome to express the tolerogenic factor (e.g. immunomodulatory polypeptide), such as CD47. In some embodiments, the engineered islets expresses an exogenous tolerogenic factor (e.g. immunomodulatory polypeptide), such as an exogenous CD47. In some instances, overexpression or increasing expression of the exogenous polynucleotide is achieved by introducing into the beta cell (e.g. transducing the cell) with an expression vector comprising a nucleotide sequence encoding a human CD47 polypeptide. In some embodiments, the expression vector may be a viral vector, such as a lentiviral vector) or may be a non-viral vector. In some embodiments, the cell, such as a beta cell, is modified to contain one or more exogenous polynucleotides in which at least one of the exogenous polynucleotides includes a polynucleotide that encodes for a tolerogenic factor. In some embodiments, the DUX4, B2M-HLA-E, CD35, CD52, CD16, CD52, CD47, CD46, CD55, CD59, CD27. CD200, HLA-C, HLA-E, HLA-E heavy' chain, HLA-G, PD-L1, IDO1, CTLA4-Ig, Cl-Inhibitor, IL-10. IL-35, FASL, CCL21, MFGE8, SERPINB9, CD35, IL-39, CD16 Fc Receptor, IL15-RF, and H2-M3 (including any combination thereof). In some embodiments, the tolerogenic factor is one or more of CD47. PD-L1, HLA-E or HLA-G, CCL21, FasL, Serpinb9, CD200, and Mfge8 (including any combination thereof). For instance, in some embodiments, at least one of the exogenous polynucleotides is a polynucleotide that encodes CD47.

[0294] In some embodiments, the tolerogenic factor is CD47. In some embodiments, the engineered islets contains an exogenous polynucleotide that encodes CD47, such as human CD47. In some embodiments, CD47 is overexpressed in the cell. In some embodiments, the expression of CD47 is overexpressed or increased in the engineered islets compared to a similar cell of the same cell type that has not been modified with the modification, such as a reference or unmodified cell, e.g. a beta cell not modified with an exogenous polynucleotide encoding CD47. CD47 is a leukocyte surface antigen and has a role in cell adhesion and modulation of integrins. It is normally expressed on the surface of a cell and signals to circulating macrophages not to eat the cell. Useful genomic, polynucleotide and polypeptide information about human CD47 are provided in, for example, the NP 001768.1,NP 942088.1, NM_001777.3 and NM_198793.2.

[0295] In some embodiments, the expression (e.g., surface expression) of CD47 is increased by about 10% or higher compared to a cell of the same cell type that does not comprise the modification, such as increased by any of about 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or higher, compared to a cell of the same cell type that does not comprise the modification. In some embodiments, the expression of CD47 is increased by about 99% or lower compared to a cell of the same cell type that does not comprise the modification, such as increased by any of about 95%, 90%. 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%.20%, 15%, 10%, or lower, compared to a cell of the same cell type that does not comprise the modification. In some embodiments, the expression of CD47 is increased by between about 10% and about 100% compared to a cell of the same cell type that does not comprise the modification, such asbetween any of about 10% and about 40%, about 20% and about 60%, about 50% and about 80%, and about 70% and about 100%, compared to a cell of the same cell type that does not comprise the modification.

[0296] In sonic embodiments, the expression (e.g., surface expression) of CD47 is increased in the engineered islets by about 2-fold or higher compared to a cell of the same cell type that does not comprise the modification, such as any of about 4-fold or higher, 6-fold or higher, 8-fold or higher, 10-fold or higher, 15-fold or higher, 20-fold or higher, 30-fold or higher, 40-fold or higher, 50-fold or higher, 60-fold or higher, 70-fold or higher, 80-fold or higher, 90-fold or higher, 100-fold or higher, 150-fold or higher, and 200-fold or higher compared to a cell of the same cell type that does not comprise the modification. In some embodiments, the expression of CD47 is increased by about 200-fold or lower compared to a cell of the same cell type that does not comprise the modification, such as any of about 150-fold or lower, 100-fold or lower, 90-fold or lower, 80-fold or lower, 70-fold or lower, 60-fold or lower, 50-fold or lower, 40-fold or lower. 30-fold or lower, 15 -fold or lower, 10-fold or lower. 8-fold or lower, 6-fold or lower. 4-fold or lower, and 2-fold or lower compared to a cell of the same cell type that does not comprise the modification. In some embodiments, the expression of CD47 is increased by between about 2-fold and about 200-fold compared to a cell of the same cell type that does not comprise the modification, such as between any of about 2-fold and about 20-fold, about 10-fold and about 50-fold, about 30-fold and about 70-fold, about 50-fold and about 100-fold, about 80-fold and about 150-fold. and about 120-fold and about 200-fold, compared to a cell of the same cell type that does not comprise the modification.

[0297] In some embodiments, the engineered islets comprise a nucleotide sequence encoding a CD47 polypeptide has at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP 001768.1 and NP 942088.1. In some embodiments, the engineered islets comprise a nucleotide sequence encoding a CD47 polypeptide having an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP 001768.1 andNP_942088.1. In sonic embodiments, the engineered islets comprise a nucleotide sequence for CD47 having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) to the sequence set forth in NCBI Ref. Nos. NM_001777.3 and NM 198793.2. In some embodiments, the engineered islets comprise a nucleotide sequence for CD47 as set forth in NCBI Ref. Sequence Nos. NM_001777.3 and NM 198793.2.

[0298] In some embodiments, the engineered islets comprise a CD47 polypeptide having at least 95% sequence identity (e.g., 95%, 96%. 97%, 98%, 99%, or more) to an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP 001768.1 and NP 942088.1. In some embodiments, the engineered islets comprise a CD47 polypeptide having an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP 001768.1 and NP 942088.1.

[0299] In some embodiments, the engineered islets comprise a CD47 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in SEQ ID NO: 1. In some embodiments, the engineered islets comprise a CD47 polypeptide having the amino acid sequence as set forth in SEQ ID NO: 1. In some embodiments, the engineered islets comprise a CD47 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in SEQ ID NO: 2. In some embodiments, the engineered islets comprise a CD47 polypeptide having the amino acid sequence as set forth in SEQ ID NO: 2.

[0300] In certain embodiments, the polynucleotide encoding CD47 is operably linked to a promoter.

[0301] In some embodiments, an exogenous polynucleotide encoding CD47 is integrated into the genome of the engineered islets by targeted or non-targeted methods of insertion, such as described further below. In some embodiments, targeted insertion is by homology -dependent insertion into a target loci, such as by insertion into any one of the genomic (gene) loci. In some embodiments, each of the one or more genomic loci are selected from the group consisting of a MICA gene locus, a MICB gene locus, a B2M gene locus, a CIITA gene locus, a CD 142 gene locus, a CCR5 gene locus, CXCR4 gene locus, PPP1R12C (also known as AAVS1) gene locus, albumin gene locus, SHS231 locus, CLYBL gene locus, ROSA26 gene locus, LRP1 gene locus, HMGB1 gene locus, ABO gene locus. RHD gene locus, FUT1 gene locus, and KDM5D gene locus. In some embodiments, each of the one or more genomic loci are selected from the group consisting of a B2M locus, a TAPI locus, a CIITA locus, a MIC-A locus, a MIC-B locus, and a safe harbor locus. In some embodiments, the safe harbor locus is selected from the group consisting of an AAVS1, ABO. CCR5, CLYBL. CXCR4, F3, FUT1, HMGB1, KDM5D, LRP1, MICA, MICB, RHD, ROSA26, and SHS231 locus.

