Terminally modified nuclease resistant translatable linear RNA

Nuclease-resistant modifications at the 5' and 3' ends of linear mRNA enhance stability and translation efficiency, addressing the limitations of cap-dependent linear mRNA constructs by enabling IRES-dependent translation and achieving comparable expression levels.

WO2026151780A2PCT designated stage Publication Date: 2026-07-16
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2026/010453
Authority / Receiving Office
WO · WO
Patent Type
Applications
Priority Date
2025-01-07
Filing Date
2026-01-07
Publication Date
2026-07-16

AI Technical Summary

Technical Problem

Existing linear mRNA constructs rely on cap-dependent translation and 3' poly-A tail for stability, limiting their durability and expression levels, while modifications to enhance stability often reduce translation efficiency or hinder poly-A adenylation, leading to susceptibility to exonuclease degradation.

Method used

Development of translatable linear mRNA with nuclease-resistant modifications at both the 5' and 3' ends, eliminating the need for a functional cap and poly-A tail, utilizing exonuclease-resistant internucleoside linkages and modified nucleobases to enhance stability and enable IRES-dependent translation.

Benefits of technology

The modified linear mRNA achieves stability and translation levels comparable to or exceeding those of cap-dependent mRNA, ensuring durable protein expression by resisting exonuclease degradation and maintaining translational efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000025_0001
    Figure IMGF000025_0001
  • Figure IMGF000027_0001
    Figure IMGF000027_0001
  • Figure IMGF000028_0001
    Figure IMGF000028_0001
Patent Text Reader

Abstract

Highly stable and translatable linear mRNA constructs are provided, The constructs have nuclease-resistant chemical modifications at both the 5' and 3' ends, one or more internal ribosome entry sites, and one or more protein coding sequences. The linear mRNA constructs provide cap-independent and IRES-dependent translation. Also provided are methods for making the linear mRNA constructs and using them to deliver therapeutic proteins to treat or prevent a wide variety of diseases or medical conditions, and for using them as vaccines.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] TITLE

[0002] Terminally Modified Nuclease Resistant Translatable Linear RNA

[0003] CROSS REFERENCE TO RELATED APPLICATIONS

[0004] This application claims the priority of U.S. Provisional Application No.

[0005] 63 / 742,692 filed 07 January 2025 and entitled “Terminally Modified Nuclease Resistant Translatable Linear RNA”, the whole of which is hereby incorporated by reference.

[0006] BACKGROUND

[0007] Messenger RNA (mRNA) has broad potential for a range of therapeutic and engineering applications. However, a fundamental limitation to its use is its relatively short half-life in biological systems.

[0008] It has long been assumed that cap-dependent translation of mRNA is superior to translation driven by internal ribosome entry sites (IRES), and this has limited research into possible designs for durable mRNA. Up to now, research on extending the lifetime of mRNA in biological cells has focused mainly on modifications to the mRNA cap that preserves translational functionality in a cap-dependent manner. Additional research has focused on nucleotides, inter-nucleotide linkages, and structural elements that preserve the 3’ end and the canonical poly-adenosine tail of linear mRNA.

[0009] Previous methods to increase the durability or stability of mRNA include the use of (a) pseudoknots, (b) more durable mRNA caps, (c) more durable nucleotides ligated to the 3’ region, (d) multiple poly-A regions or multiple, more durable cap elements, (e) RNA elements that preserve poly-adenylation of the 3’ end, (f) circularization of the mRNA, (g) modified nucleosides within the mRNA, and (h) modified inter-nucleotide linkages within the mRNA.

[0010] Circularization has significantly improved the durability of mRNA by eliminating available 5’ and 3’ ends, which are subject to degradation by exonucleases. This enhanced durability and allowed IRES-dependent translation to meet or exceedtranslation levels of cap-dependent linear mRNA for the first time. However, in contrast to these advantages of circular mRNA, linear forms of mRNA have maintained a reliance on 5’ cap-dependent translation and 3’ adenylation, and therefore have never matched the durability levels and expression levels of circular mRNA constructs. While modifications at various locations throughout linear mRNA have been tried, none have achieved levels of expression equivalent to the best varieties of canonical linear, cap-dependent mRNA. Thus, there remains a need to extend the duration of protein expression from full-length RNA messages.

[0011] SUMMARY

[0012] Provided herein are translatable linear mRNAs with nuclease resistant chemical modifications at both the 5’ and 3’ ends as a means to improve stability. Such modifications eliminate the canonical mRNA functionality of cap-dependent translation and therefore require IRES-dependent translation for the resulting mRNA constructs to be able to produce protein. Also provided herein are methods for construction and use of such linear mRNA.

[0013] Modifications to either end include modified internucleoside linkages nucleotides used within single nucleotides or oligonucleotides placed at both ends of a linear mRNA. Such modifications can be used in combination with modified nucleobases, non-nucleotide chemical structures, or any combination thereof.

[0014] The use of nuclease resistant modifications to the 5’ end and the 5’ cap has been of limited use as such modifications can reduce the functionality of structural elements within the mRNA or the mRNA cap and subsequently reduce mRNA translation in a cap-dependent manner. The use of nuclease resistant modifications at the 3’ end has been of limited use as such modifications can hinder poly-A adenylation which is the canonical method for protecting the 3’ end from exonuclease degradation. It is speculated that loss of the poly A tail also results in a loss of protection for the 5’ mRNA cap, subsequently leaving the 5’ end of a linear mRNA susceptible to de-capping and 5’ exonuclease degradation. As such, modifications at the 5’ and 3’ ends of mRNA resulted in lower translation rates and less stable mRNA constructs.

[0015] By eliminating the requirement of a functional cap in mRNA translation and a poly A tail and by using modifications that are highly, if not, fully resistant to exonuclease degradation, mRNA stability can be greatly enhanced. Subsequently,by increasing the stability of the mRNA in a significant way, IRES driven translation levels can meet or exceed those of mRNA that is translated in a cap-dependent manner.

[0016] Accordingly, the present technology provides a translatable, linear mRNA comprising of exonuclease resistant internucleoside linkage modifications at both the 5’ and 3’ ends (i.e. “linear RNA that contains modified 5’ and 3’ end segments” or LRS-MES).

[0017] In all embodiments, mRNA are translated into proteins in a cap-independent manner. This is due to the fact that exonuclease modifications will render any cap or cap-like structure non-functional with regard to translation. Additionally, some 5’ modifications are nucleotides or oligonucleotides that lack the ability to recruit ribosome binding to the 5’ end. For this reason, translation would be driven by internal ribosome entry sites and therefore categorized as IRES-dependent translation.

[0018] The present technology also provides a translatable, linear mRNA comprising of exonuclease resistant internucleoside linkage modifications at both the 5’ and 3’ ends (LRS-MES) wherein the ribonucleoside bases internal to the mRNA and not found within the 5’ or 3’ ends (i.e. “linear RNA segment” or LRS) can be, non-standard, modified nucleobases. This includes placement of modified nucleotides within the 5’ UTR (untranslated region), the 3’ UTR, the open reading frame (ORF) of a translatable gene, or any region not characterized as a 5’ or 3’ end segments (MES or 5’-MES and 3’-MES). Modifications in these regions impart endonuclease resistance or resistance against natural hydrolysis for the mRNA while also preserving translatability of the linear mRNA and ORF.

[0019] In some embodiments, there are a range of internucleoside linkage modifications that can be used in the nucleotides, oligonucleotides, or regions at or near the 5’ or 3’ ends (i.e. “modified 5’ and 3’ end segments”, 5’-MES and 3’-MES or MES). Each modification type provides a unique level of exonuclease resistance and resulting mRNA durability. The list of possible modifications can be one or more modified internucleoside linkages selected from the group consisting of a carbophosphonate, a methylphosphonate, an ethylphosphonate, a phenylphosphonate, a pyridyl carbophosphonate, an aminomethylphosphonate, an aminoethylphosphonate, a phosphonoacetate, a phosphonoformate, a thiophosphonoacetate, a methanephosphonamidate, a phosphoram idite, a phosphorodiamidate, a phosphorodithioate, a thionophosphate, analaninolphosphotriester, a S-methylthiourea, an inverted 3’ to 3’ internucleoside linkage, and inverted 5’ to 5’ internucleoside linkage, a peptide nucleic acid (PNA) linkage, a threose nucleic acid (TNA) linkage, or a morpholino nucleic acid (MNA) linkage. Various modifications at either end of the linear mRNA can be combined together or combined with any number of further modifications consisting of modified nucleotides, modified nucleobases, or non-nucleotide compounds.