[0302] In some embodiments, targeted insertion is by homology -dependent insertion into a target loci, such as by insertion into any one of tire gene loci described herein, e g. a B2M gene, a CIITA gene. In some embodiments, targeted insertion is by homology -independent insertion, such as by insertion into a safe harbor locus. In some cases, the polynucleotide encoding CD47 is inserted into a safe harbor locus, such as but not limited to, a gene locus selected from AAVS1, CCR5, CLYBL. ROSA26. and SHS231. In particular embodiments, the polynucleotide encoding CD47 is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus. In some embodiments, the polynucleotide encoding CD47 is inserted into any one of the gene loci described herein. In some cases, the polynucleotide encoding CD47 is inserted into a safe harbor locus.

[0303] In particular embodiments, the polynucleotide encoding CD47 is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus. In some embodiments, the polynucleotide encoding CD47 is inserted into a B2M gene locus or a CIITA gene locus. In some embodiments, a suitable gene editing system (e.g.. CRISPR / Cas system or any of the geneediting systems described herein) is used to facilitate the insertion of a polynucleotide encoding CD47, into a genomic locus of the cell.

[0304] In some embodiments, CD47 protein expression is detected using a Western blot of cell lysates probed with antibodies against the CD47 protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the exogenous CD47 inRNA.

[0305] In some embodiments, the engineered islets contains an exogenous polynucleotide that encodes CD200. such as human CD200. In some embodiments, CD200 is overexpressed in the cell. In some embodiments, the expression of CD200 is increased in the engineered islets compared to a similar reference or unmodified cell (including with any other modifications, such as genetic modifications) except that the reference or unmodified cell does not include the exogenous polynucleotide encoding CD200. Useful genomic, polynucleotide and polypeptide information about human CD200 are provided in, for example, the GeneCard Identifier GC03P112332. HGNC No. 7203, NCB1 Gene ID 4345. Uniprot No. P41217, and NCBI RefSeq Nos. NP_001004196.2, NM_001004196.3. NP_001305757.1,NM 001318828.1, NP_005935.4, NM_005944.6, XP_005247539.1, and XM_005247482.2. In certain embodiments, the polynucleotide encoding CD200 is operably linked to a promoter.

[0306] In some embodiments, the polynucleotide encoding CD200 is inserted into any one of the gene loci described herein. In some cases, the polynucleotide encoding CD200 is inserted into a safe harbor locus, such as but not limited to, a gene locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In particular embodiments, the polynucleotide encoding CD200 is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus. In some embodiments, the polynucleotide encoding CD200 is inserted into a B2M gene locus or a CIITA gene locus. In some embodiments, a suitable gene editing system (e.g., CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate the insertion of a polynucleotide encoding CD200, into a genomic locus of the cell.

[0307] In some embodiments, CD200 protein expression is detected using a Western blot of cell lysates probed with antibodies against the CD200 protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the exogenous CD200 mRNA.

[0308] In some embodiments, the engineered islets contains an exogenous polynucleotide that encodes HLA-E, such as human HLA-E. In some embodiments. HLA-E is overexpressed in the cell. In some embodiments, the expression of HLA-E is increased in the engineered islets compared to a similar reference or unmodified cell (including with any other modifications) except that the reference or unmodified cell does not include the exogenous polynucleotide encoding HLA-E. Useful genomic, polynucleotide and polypeptide information about human HLA-E are provided in, for example, the GeneCard Identifier GC06P047281. HGNC No. 4962, NCBI Gene ID 3133. Uniprot No. P13747, and NCBI RefSeq Nos. NP 005507.3 and NM 005516.5. In certain embodiments, the polynucleotide encoding HLA-E is operably linked to a promoter.

[0309] In some embodiments, the polynucleotide encoding HLA-E is inserted into any one of the gene loci described herein. In some cases, the polynucleotide encoding HLA-E is inserted into a safe harbor locus, such as but not limited to, a gene locus selected from AAVS1, CCR5, CLYBL, ROSA26, SHS231. In particular embodiments, the polynucleotide encoding HLA-E is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus. In some embodiments, the polynucleotide encoding HLA-E is inserted into a B2M gene locus, a CIITA gene locus. In some embodiments, a suitable gene editing system (e.g., CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate the insertion of a polynucleotide encoding HLA-E, into a genomic locus of the cell.

[0310] In some embodiments, HLA-E protein expression is detected using a Western blot of cell lysates probed with antibodies against the HLA-E protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the exogenous HLA-E mRNA.

[0311] In some embodiments, the engineered islets contains an exogenous polynucleotide that encodes HLA-G. such as human HLA-G. In some embodiments, HLA-G is overexpressed in the cell. In some embodiments, the expression of HLA-G is increased in the engineered islets compared to a similar reference or unmodified cell (including with any other modifications, such as genetic modifications) except that the reference or unmodified cell does not include the exogenous polynucleotide encoding HLA-G. Useful genomic, polynucleotide and polypeptide information about human HLA-G are provided in, for example, the GeneCard Identifier GC06P047256, HGNC No. 4964, NCBI Gene ID 3135, UniprotNo. P17693, and NCBI RefSeqNos. NP_002118.1 and NM 002127.5. In certain embodiments, the polynucleotide encoding HLA-G is operably linked to a promoter.

[0312] In some embodiments, the polynucleotide encoding HLA-G is inserted into any one of the gene loci described herein. In some cases, the polynucleotide encoding HLA-G is inserted into a safe harbor locus, such as but not limited to, a gene locus selected from AAVSL CCR5, CLYBL. ROSA26, and SHS231. In particular embodiments, the polynucleotide encoding HLA-G is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus. In some embodiments, the polynucleotide encoding HLA-G is inserted into a B2M gene locus or; a CIITA gene locus. In some embodiments, a suitable gene editing system (e.g., CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate the insertion of a polynucleotide encoding HLA-G, into a genomic locus of the cell.

[0313] In some embodiments, HLA-G protein expression is detected using a Western blot of cell lysates probed with antibodies against the HLA-G protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the exogenous HLA-G mRNA.