[0020] In some embodiments, the linear RNA segment (LRS) that is not considered part of a modified end segment (MES) of any previous claim that contains one or more nucleobase modifications that retain translation of the mRNA. Such modifications must retain the ability to be decoded by tRNA and provide for protein translation for the overall mRNA construct (LRS-MES). Nucleobase modifications can one or more modifications selected from the group consisting of a pseudouridine, a N1-Methylpseudouridine, a 5-alkyl pyrimidine, a 5-o-alkyl pyrimidine, a 5-halo pyrimidine, a 7-deaza-guanosine, or a phosphorothioate internucleoside linkage located 5’ to a pyrimidine. Such modifications impart a level of endonuclease resistance to the overall construct.

[0021] In some embodiments, the modified 5’ and 3’ end segments (5’-MES and 3’-MES, or collectively MES) of any previous claim or the overall linear mRNA construct containing modified 5’ and 3’ end segments (LRS-MES) of any previous claim is resistant to an exonuclease as demonstrated by an assay. The assay will be exposure of the linear RNA to a 5’ or 3’ specific exonuclease. For example, XRN1 can be used to test the 5’ exonuclease resistance while RNaseR can be used to test 3’ exonuclease resistance. The proof of exonuclease resistance is wherein 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, 98% or more, 99% or more of the full length of each segment (MES or LRS-MES) remains after 24 hours of exposure to a 5’ and / or 3’ specific exonuclease.

[0022] In some embodiments, the linear mRNA contains one or more open reading frames (ORF), coding sequences (CDS), or genes. These ORF are translatable in the aforementioned linear mRNA construct. As described above, to ensure these ORF are translatable, there is a limitation for the types of modified nucleotides possibly added within the linear RNA segment that is designed to be endonuclease resistant.

[0023] In some embodiments a previously synthesized 5’ or 3’ modified end segment (MES) is attached to a previously synthesized linear RNA segment (LRS). This can be accomplished using a variety of conjugation methods. The most common form ofattachment is the use of enzymatic ligation to bind two oligonucleotides. Examples include the use of DNA ligase, RNA ligase 1, RNA ligase 2, and DNAzyme with oligonucleotide splints and / or oligonucleotide disruptors to enhance ligation efficiency. However, click chemistry or chemical conjugation can also be employed to attach an exonuclease resistant end structure (MES) to either end of a linear mRNA (LRS). Examples include the conjugation of an azide with an alkyne or other varieties of click chemistry or the use of sodium periodate to generate a dialdehyde that reacts with a nucleophile to form a covalent bond in the case of chemical ligation.

[0024] In some embodiments, the modified 5’ end segment (5’-MES) is incorporated into the linear RNA during synthesis of the linear RNA segment (LRS). For example, the modified 5’ end segment is a short oligonucleotide that can initiate or prime an In Vitro Transcription (IVT) reaction. This method of priming the synthesis of RNA with a custom modified oligonucleotide is known as co-transcriptional incorporation and is most often used to place special mRNA caps onto mRNA in an efficient manner. Therefore, this method of binding ensures high efficiency of addition of the modified 5’ end segment (5’-MES) to the overall linear RNA construct (LRS).

[0025] In some embodiments, the linear RNA segment (LRS) has a monophosphate, diphosphate, or adenosine diphosphate located at the 5’ end for the purposes of enzymatic ligation. This chemical structure at the 5’ end of the linear mRNA segment (LRS) can be added co-transcriptional ly or added via enzymatic modification to the terminal nucleotide after initial synthesis of the LRS.

[0026] In some embodiments, the linear RNA segment (LRS) of any previous claim has a cap, cap-like structure, or oligonucleotide that contains a functional clickchemistry group co-transcriptionally added during in vitro transcription to produce a linear RNA with a 5’ click chemistry group to allow binding, ligation, click chemistry or covalent bonding to a 5’ specific end modified segment (5’-MES).

[0027] In some embodiments, the previously synthesized modified end segments (MES) of any previous claim contain a 5’ monophosphate, diphosphate, adenosine diphosphate or functional click chemistry group prior to binding, ligation, click chemistry or covalent bonding of a previously synthesized modified end segment (MES) with previously synthesized linear RNA segment (LRS) of any previous claim. In cases where binding of two ribonucleotides or oligonucleotides is enzymatic in nature, the available 5’ end of one of the nucleotides must have an enzymatically reactive 5’ end. Notably, the 5’ end must contain a monophosphate, diphosphate, oradenosine diphosphate (common to an adenylated oligonucleotide). These various 5’ ends are reactive when binding of two ribonucleotides or oligonucleotides is mediated by a ligase (such as a DNA ligase, RNA ligase or similar ligase).

[0028] In some embodiments, the previously synthesized modified end segments (MES) of any previous claim that contains a terminal, unreactive nucleotide or chemical structure such that it can only be bonded, ligated, click chemistry linked, or covalently bonded as a single unit at any particular free / reactive end of a previously synthesized linear RNA segment (LRS) of any previous claim. This single use reactivity prevents self-reactivity and formation of rings or concatemers of the modified end segments (MES). This only applies to enzymatic ligation as chemical boding or click chemistry have strict bonding requirements. Chemical structures that work in this way are dideoxy nucleotides that lack a 3’ hydroxyl group as well as other modified nucleotides that have a chemical structure bound to the 3’ position.

[0029] In some embodiment, exonucleases are used to purify the final translatable linear RNA that contains 5’ and 3’ modified end segments (LRS-MES). Due to exonuclease resistance of the modified end segments (MES) only linear RNA that does not contain a modified end segment will be degraded when exposed to both 5’ and 3’ exonucleases. This leaves behind high purity mRNA of the desired design construct with modified end segments at both ends.

[0030] In one embodiment, the present technology is directed to a method of expressing protein in a cell, said method comprising transfecting a translatable linear RNA that contains 5’ and 3’ end segments (LRS-MES) provided herein into the cell. In some aspects, the present technology provides a cell comprising any one of the modified mRNAs provided herein. In some embodiments, the cell is a mammalian cell.

[0031] In some embodiments, the present technology provides an mRNA as described above (LRS-MES) for use in a therapeutic or diagnostic method, in particular for protein production in an in vivo setting. The present technology provides a pharmaceutical composition comprising of a mRNA described above.

[0032] In some aspects, the present technology provides a method of treating a disease in a subject in need thereof comprising introducing a therapeutic dose of any one or more of the modified mRNAs (LRS-MES) provided herein, a delivery agent provided herein, a cell provided herein, or a composition provided herein into the subject, wherein the open reading frame of the modified mRNA encodes a protein. Insome aspects, the present technology provides any one of the modified mRNAs provided herein, a delivery agent provided herein, a cell provided herein, or a composition provided herein for use in treating a disease in a subject in need thereof. In some embodiments, the subject is a human. In some embodiments, the subject is a dog. In some aspects, the present technology provides a kit comprising a pharmaceutical composition provided herein, a device for administering the pharmaceutical composition to a subject, and instructions for administering the pharmaceutical composition to a subject.

[0033] In some embodiments, the present technology provides a kit comprising of modified end segments (MES) of any previous claim for the purposes of binding, ligation, covalent bonding, or click chemistry of a previously synthesized modified end segment (MES) to a translatable linear RNA (LRS) that contains an IRES.

[0034] Definitions

[0035] As used herein, “LRS-MES” is an abbreviation for Translatable Linear RNA Segment that contains Modified 5’ and 3’ End Segments. This term represents a completed construct as defined in the main claims of this technology.

[0036] As used herein, “LRS” is an abbreviation for Linear RNA Segment or internal Linear RNA Segment. This term represents the part of the construct that contains the translatable genes and RNA elements needed to initiate translation of the genes. Modifications to this segment of the final construct are independent of modification to end segments.

[0037] As used herein, “MES” is an abbreviation for Modified End Segment(s). This term represents one or both ends (5’ and / or 3’) of the final RNA construct either when attached to the LRS or prior to attachment, such as during synthesis. Modifications one of these segments can be independent of modification to other end segments (such as with the 5’ end segment as compared to 3’ end segment).

[0038] As used herein, “5’-MES” is an abbreviation for Modified 5’ End Segment. This term represents a modified nucleotide, oligonucleotide, or compound that can be attached or has been attached at the 5’ end of a linear RNA for the purposes of protecting it from exonuclease degradation.

[0039] As used herein, “3’-MES” is an abbreviation for Modified 3’ End Segment. This term represents a modified nucleotide, oligonucleotide that can be attached or hasbeen attached at the 3’ end of a linear RNA for the purposes of protecting it from exonuclease degradation.