[0314] In some embodiments, the engineered islets contains an exogenous polynucleotide that encodes PD-L1, such as human PD-L1. In some embodiments. PD-L1 is overexpressed in the cell. Insome embodiments, the expression of PD-L1 is increased in engineered islets compared to a similar reference or unmodified cell (including with any other modifications) except that the reference or unmodified cell does not include the exogenous polynucleotide encoding PD-L1. Useful genomic, polynucleotide and polypeptide information about human PD-L1 or CD274 are provided in, for example, the GeneCard Identifier GC09P005450, HGNC No. 17635, NCBI Gene ID 29126, Uniprot No.Q9NZQ7, and NCBI RcfScqNos. NP_001254635.1, NM OO 1267706.1, NP_054862.1, andNM 014143.3. In certain embodiments, the polynucleotide encoding PD-L1 is operably linked to a promoter.

[0315] In some embodiments, the polynucleotide encoding PD-L1 is inserted into any one of the gene loci described herein. In some cases, the polynucleotide encoding PD-L1 is inserted into a safe harbor locus, such as but not limited to, a gene locus selected from AAVS1, CCR5, CLYBL, ROSA26. and SHS231. In particular embodiments, the polynucleotide encoding PD-L1 is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus. In some embodiments, the polynucleotide encoding PD-L1 is inserted into a B2M gene locus, a CIITA gene locus. In some embodiments, a suitable gene editing system (e.g., CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate the insertion of a polynucleotide encoding PD-L1, into a genomic locus of the cell.

[0316] In some embodiments, PD-L1 protein expression is detected using a Western blot of cell lysates probed with antibodies against the PD-L1 protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the exogenous PD-L1 mRNA.

[0317] In some embodiments, the engineered islets contains an exogenous polynucleotide that encodes FasL, such as human FasL. In some embodiments, FasL is overexpressed in the cell. In some embodiments, the expression of FasL is increased in the engineered islets compared to a similar reference or unmodified cell (including with any other modifications, such as genetic modifications) except that the reference or unmodified cell does not include the exogenous poly nucleotide encoding FasL. Useful genomic, polynucleotide and polypeptide information about human Fas ligand (which is known as FasL, FASLG, CD 178, TNFSF6, and the like) are provided in, for example, the GeneCard Identifier GC01P172628, HGNC No. 11936, NCBI Gene ID 356, Uniprot No. P48023, and NCBI RefSeqNos. NP 000630.1. NM_000639.2, NP_001289675.1, and NM OO 1302746.1. In certain embodiments, the polynucleotide encoding Fas-L is operably linked to a promoter.

[0318] In some embodiments, the polynucleotide encoding Fas-L is inserted into any one of the gene loci described herein. In some cases, the polynucleotide encoding Fas-L is inserted into a safe harbor locus, such as but not limited to. a gene locus selected from AAVSL CCR5, CLYBL, ROSA26. and SHS231. In particular embodiments, the polynucleotide encoding Fas-L is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus. In some embodiments, the polynucleotide encoding Fas-L is inserted into a B2M gene locus or a CIITA genelocus. In some embodiments, a suitable gene editing system (e.g.. CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate the insertion of a polynucleotide encoding Fas-L, into a genomic locus of the cell.

[0319] In some embodiments, Fas-L protein expression is detected using a Western blot of cell lysates probed with antibodies against the Fas-L protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the exogenous Fas-L mRNA.

[0320] In some embodiments, the engineered islets contains an exogenous polynucleotide that encodes CCL21. such as human CCL21. In some embodiments, CCL21 is overexpressed in the cell. In some embodiments, the expression of CCL21 is increased in the engineered islets compared to a similar reference or unmodified cell (including with any other modifications, such as genetic modifications) except that the reference or unmodified cell does not include the exogenous polynucleotide encoding CCL21. Useful genomic, polynucleotide and polypeptide information about human CCL21 are provided in, for example, the GeneCard Identifier GC09M034709, HGNC No. 10620, NCBI Gene ID 6366. UniprotNo. 000585, and NCBI RefSeqNos. NP 002980.1 and NM 002989.3. In certain embodiments, the polynucleotide encoding CCL21 is operably linked to a promoter.

[0321] In some embodiments, the polynucleotide encoding CCL21 is inserted into any one of the gene loci described herein. In some cases, the polynucleotide encoding CCL21 is inserted into a safe harbor locus, such as but not limited to, a gene locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In particular embodiments, the polynucleotide encoding CCL21 is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus. In some embodiments, the polynucleotide encoding CCL21 is inserted into a B2M gene locus, a CIITA gene locus. In some embodiments, a suitable gene editing system (e.g., CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate the insertion of a polynucleotide encoding CCL21, into a genomic locus of the cell.

[0322] In some embodiments, CCL21 protein expression is detected using a Western blot of cell lysates probed with antibodies against the CCL21 protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the exogenous CCL21 mRNA.

[0323] In some embodiments, the engineered islets contains an exogenous polynucleotide that encodes CCL22. such as human CCL22. In some embodiments, CCL22 is overexpressed in the cell. In some embodiments, the expression of CCL22 is increased in the engineered islets compared to a similar reference or unmodified cell (including with any other modifications, such as genetic modifications) except that the reference or unmodified cell does not include the exogenous polynucleotide encoding CCL22. Useful genomic, polynucleotide and polypeptide information about human CCL22 are provided in. for example, the GeneCard Identifier GC16P057359, HGNC No. 10621, NCBI Gene ID 6367.UniprotNo. 000626. and NCBI RefSeqNos. NP_002981.2, NM_002990.4. XP_016879020.1. andXM_017023531.1. In certain embodiments, the polynucleotide encoding CCL22 is operably linked to a promoter.

[0324] In some embodiments, the polynucleotide encoding CCL22 is inserted into any one of the gene loci described herein. In some cases, the polynucleotide encoding CCL22 is inserted into a safe harbor locus, such as but not limited to, a gene locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In particular embodiments, the polynucleotide encoding CCL22 is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus. In some embodiments, the polynucleotide encoding CCL22 is inserted into a B2M gene locus, a CIITA gene locus. In some embodiments, a suitable gene editing system (e.g., CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate the insertion of a polynucleotide encoding CCL22, into a genomic locus of the cell.

[0325] In some embodiments, CCL22 protein expression is detected using a Western blot of cell lysates probed with antibodies against the CCL22 protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the exogenous CCL22 mRNA.

[0326] In some embodiments, the engineered islets contains an exogenous polynucleotide that encodes Mfge8, such as human Mfge8. In some embodiments, Mfge8 is overexpressed in the cell. In some embodiments, the expression of Mfge8 is increased in the engineered islets compared to a similar reference or unmodified cell (including with any other modifications, such as genetic modifications) except that the reference or unmodified cell does not include the exogenous polynucleotide encoding Mfge8. Useful genomic, polynucleotide and polypeptide information about human Mfge8 are provided in, for example, the GeneCard Identifier GC15M088898, HGNC No. 7036, NCBI Gene ID 4240, Uniprot No. Q08431, and NCBI RefSeq Nos. NP 001108086.1, NM 001114614.2, NP 001297248.1,NM 001310319.1, NP 001297249.1, NM 001310320.1, NP 001297250.1, NM 001310321.1, NP 005919.2, and NM 005928.3. In certain embodiments, the polynucleotide encoding Mfge8 is operably linked to a promoter.