[0040] As used herein, “exonuclease resistance” refers to the ability to withstand degradation of the RNA via nucleases that degrade only from the end of an RNA in either a 5’ or 3’ specific manner. For example, 5’ exonucleases sequentially cleave single nucleotides from the 5’ end of a linear RNA while 3’ exonucleases cleave sequentially single nucleotides from the 3’ end of a linear RNA. For the purposes of this technology exonuclease resistance is further qualified by an assay in which linear RNA is exposed to an exonuclease and more than 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, 98% or more, 99% or more of the full length of the RNA being exposed to exonucleases remains present after 24 hours of exposure. The test for resistance can be performed in a 5’ exonuclease specific manner where the RNA is exposed to only a 5’ exonuclease. Similarly, the test for resistance can be performed in a 3’ exonuclease specific manner where the RNA is exposed to only a 3’ exonuclease. Additionally, the test for resistance can be performed where the RNA is exposed to both 5’ exonuclease and 3’ exonuclease at the same time demonstrating exonuclease resistance from both end simultaneously. Assays to quantify initial and remaining RNA in order to validate exonuclease resistance include, but are not limited to capillary electrophoresis, gel electrophoresis, high performance liquid chromatography (HPLC), and liquid chromatography combined with mass spectrometry (LC-MS).

[0041] As used herein, a "functional" biological molecule is a biological molecule in a form in which it exhibits a property and / or activity by which it is characterized.

[0042] As used herein, a “nucleotide” refers to an organic molecule comprising a 1) a nucleoside comprising a sugar covalently bonded to a nitrogenous base (nucleobase); and 2) a phosphate group that is covalently bonded to the sugar of the nucleoside.

[0043] As used herein, a “nucleic acid,” or “oligonucleotide” refers to an organic molecule comprising two or more covalently bonded nucleotides. Nucleotides in a oligonucleotide are typically joined by a phosphodiester bond, in which the 3' carbon of the sugar of a first nucleotide is linked to the 5' carbon of the sugar of a second nucleic acid by a bridging phosphate group. Typically, the bridging phosphate comprises two non-bridging oxygen atoms, which are bonded only to a phosphorus atom of the phosphate, and two bridging oxygen atoms, each of which connects the phosphorus atom to either the 3' carbon of the first nucleotide or the 5' carbon of thesecond nucleotide. In a nucleic acid sequence describing the order of nucleotides in a nucleic acid, a first nucleotide is said to be 5' to (upstream of) a second nucleotide if the 3' carbon of first nucleotide is connected to the 5' carbon of the second nucleotide. Similarly, a second nucleotide is said to be 3' to (downstream of) a first nucleotide if the 5' carbon of the second nucleotide is connected to the 3' carbon of the first nucleotide. Nucleic acid sequences are typically read in 5'->3' order, starting with the 5' nucleotide and ending with the 3' nucleotide.

[0044] As used herein, a “nucleobase” (or nitrogenous base) is a crucial organic compound in DNA and RNA, acting as the "letters" (A, T, C, G, U) that carry genetic information, linking with sugars and phosphates to form nucleotides, the building blocks of nucleic acids, dictating protein synthesis and life's instructions.

[0045] As used herein, “RNA” is an abbreviation for RiboNucleic Acid. An RNA molecule that can be translated is referred to as a messenger RNA, or mRNA. An RNA sequence encodes a gene through codons. A codon refers to a group of three nucleotides within a nucleic acid, such as RNA, sequence. An anticodon refers to a group of three nucleotides within a nucleic acid, such as a transfer RNA (tRNA), that are complementary to a codon, such that the codon of a first nucleic acid associates with the anticodon of a second nucleic acid through hydrogen bonding between the bases of the codon and anticodon. For example, the codon 5'-AUG-3' on an mRNA has the corresponding anticodon 3'-UAC-5' on a tRNA. During translation, a tRNA with an anticodon complementary to the codon to be translated associates with the codon on the mRNA, generally to deliver an amino acid that corresponds to the codon to be translated, or to facilitate termination of translation and release of a translated polypeptide from a ribosome.

[0046] As used herein, a “messenger RNA” (“mRNA”) refers to a nucleic acid comprising an open reading frame encoding a gene produce, such as a protein. An mRNA may also comprise a 5' untranslated region (5' UTR) that is 5' to (upstream of) the open reading frame, and a 3' untranslated region that is 3' to (downstream of) the open reading frame or coding sequence of the gene. A mRNA may also comprise a poly-A region that is 3' to the open reading frame. A mRNA may also comprise a 5' cap at the 5' end of the mRNA

[0047] As used herein, a “canonical mRNA” refers to messenger RNA that follows the "standard" or most common rules of gene expression, featuring a typical 5' 7-methylguanosine (m7G) cap and 3' poly-A tail, being translated by ribosomes in astraightforward codon-by-codon manner, and undergoing standard decay (deadenylation / decapping). Polypeptide or protein production from a canonical mRNA is performed via a cap-dependent mechanism where the mRNA cap is responsible for attracting ribosomes needed to decode the RNA sequence. It represents the well-understood, baseline model of mRNA, contrasting with "non-canonical" mRNAs that use alternative processing, translation, or decay mechanisms.

[0048] As used herein, “ribosome” or “ribosomes” refer to macromolecular biological machines found within all cells that perform messenger RNA translation. Ribosomes link amino acids together in the order specified by the codons of messenger RNA molecules to form polypeptide chains. Ribosomes consist of two major components: the small and large ribosomal subunits. Each subunit consists of one or more ribosomal RNA molecules and many ribosomal proteins (r-proteins). The ribosomes and associated molecules are also known as the translational apparatus.

[0049] As used herein, “transfer ribonucleic acid” or its abbreviation “tRNA” refer to an adaptor molecule composed of RNA, typically 76 to 90 nucleotides in length (in eukaryotes). In a cell, it provides the physical link between the genetic code in messenger RNA (mRNA) and the amino acid sequence of proteins, carrying the correct sequence of amino acids to be combined by the protein-synthesizing machinery, the ribosome. Each three-nucleotide codon in mRNA is complemented by a three-nucleotide anticodon in tRNA. As such, tRNAs are a necessary component of translation, the biological synthesis of new proteins in accordance with the genetic code.

[0050] As used herein, an “ORF” is an abbreviation for “open reading frame”. ORF refers to a nucleic acid sequence comprising a coding sequence, that leads to the production of the protein when the open reading frame is translated. The nucleic acid sequence may be an RNA sequence, in which case translation of the RNA sequence produces a polypeptide with the amino acid sequence of the protein. An ORF is a continuous stretch of RNA codons (three-nucleotide units) that starts with a start codon (like AUG) and ends with a stop codon (UAA, UAG, UGA), containing no other stop codons in between, representing a potential protein-coding sequence.

[0051] As used herein, an “CDS” is an abbreviation for “coding sequence”. CDS is another description for an ORF.

[0052] As used herein, “translated” or “translatable” or “translation” refers to the process in which the RNA coding sequence is used to direct the production of apolypeptide or protein. The first step in translation is initiation, in which a ribosome associates with an mRNA, and a first transfer RNA (tRNA) carrying a first amino acid associates with the first codon, or START codon. The next phase of translation, elongation, involves three steps. First, a second tRNA with an anticodon that is complementary to codon following the START codon, or second codon, and carrying a second amino acid, associates with the mRNA. Second, the carbon atom of terminal, non-side chain carboxylic acid moiety of the first amino acid reacts with the nitrogen of the terminal, non-side chain amino moiety of the second amino acid carried, forming a peptide bond between the two amino acids, with the second amino acid being bound to the second tRNA, and the first amino acid bound to the second amino acid, but not the first tRNA. Third, the first tRNA dissociates from the mRNA, and the ribosome advances along the mRNA, such that the position at which the first tRNA associated with the ribosome is now occupied by the second tRNA, and the position previously occupied by the second tRNA is now free for an additional tRNA carrying an additional amino acid to associate with the mRNA. These three steps of 1 ) association of a tRNA carrying amino acid, 2) formation of a peptide bond, which adds an additional amino acid to a growing polypeptide, and 3) advancement of the ribosome along the mRNA, continue until the ribosome reaches a STOP codon, which results in termination of translation. Generally, tRNAs that associate with STOP codons do not carry an amino acid, so the association of a tRNA that does not carry an amino acid during the elongation step results in cleavage of the bond between the polypeptide and the tRNA carrying the final amino acid in the polypeptide, such that the polypeptide is released from the ribosome. Alternatively, ribosomes may dissociate from the mRNA and release the polypeptide if no tRNA associates with the STOP codon.

[0053] As used herein, “untranslated region”, or its abbreviation “UTR”, refer to either of two sections, one on each side of a coding sequence on a strand of mRNA. If it is found on the 5' side, it is called the 5' UTR (or leader sequence), or if it is found on the 3' side, it is called the 3' UTR (or trailer sequence). The 5' UTR is upstream from the coding sequence. Within the 5' UTR is a sequence that is recognized by the ribosome which allows the ribosome to bind and initiate translation. The 3' UTR is found immediately following the translation stop codon. The 3' UTR plays a critical role in translation termination as well as post-transcriptional modification.