[0327] In some embodiments, the polynucleotide encoding Mfge8 is inserted into any one of the gene loci described herein. In some cases, the polynucleotide encoding Mfge8 is inserted into a safe harbor locus, such as but not limited to, a gene locus selected from AAVS1, CCR5, CLYBL. ROSA26. and SHS231. In particular embodiments, the polynucleotide encoding Mfge8 is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus. In some embodiments, the polynucleotide encoding Mfge8 is inserted into a B2M gene locus, a CIITA gene locus. In some embodiments, a suitable gene editing system (e.g., CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate the insertion of a polynucleotide encoding Mfge8, into a genomic locus of the cell.

[0328] In some embodiments, Mfge8 protein expression is detected using a Western blot of cell lysates probed with antibodies against the Mfge8 protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) arc used to confirm the presence of the exogenous Mfgc8 mRNA.

[0329] In some embodiments, the engineered islets contains an exogenous polynucleotide that encodes SerpinB9. such as human SerpinB9. In some embodiments, SerpinB9 is overexpressed in the cell. In some embodiments, the expression of SerpinB9 is increased in the engineered islets compared to a similar reference or unmodified cell (including with any other modifications, such as genetic modifications) except that the reference or unmodified cell does not include the exogenous polynucleotide encoding SerpinB9. Useful genomic, polynucleotide and polypeptide information about human SerpinB9 are provided in. for example, the GeneCard Identifier GC06M002887, HGNC No. 8955. NCBI Gene ID 5272, UniprotNo. P50453, andNCBI RefSeqNos. NP 004146.1. NM 004155.5, XP 005249241.1. and XM 005249184.4. In certain embodiments, the polynucleotide encoding SerpinB9 is operably linked to a promoter.

[0330] In some embodiments, the polynucleotide encoding SerpinB9 is inserted into any one of the gene loci described herein. In some cases, the polynucleotide encoding SerpinB9 is inserted into a safe harbor locus, such as but not limited to, a gene locus selected from AAVS1. CCR5, CLYBL.ROSA26, and SHS231. In particular embodiments, the polynucleotide encoding SerpinB9 is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus. In some embodiments, the polynucleotide encoding SerpinB9 is inserted into a B2M gene locus, a CIITA gene locus. In some embodiments, a suitable gene editing system (e.g., CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate the insertion of a polynucleotide encoding SerpinB9, into a genomic locus of the cell.

[0331] In some embodiments, SerpinB9 protein expression is detected using a Western blot of cell lysates probed with antibodies against the SerpinB9 protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confinn the presence of the exogenous SerpinB9 mRNA.

[0332] In some embodiments, the tolerogenic factor overexpressed or increased in the cell, e.g. engineered hypoimmunogenic islets, is an engineered CD47 protein. In some embodiments, the engineered CD47 protein have fewer amino acids than the wild-type full-length human CD47 protein. Such engineered proteins afford more efficient cell engineering approaches, including delivery via integrating gene therapy vectors. In some embodiments, the engineered CD47 proteins overexpressed or increased in the engineered hypoimmunogenic islets, are those described in PCT Publication No.WO2023158836, which is hereby incorporated by reference in its entirety.

[0333] CD47, also known as integrin-associated protein (IAP) or MER6, is a transmembrane protein that, in humans, is encoded by the human CD47 gene. CD47 is a member of the immunoglobulin(Ig) superfamily and is involved in a range of cellular processes, including apoptosis, proliferation, adhesion, and migration.

[0334] Human CD47 has a single IgV-like domain at its N-terminus, a highly hydrophobic stretch with five membrane-spanning segments, and an alternatively spliced cytoplasmic tail at its C-tenninus . In addition, it has two extracellular regions and two intracellular regions between neighboring membrane-spanning segments. The signal peptide, when it exists on a CD47 isofonn, is located at the N-terminus of die IgV-like domain.

[0335] As used herein, a human CD47 extracellular domain refers to the IgV-like domain at the N-terminus of the human CD47 protein. Structurally, die human CD47 extracellular domain is the N-terminal portion of the human CD47 protein that is located outside a cell when the human CD47 protein is anchored in the cell membrane. In some embodiments, the human CD47 extracellular domain has an amino acid sequence corresponding to amino acids 19-141 of SEQ ID NO:78. or an amino acid sequence that has at least 80%, 85%. 90%. 91%, 92%, 93%. 94%. 95%, 96%, 97%. 98%. or 99% identity with amino acids 19-141 of SEQ ID NO: 78. In some embodiments, the human CD47 extracellular domain has an amino acid sequence corresponding to amino acids 19-141 of SEQ ID NO: 78, or an amino acid sequence that has at least about 80%, 85%. 90%. 91%, 92%, 93%. 94%. 95%, 96%, 97%, 98%. or 99% identity with amino acids 19-141 of SEQ ID NO: 78.

[0336] As used herein, a human CD47 intracellular domain refers to the cytoplasmic tail at the C-terminus of the human CD47 protein. Structurally, the human CD47 intracellular domain is the C-terminal portion of the human CD47 protein that is located inside a cell when the human CD47 protein is anchored in the cell membrane. The human CD47 intracellular domain is alternatively spliced in vivo. In some embodiments, the human CD47 intracellular domain has an amino acid sequence corresponding to amino acids 290-323 of SEQ ID NO: 78, or an amino acid sequence that has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with amino acids 290-323 of SEQ ID NO: 78. In some embodiments, tire human CD47 intracellular domain has an amino acid sequence corresponding to amino acids 290-323 of SEQ ID NO: 78, or an amino acid sequence that has at least about 80%, 85%, 90%. 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with amino acids 290-323 of SEQ ID NO: 78.

[0337] As used herein, a human CD47 transmembrane domain refers to one of the membranespanning segments of the human CD47 protein. In some embodiments, the human CD47 transmembrane domain has an amino acid sequence corresponding to amino acids 142-162. 177-197, 208-228. 236-257, or 269-289 of SEQ ID NO: 78. or an amino acid sequence that has at least 80%. 85%, 90%, 91%, 92%.93%, 94%, 95%, 96%. 97%, 98%, or 99% identity with amino acids 142-162. 177-197, 208-228. 236-257, or 269-289 of SEQ ID NO: 78. In some embodiments, the human CD47 transmembrane domain has an amino acid sequence corresponding to amino acids 142-162, 177-197, 208-228, 236-257, or 269-289 of SEQ ID NO: 78. or an amino acid sequence that has at least about 80%. 85%. 90%, 91%, 92%. 93%.94%, 95%, 96%. 97%, 98%, or 99% identity with amino acids 142-162. 177-197, 208-228, 236-257, or 269-289 of SEQ ID NO: 78.