[0054] As used herein, “Internal ribosome entry site” or its abbreviation “IRES” refer to a specific RNA sequence in the 5' untranslated region (5'-UTR) of certain messengerRNAs (mRNAs) that allows ribosomes to initiate protein synthesis internally, without needing the usual 5' cap-dependent mechanism, enabling translation during cellular stress or for multiple proteins from one mRNA. These diverse sequences form structures that directly bind ribosomes or recruit them with help from IRES TransActing Factors (ITAFs), crucial for viruses and some cellular genes under stress. Common examples of IRES used in protein translation are CrPV IGR (intergenic region from Cripavirus), EMCV (from Encephalomyocarditis virus), CVB3 (from Coxsackie B virus), iHRV-B3 (from Human Rhinovirus B3), and Apt-elF4G sequences (aptamer that attracts elF4g protein that is part of ribosome initiation complex).

[0055] As used herein, “cap-independent” or “cap-independent translation” refers to a way for ribosomes to start making protein from mRNA without needing the 5' cap of a canonical mRNA structure, often using an Internal Ribosome Entry Site (IRES), allowing translation during cellular stress, viral infection, or for specific genes like tumor suppressors, bypassing the normal cap-dependent pathway

[0056] As used herein, a “nuclease” refers to a type of enzyme that cleaves the chains of nucleotides in nucleic acids into smaller units.

[0057] As used herein, an “exonuclease” refers to a type of enzyme that cuts and removes nucleotides, one by one, from the ends (either the 3' or 5' end) of a RNA strand

[0058] As used herein, an “endonuclease” refers to a type of enzyme that cuts phosphodiester bonds inside a nucleic acid chain (RNA), breaking it into shorter pieces, unlike exonucleases which work from the ends.

[0059] As used herein, “de-capping” or “mRNA decapping” refers to the cellular process of enzymatically removing the protective 7-methylguanosine (m7G) "cap" from the 5' end of messenger RNA (mRNA), which signals the start of its degradation, halting translation and marking the transcript for destruction by 5' to 3' exonucleases, a fundamental step in controlling gene expression and mRNA turnover

[0060] As used herein, “nuclease resistant nucleotides” refer to modified DNA / RNA building blocks with altered sugar or phosphate groups, making them stable against natural enzymes (nucleases) that break down nucleic acids, crucial for therapeutic applications like antisense drugs. Common examples include Phosphorothioates (PS) for backbone stability, 2'-O-Methyl (2'0Me) for enhanced RNA stability, and backboneswapping structures like Morpholinos, allowing longer action in biological systems by preventing rapid degradation.As used herein, a “modified nucleotide” refers to a nucleotide with a structure that is not the canonical structure of an adenosine nucleotide, cytosine nucleotide, guanosine nucleotide, or uracil nucleotide. A canonical structure of a molecule refers to a structure that is generally known in the art to be the structure referred to by the name of the molecule. As used herein, a “modified nucleotide” may also refer to a nucleotide which comprises a nucleobase or sugar (ribose or deoxyribose) that is not canonical. A “modified nucleotide” may also refer to a nucleotide that is covalently linked to a second nucleotide through an internucleoside linkage that is not a canonical internucleoside linkage (i.e., not a phosphodiester internucleoside linkage, e.g., a phosphorothioate internucleoside linkage).

[0061] As used herein, an “internucleoside linkage” (or internucleotide linkage) refers to the chemical bond connecting individual nucleosides (building blocks) to form a nucleic acid polymer (DNA or RNA), typically a phosphodiester bond, linking the 3' carbon of one sugar to the 5' carbon of the next via a phosphate group, creating the sugar-phosphate backbone that carries the genetic code and is crucial for genetic function and therapeutic potential

[0062] As used herein, a “modified internucleoside linkage” refers to a chemical alteration of the natural phosphodiester bond (-O-P(O)2-O-) connecting nucleotides in DNA / RNA, often replacing oxygen with atoms like sulfur (phosphorothioate) or forming different structures (amide, phosphonate).

[0063] As used herein, a “reverse oriented internucleoside linkage”, also known as an inverted linkage, refers to a non-natural chemical bond in an oligonucleotide (DNA or RNA strand) where the orientation of the sugar-phosphate backbone is intentionally reversed compared to the standard biological 3' to 5' linkage. In a normal nucleic acid strand, nucleotides are linked via phosphodiester bonds between the 3' -hydroxyl (3'-OH) group of one sugar and the 5'-phosphate (5'-P) group of the next sugar. This creates a natural directionality, or polarity, typically read as 5' — 3'. A reverse oriented linkage changes this natural orientation. For example, a common modification involves creating a 3'-3' linkage at one end of the strand, or less commonly, a 5'-5' linkage. This structural change disrupts the uniform polarity of the molecule.