[0338] As used herein, a signal peptide refers to the short peptide present at the N-terminus of the CD47 protein when the protein is initially translated. Signal peptides are usually cleaved off from a protein by a signal peptidase during or immediately after insertion into a cell membrane. Signal peptides function to prompt a cell to translocate the protein, usually to the plasma membrane. In some embodiments, the signal peptide for a human CD47 protein has an amino acid sequence corresponding to amino acids 1-18 of SEQ ID NO: 78, or an amino acid sequence that has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with amino acids 1-18 of SEQ ID NO: 78. In some embodiments, the signal peptide for a human CD47 protein has an amino acid sequence corresponding to amino acids 1-18 of SEQ ID NO: 78. or an amino acid sequence that has at least about 80%, 85%, 90%, 91%. 92%, 93%, 94%, 95%. 96%, 97%, 98%, or 99% identity with amino acids 1-18 of SEQ ID NO: 78.

[0339] The wild-type full-length human CD47 protein, as used herein, refers to the isoform CD47-202 as disclosed in the Ensembl database as of the filing date of this patent application. The wildtype full-length human CD47 protein has an amino acid sequence of SEQ ID NO: 78, wherein amino acids 1-18 are the signal peptide, amino acids 19-141 are the extracellular domain, amino acids 142-162, 177-197, 208-228, 236-257, 269-289 are the five transmembrane domains, and amino acids 290-323 are the intracellular domain. Amino acids 163-176 and 229-235 are the two intracellular connections between the transmembrane domains, and amino acids 198-207 and 257-268 are the two extracellular connections between die transmembrane domains.

[0340] In some embodiments, the engineered CD47 protein is a C-temiinally truncated version of isoform 202 (SEQ ID NO: 78). For example, in some embodiments, the C-terminal truncation is consecutive and is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113. 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124. 125, 126, 127, 128, 129, 130, 131. 132, 133, 134. 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145. 146, 147, 148, 149, 150, 151, 152. 153, 154, 155. 156, 157, 158, 159, 160, or 161 amino acid(s) long. In some embodiments, the engineered CD47 protein having a C-tenninal truncation of SEQ ID NO: 78 further has an N-temiinal truncation of 1, 2, 3, 4. 5, 6, 7, 8, 9. 10, 11, 12, 13. 14, 15, 16, 17. 18, 19, 20, 21, 22. 23, 24, 25, 26. 27, 28, 29, 30, 31. 32, 33, 34, 35. 36. 37, 38, 39, 40. 41, 42, 43, 44. 45, 46, 47, 48, 49. 50, 51, 52, 53. 54, 55, 56, 57, 58, 59. 60, 61, 62, 63. 64. 65, 66, 67, 68. 69, 70, 71, 72. 7...

Claims

CLAIMSWHAT IS CLAIMED:

1. A method of treating or preventing a beta cell disorder in a subject in need thereof, comprising administering to the subject a composition comprising a dose of engineered hypoimmunogenic islet cells,wherein the composition is administered to the subject via intramuscular injection, and wherein the composition comprises a dose from:A) about 1x10" cells to about 3 x 108cells;B) about 1.25x10scells / kg to about 1.2 x 10’ cells / kg;C) about 6,500 islet equivalents (IEQ) to about 600,000 IEQ; orD) about 80 lEQ / kg to about 24,000 lEQ / kg.

2. A method of reducing exogenous insulin dependence in a subject having or at risk of having a beta cell disorder, comprising administering to the subject a composition comprising a dose of engineered hypoimmunogenic islet cells,wherein the composition is administered via intramuscular injection,wherein the composition comprises a dose from:A) about I lO7cells to about 3 x 108cells;B) about 1.25x10scells / kg to about 1.2 x 10 cells / kg;C) about 6,500 islet equivalents (IEQ) to about 600,000 IEQ; orD) about 80 lEQ / kg to about 24.000 IEQ / kg;wherein the amount of exogenous insulin required is less than the amount of exogenous insulin required for a subject treated with non-hypoimmunogenic islets or is less than the amount of exogenous insulin required for untreated subjects that have the beta cell disorder.

3. A method of stabilizing glucose levels in a subject having or at risk of having a beta cell disorder, comprising administering to the subject a composition comprising a dose of engineered hypoimmunogenic islet cells,wherein the composition is administered via intramuscular injection,wherein the composition comprises a dose from:A) about 1x10" cells to about 3 x 108cells;B) about 1.25x10scells / kg to about 1.2 x 107cells / kg;C) about 6,500 islet equivalents (IEQ) to about 600,000 IEQ; orD) about 80 IEQ / kg to about 24,000 IEQ / kg;wherein the glucose levels are stabilized compared to a subject administered an alternative islet therapy or compared to an untreated subject.

4. A method of stabilizing / increasing c-peptide levels in a subject having or at risk of having a beta cell disorder, comprising administering to the subject a composition comprising a dose of engineered hypoimmunogenic islet cells,wherein the composition is administered via intramuscular injection, andwherein composition comprises a dose from:A) about IxlO7cells to about 3 x 108cells;B) about 1.25xl05cells / kg to about 1.2 x 10’ cells / kg;C) about 6,500 islet equivalents (IEQ) to about 600,000 IEQ; orD) about 80 lEQ / kg to about 24,000 lEQ / kg;wherein the c-peptide levels are stabilized or increased compared to a subject administered an alternative islet therapy or compared to an untreated subject.

5. A method of reducing HbAlc levels in a subject having or at risk of having a beta cell disorder, comprising administering to the subject a composition comprising a dose of engineered hypoimmunogenic islet cells.wherein the composition is administered via intramuscular injection, andwherein the composition comprises a dose from:A) about I lO7cells to about 3 x 108cells;B) about 1.25xl(F cells / kg to about 1.2 x 10 cells / kg;C) about 6,500 islet equivalents (IEQ) to about 600,000 IEQ; orD) about 80 lEQ / kg to about 24,000 lEQ / kg;wherein the HbAlc levels are reduced compared to a subject administered an alternative islet therapy or compared to an untreated subject.

6. A method of reducing adverse side effects associated with islet cell therapy in a subject having or at risk of having a beta cell disorder, the method comprisingi) introducing hypoimmunogenic modifications to a population of islet cells comprising beta cells to generate engineered hypoimmunogenic islet cells, andii) administering a composition comprising a dose of the engineered hypoimmunogenic islet cells to a subject having or at risk of having a beta cell disorder,wherein the composition is administered via intramuscular injection, andwherein the composition comprises a dose from:A) about IxlO7cells to about 3 x 108cells;B) about 1.25xl05cells / kg to about 1.2 x 10’ cells / kg;C) about 6,500 islet equivalents (IEQ) to about 600,000 IEQ; orD) about 80 lEQ / kg to about 24,000 lEQ / kg.

7. A method of increasing time in range (TIR) in a subject having or at risk of having a beta cell disorder, the method comprising administering to the subject a composition comprising a dose of engineered hypoimmunogenic islet cells,wherein the composition is administered via intramuscular injection, andwherein the composition comprises a dose from:A) about 1x10scells to about 3 x 108cells;B) about 1.25xl05cells / kg to about 1.2 x 10’ cells / kg;C) about 6,500 islet equivalents (IEQ) to about 600,000 IEQ; orD) about 80 lEQ / kg to about 24,000 lEQ / kg;wherein the TIR is increased compared to a subject administered an alternative islet therapy or compared to an untreated subject.

8. A method of inducing immune tolerance to a composition comprising a dose of engineered hypoimmunogenic islet cells, comprising administering the composition to a subject having or at risk of having a beta cell disorder, wherein the composition comprises a mixed population of engineered and non-engineered islet cells.

9. The method of claim 8, wherein the immune tolerance is induced against the non-cnginccrcd islet cells.

10. The method of any one of claims 8-9, wherein the dose comprises:A) about 1x10scells to about 3 x 108cells;B) about 1.25x10scells / kg to about 1.2 x 10’ cells / kg;C) about 6,500 islet equivalents (IEQ) to about 600,000 IEQ; orD) about 80 lEQ / kg to about 24,000 lEQ / kg.

11. The method of any one of claims 8-10, wherein the immune tolerance is induced about at least 6 months, 9 months, or 12 months after administration of the composition.

12. The method of any one of claims 8-11, wherein the composition is administered to the subject via intramuscular injection.

13. The method of any one of claims 8-12, wherein the immune tolerance is reduced adaptive immune response.

14. The method of claim 13, wherein reduced adaptive immune response comprises reduced T cell response and / or donor-specific antibodies.

15. The method of any of claims 1-14, wherein the method results in reduction in other medication requirements for treating the beta cell disorder, optionally wherein the beta cell disorder medication is insulin.

16. The method of any of claims 1-15. wherein the subject exhibits reduced insulin dependence.

17. The method of claim 2 or claim 16, wherein the amount of exogenous insulin is reduced by 10%, about 20%, about 30%, about 40%. about 50%, about 60%, about 70%. about 75%, about 80% or more compared to tire amount of exogenous insulin required for a subject administered non-hypoimmunogenic islets for treating the beta cell disorder or the amount of exogenous insulin required for untreated subjects that have die beta cell disorder.

18. The method of any of claims 2, 16, and 17, wherein the method is characterized by the subject meeting one or more of the following criteria: (i) fasting capillary glucose level does not exceed 140 mg / dL (7.8 mmol / L) more than three times in 1 week (based on measuring capillary glucose levels a minimum of 7 times in a seven day period); (ii) 2-hours post-prandial capillary glucose does not exceed 180 mg / dL (10.0 mmol / L) more than three times in 1 week (based on measuring capillary glucose levels a minimum of 21 times in a seven day period); and (iii) evidence of endogenous insulin production defined as fasting or stimulated C-peptide levels >0.5 ng / mL (0.16 pmol / L).

19. The method of any of claims 1-6, wherein the method results in the subject exhibiting insulin-independence .

20. The method of claim 19, wherein the subject exhibits insulin-independence for a period of greater than one month, greater than two months, greater than three months, greater than four months, greater than 5 months, greater than 6 months, greater than 7 months, greater than 8 months, greater than 9 months, greater than 10 months, greater than 11 months or greater than 12 months.

21. The method of any of claims 1-20, the method is characterized by the subject meeting one or more of the following:a) Peak c-peptide >0.20 nmol / 1 (as assessed by mixed meal tolerance test);b) Non-fasting c-peptide >0.10 nmol / 1 (as assessed by mixed meal tolerance test);c) Daily exogenous insulin requirement <0.25U / kg;d) Daily exogenous insulin requirement = OU / kg;e) Decrease in exogenous insulin requirement (per kg body w eight);f) Decrease in HbAlc (per kg body weight);g) Decrease in glucose variability (stabilization);h) Decrease in duration of hypoglycemia and / or hyperglycemia (unproved euglycemia); i) Glycemic control HbAlc <6.5% (48 mmol / mol); andj) Glycemic control HbAlc <7.0% (53 mmol / mol).

22. The method of any of claims 1-21, wherein the engineered hypoimmuno genic islet cells comprise modifications that:(a) inactivate or disrupt one or more alleles of: (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate expression of the one or more MHC class I molecules, and / or (ii) one or more MHC class II molecules or one or more molecules that regulate expression of the one or more MHC class II molecules; and / or(b) increase expression of one or more tolerogenic factors, wherein the increased expression is relative to a control or wild-type islet that does not comprise the modifications.

23. The method of any one of claims 1-22, wherein the engineered hypoimmunogenic islet cells comprise engineered beta islet cells.

24. The method of claim 23, wherein the engineered hypoimmunogenic islet cells further comprises additional engineered islet cells, optionally wherein the additional engineered islet cells comprise alpha cells and / or delta cells.

25. The method of claim 24, wherein the additional engineered islet cells comprises cells that comprises the same modifications of die engineered beta islet cells.

26. The method of any one of claims 1-25, wherein at least 20%, at least 25%. at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, or at least 70% of the cells in the engineered hypoimmunogenic islet cells comprise engineered beta islet cells.

27. The method of any one of claims 1-26, wherein the engineered hypoimmunogenic islet cells is an islet cluster.

28. The method of any one of claims 1-27, wherein the engineered hypoimmunogenic islet cells is engineered from primary islets.

29. The method of claim 28, wherein the primary islets are from a pancreas.

30. The method of claim 28 or claim 29, wherein the primary islets are from a human subject or an animal subject, optionally wherein the primary islets are porcine, bovine or ovine.

31. The method of any of claims 29 or 30, wherein the primary islets are from a donor subject that is not suspected of having a beta cell related disorder.

32. The method of claim 31, wherein the donor is a cadaver.

33. The method of any one of claims 1-32. wherein the engineered hypoimmunogenic islet cells are ABO blood group type O.

34. The method of any one of claims 1-33. wherein the engineered hypoimmunogenic islet cells are Rhesus factor negative (Rli-).

35. The method of any one of claims 1-34, wherein the engineered hypoimmunogenic islet cells are differentiated from a stem cell.

36. The method of any one of claims 1-34, wherein the engineered hypoimmunogenic islet cells are autologous.

37. The method of any one of claims 1-36, wherein the beta cell disorder is diabetes.

38. The method of any one of claims 1-37, wherein the beta cell disorder is Type I diabetes.

39. The method of any one of claims 1-38, wherein the beta cell disorder is autoimmune diabetes mellitus (Type 1A).

40. The method of any of claims 1-39, wherein the subject to be treated is characterized by one or more of the follow ing: ty pe 1 diabetes for more than 5 years, C-peptide negative (or <0.01 mnol / 1)in response to mixed meal tolerance test (MMTT), positive for antibodies to either GAD or IA2, HbAic> 63 mmol / mol, Time in Range (glucose values 4-10 mmol / 1) in the ambulator}' glucose profile, as measured by CGM, < 50%. and an exogenous insulin requirement <lU / kg.

41. The method of any one of claims 1-40, wherein the composition comprises a pharmaceutically acceptable carrier.

42. The method of any one of claims 1-41, wherein intramuscular administration is via the intramuscular space of the forearm, upper arm, hip, thigh or buttocks.

43. The method of any one of claims 1-42, wherein the method comprises administration of one or more further compositions comprising the engineered hypoimmunogenic islet cells.

44. The method of claim 43, wherein the one or more further compositions is administered to the subject when, after the initial dose:(a) the subject does not exhibit a reduction in other medication requirements for treating the beta cell disorder, optionally wherein the beta cell disorder medication is insulin; and / or(b) the administered engineered hypoimmunogenic islet cells are not detected by imaging.

45. The method of claim 43, wherein the one or more further compositions is administered to the subject when, after the initial dose, the subject does not meet one or more of the following criteria: (i) fasting capillary glucose level does not exceed 140 mg / dL (7.8 mmol / L) more than three times in 1 week (based on measuring capillary glucose levels a minimum of 7 times in a seven day period); (ii) 2-hours post-prandial capillary glucose does not exceed 180 mg / dL (10.0 mmol / L) more than three times in 1 week (based on measuring capillary glucose levels a minimum of 21 times in a seven day period); and (iii) evidence of endogenous insulin production defined as fasting or stimulated C-peptide levels >0.5 ng / mL (0.16 pmol / L).

46. The method of claim 43, wherein the one or more further compositions is administered to the subject when:(a) the subject does not achieve insulin-independence within a period of time after the initial dose; and / or(b) the subject does not exhibit a reduction in other medication requirements for treating the beta cell disorder within a period of time, optionally wherein the beta cell disorder medication is insulin, optionally wherein die subject does not achieve insulin-independence for a period of greater than one week, greater than two weeks, greater than three weeks, greater than one month, greater than two months, greater than three months, greater than four months, greater than 5 months, greater than 6 months, greater than 7 months, greater than 8 months, greater than 9 months, greater than 10 months, greater than 11 months or greater than 12 months, optionally wherein the subject does not achieve insulin-independence for a period of 2 weeks.

47. The method of claim 43, wherein the one or more further compositions is administered to the subject when, after the initial dose, the subject does not meet one or more of the following criteria:a) Peak c-peptide >0.20 nmol / 1 (as assessed by mixed meal tolerance test);b) Non-fasting c-peptide >0.10 nmol / 1 (as assessed by mixed meal tolerance test);c) Daily exogenous insulin requirement <0.25U / kg;d) Daily exogenous insulin requirement = OU / kg;e) Decrease in exogenous insulin requirement (per kg body weight);f) Decrease in HbAlc (per kg body weight);g) Decrease in glucose variability (stabilization);h) Decrease in duration of hypoglycemia and / or hyperglycemia (unproved eugly cemia); i) Glycemic control HbAlc <6.5% (48 mmol / mol); andj) Glycemic control HbAlc <7.0% (53 mmol / mol).

48. The method of any one of claims 44-47, wherein prior to administering the one or more further compositions, the number of the engineered hypoimmunogenic islet cells from the initial dose are cleared or reduced in the subject.

49. The method of claim 48, wherein the number of engineered hypoimmunogenic islet cells are reduced in the subject following administration of an exogenously administered agent to direct targeted death of the engineered hypoimmunogenic islet cells, optionally wherein the exogenously administered agent activates a suicide gene or safety switch in the engineered cells or recognizes one or more tolerogenic factors on the surface of the engineered hypoimmunogenic islet cells.

50. The method of any one of claims 1-49, wherein the subject is administered an immunosuppression regimen.

51. The method of claim 50, wherein the immunosuppression regimen is administered to the subject only prior to administration of the composition.

52. The method of claim 50 or 51. wherein the immunosuppression regimen is administered to the subject only after administration of the composition.

53. The method of any one of claims 50-52, wherein the immunosuppression regimen comprises one or more immunosuppression agents.

54. The method of any one of claims 50-53, wherein the immunosuppression regimen is administered to the subject to treat a pre-existing condition unrelated to the beta cell disorder.

55. The method of any of claims 22-54, wherein the one or more tolerogenic factors is selected from the group consisting of CD16. CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, Cl inhibitor, FASL, IDO1. HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc Receptor, IL15-RF, H2-M3 (HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF.

56. The method of any of claims 22-55, wherein at least one of the one or more tolerogenic factors is CD47.

57. The method of claim 56, wherein the CD47 is an engineered CD47 protein.

58. The method of claim 57, wherein the engineered CD47 protein comprises:(a) one or more extracellular domains; and(b) one or more membrane tethers;wherein the one or more extracellular domains comprise a signal-regulatory protein alpha (SIRPa) interaction motif, andwherein the engineered protein docs not comprise one or more full-length CD47 intracellular domains.

59. The method of claim 58, wherein the SIRPa interaction motif is or comprises a CD47 extracellular domain or a portion thereof.

60. The method of claim 58, wherein the SIRPa interaction motif is or comprises a SIRPa antibody or a portion thereof.

61. The method of any of claims 1-60, wherein the engineered hypoimmunogenic islet cellss has the phenotype"<"62. The method of any of claims 1-61, wherein the engineered hypoimmunogenic islet cells exhibits one or more functions of a wild-type or control beta islet cell, optionally wherein the one or more functions is selected from the group consisting of in vitro glucose-stimulated insulin secretion (GSIS). glucose metabolism, maintaining fasting blood glucose levels, secreting insulin in response to glucose injections in vivo, and clearing glucose after a glucose injection in vivo.

63. The method of claim 62, wherein the GSIS is dynamic GSIS comprising first and second phase dynamic insulin secretion.

64. The method of claim 62, wherein the GSIS is static GSIS. optionally wherein the static incubation index is greater than at or about 1, greater than at or about 2, greater than at or about 5, greater than at or about 10 or greater than at or about 20.

65. The method of any of claims 1-64. wherein the level of insulin secretion by the engineered hypoimmunogenic islet cells is at least 20% of that observed for primary islets, optionally cadaveric islets.

66. The method of any of claims 1-65, wherein the total insulin content of the engineered hypoimmunogenic islet cells is greater than at or about 500 pIU Insulin per 5000 cells, greater than at or about 1000 |iIU Insulin per 5000 cells, greater than at or about 2000 pIU Insulin per 5000 cells, greater than at or about 3000 pIU Insulin per 5000 cells or greater than at or about 4000 pIU Insulin per 5000 cells.

67. The method of any of claims 1-66, wherein the engineered hypoimmunogenic islet cells exhibits functionality for at least 12 months following administration into a subject.

68. The method of any of claims 1-67, wherein the dose is selected from: about 1x107cells to about 3 x 108cells, from about 25 x 106cells to about 80 x 107cells, from about 25 x 106cells to about25 x 10 cells, from about 80 x 106cells to about 80 x 107cells, from about 25 x 106cells to about 80 x 106cells, or from about 1.25xl05cells / kg to about 1.2 x 107cells / kg.

69. The method of any of claims 1-68, wherein the dose is selected from about 6,500 islet equivalents (IEQ) to about 600,000 IEQ or from about 80 lEQ / kg to about 24,000 lEQ / kg.

70. The method of any of claims 1-69, wherein the method is characterized by the subject meeting one or more of the following:a) immune evasion of engineered hypoimmunogenic islet cells, as evaluated in systemic PBMC and serum;b) peak c-peptide > 0.01 mnol / 1 in response to a mixed meal tolerance test (MMTT); c) non-fasting c-peptide concentration > 0.01 mnol / 1;d) survival of engineered hypoimmunogenic islets, as evaluated by MRI;e) decreases in insulin requirement / kg BW;f) decreases in HbAlc; andg) reductions in glucose variability, hypoglycemia, and hyperglycemia.

71. The method of claim 70, wherein the engineered hypoimmunogenic islet cells demonstrate immune evasion for at least 1, 2, 4, 8. 12, 18, 26, or 52 weeks following administration to the subject.

72. The method of claim 70, wherein the engineered hypoimmunogenic islet cells survive at least 2, 4.

6. 8, 12. 26, or 52 weeks following administration to the subject.

73. The method of claim 70, wherein the insulin requirement / kg of body weight decreases at 1, 2, 3, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, or 52 weeks following administration of the engineered hypoimmunogenic islet cells to the subject.

74. The method of claim 70, wherein the HbAlc decreases at 2. 4, 6, 8, 10, 12.

14. 16, 18, 20, 26, or 52 weeks following administration of the engineered hypoimmunogenic islet cells to the subject.

75. The method of claim 70, wherein glucose variability, hypoglycemia, and hyperglycemia are reduced at least 4, 8, 12, 18, 26. or 52 weeks following administration of the engineered hypoimmunogenic islet cells to the subject.

76. The method of any of claims 1-75, wherein the subject is not characterized by having the following: any previous organ transplantation; any history of malignancy; use of any investigational agent(s) within 4 weeks of receiving the dose of engineered hypoimmunogenic islets; use of any antidiabetic medication other than insulin within 4 weeks of receiving the dose of engineered hypoimmunogenic islets; active infections including Tuberculosis, HIV, HBV and HCV; liver function test value for AST, ALT, GGT or ALP exceeding the respective reference interval; serological evidence of infection with HTLVI or HTLVII; pregnancy, nursing, intention for pregnancy; chronic kidney disease grade 3 or worse (GFR < 60 ml / min as estimated by creatine measurement); medical history of cardiac disease or symptoms at screening consistent with cardiac disease; administration of live attenuated vaccines < 6 months before receiving the dose of engineered hypoimmunogenic islets; untreatedproliferative diabetic retinopathy; ongoing psychiatric illness; ongoing substance abuse, drug or alcohol or treatment noncompliance; and known hypersensitivity to ciprofloxacin, gentamicin, or amphotericin.

77. The method of any one of claims 1-49 or 55-76, wherein the subject is not administered an immunosuppressive regimen before, during, or after administering to the subject the composition.

78. The method of any one of claims 1-49 or 55-76, wherein the subject is not administered an immunosuppressive regimen during or after administering the composition.

79. The method of any one of claims 1-78, wherein the mixed population of engineered and nonengineered islet cells comprises(i) wild type islet cells,(ii) partially gene edited islet cells comprising modifications that inactivate or disrupt one or more alleles of: (1) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate expression of the one or more MHC class 1 molecules, and / or (2) one or more MHC class II molecules or one or more molecules that regulate expression of the one or more MHC class II molecules; and wherein the partially gene edited islet cells comprise endogenous levels of one or more tolerogenic factors; and(iii) the engineered hypoimmune islet cells comprising modifications that (a) inactivate or disrupt one or more alleles of: (1) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate expression of the one or more MHC class I molecules, and (2) one or more MHC class II molecules or one or more molecules that regulate expression of the one or more MHC class II molecules; and (b) increase expression of one or more tolerogenic factors, wherein the increased expression is relative to a control or wild-type islet that does not comprise the modifications.

80. The method of claim 79, wherein the one or more tolerogenic factors is selected from the group consisting of CD16, CD24. CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, Cl inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain. HLA-G, IL- 10, IL-35. PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc Receptor, IL15-RF, H2-M3 (HLA-G), A20 / TNFAIP3. CR1, HLA-F, and MANF.

81. The method of claim 80, wherein the one or more tolerogenic factors is CD47.

82. The method of any one of claims 1-81, wherein the subject is a human.

83. The method of any one of claims 79-82, wherein the subject elicits an adaptive immune response against the wild ty pe islet cells.

84. The method of any one of claims 79-83. wherein the subject elicits an innate immune response against the partially gene edited islet cells.

85. The method of any one of claims 79-84. wherein the subject does not elicit an adaptive or innate immune response against the engineered hypoimmune islet cells.

86. The method of any of previous claims, wherein the composition comprises a mixed population of engineered and non-engineered islet cells.

87. A composition comprising a dose of engineered hypoimmunogenic islet cells, wherein the composition comprises:(i) wild ty pe islet cells,(ii) partially gene edited islet cells comprising modifications that inactivate or disrupt one or more alleles of: (1) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate expression of the one or more MHC class I molecules, and / or (2) one or more MHC class II molecules or one or more molecules that regulate expression of the one or more MHC class II molecules; and wherein the partially gene edited islet cells comprise endogenous levels of one or more tolerogenic factors; and(iii) the engineered hypoimmune islet cells comprising modifications that (a) inactivate or disrupt one or more alleles of: (1) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate expression of the one or more MHC class I molecules, and (2) one or more MHC class II molecules or one or more molecules that regulate expression of the one or more MHC class II molecules; and (b) increase expression of one or more tolerogenic factors, wherein the increased expression is relative to a control or wild-type islet that does not comprise the modifications.

88. The composition of claim 87. wherein the one or more tolerogenic factors is selected from the group consisting of CD16, CD24, CD35, CD39. CD46, CD47. CD52, CD55, CD59. CD64, CD200, CCL22. CTLA4-Ig, Cl inhibitor. FASL, IDO1. HLA-C. HLA-E. HLA-E heavy chain, HLA-G, IL-10. IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc Receptor, IL15-RF, H2-M3 (HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF.

89. The composition of claim 88, wherein the one or more tolerogenic factors is CD47.

90. The composition of any one of claims 87-89. wherein the dose is selected from:A) about 1x10 cells to about 3 x 108cells;B) about 1.25xl05cells / kg to about 1.2 x 10 cells / kg;C) about 6.500 islet equivalents (IEQ) to about 600,000 IEQ; orD) about 80 lEQ / kg to about 24.000 lEQ / kg.

Images