[0064] As used herein, the term "alkyl" is meant to refer to a saturated hydrocarbon group which is straight-chained or branched. Example alkyl groups include methyl (Me), ethyl (Et), propyl (e.g., n-propyl and isopropyl), butyl (e.g., n-butyl, isobutyl, t-butyl), pentyl (e.g., n-pentyl, isopentyl, neopentyl), and the like. An alkyl group cancontain from 1 to about 20, from 2 to about 20, from 1 to about 12, from 1 to about 8, from 1 to about 6, from 1 to about 4, or from 1 to about 3 carbon atoms.

[0065] As used herein, "alkoxy" or “o-alkyl” refers to a hydrocarbon group attached through an ester bond.. Example alkoxy groups include methoxy, ethoxy, propoxy (e.g., n-propoxy and isopropoxy), t-butoxy, and the like.

[0066] As used herein, "halo" or "halogen" refers to fluoro, chloro, bromo, and iodo chemical side groups.

[0067] As used herein, “bound”, “covalently bonded”, "conjugated," “ligated,” "linked," "attached,” "bonded,” and "tethered," when used with respect to two or more moieties, means that the moieties are physically associated or connected with one another, either directly or via one or more additional moieties that serves as a linking agent, to form a structure that is sufficiently stable so that the moieties remain physically associated under the conditions in which the structure is used, e.g., physiological conditions. The terms can be used in the current tense of any of the above terms and refer to the act of attaching one moiety to another moiety.

[0068] As used herein, a “ligase” refers to an enzyme that is capable of forming a covalent bond between two nucleotides, and the process of “ligation” refers to the formation of the covalent bond between the two nucleotides.

[0069] As used herein, “click-chemistry” refers to an approach to chemical synthesis that is used to join two molecules. The use of the word “click” refers to an emphasis on efficiency and simplicity. To link two molecular components, each is first fitted with appropriate functional groups, such as azide and alkyne groups. These components are then "clicked" together in a process that is highly favorable and which tolerates many functional groups that might complicate other coupling processes.

[0070] As used herein, "in vitro" refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, in a Petri dish, etc., rather than within an organism (e.g., animal, plant, or microbe).

[0071] As used herein, “In vitro transcription” or its abbreviation “IVT” refer to a lab technique that synthesizes RNA from a DNA template in a test tube, outside a living cell, using enzymes like T7 RNA polymerase to create large quantities of specific RNA for research, diagnostics, and therapeutics, including mRNA vaccines. It's a key method for producing research-grade RNA, probes, or therapeutic mRNA by controlling the template, enzymes, and conditions to generate custom RNA molecules with high yield and purityAs used herein, “RNA polymerase” (abbreviated RNAP or RNApol) refers to, or more specifically DNA-directed / dependent RNA polymerase (DdRP), is an enzyme that catalyzes the chemical reactions that synthesize RNA from a DNA template. Common examples of RNAP that are used in IVT synthesis of RNA include T7, T3, and SP6 RNA bacteriophage polymerases.

[0072] As used herein, a “structural element” refers to a nucleic acid sequence comprising at least two nucleotides that are capable of interacting with each other to form a secondary structure in a nucleic acid comprising the structural sequence. Structural elements impart functionality into the RNA such as enhanced translation or stability.

[0073] As used herein, a “pseudoknot” refers to a nucleic acid secondary structure containing at least two stem-loop structures in which half of one stem is intercalated between the two halves of another stem.

[0074] As used herein, “poly-adenylation” or “poly A tail” refer to the addition of a poly(A) tail to an RNA transcript, typically a messenger RNA (mRNA). The poly(A) tail consists of multiple adenosine monophosphates; in other words, it is a stretch of RNA that has only adenine bases. In eukaryotes, polyadenylation is part of the process that produces mature mRNA for translation.

[0075] As used herein, “circular mRNA” or its abbreviation “circRNA” refer to a type of single-stranded RNA which, unlike linear RNA, forms a covalently closed continuous loop. In circular RNA, the 3' and 5' ends normally present in an RNA molecule have been joined together.

[0076] As used herein, “aptamer” refers to a nucleic acid comprising a secondary structure that is capable of binding to a target molecule.

[0077] As used herein, “RNA interference” or its abbreviation “RNAi” refer to a biological process in which RNA molecules are involved in sequence-specific suppression of gene expression by RNA to RNA interactions, through translational or transcriptional repression. Additional terms that fall into the scientific field of RNAi include “siRNA” (small interfering RNA), “miRNA” (microRNA), “shRNA” (short hairpin RNA), and ASO (antisense applications).

[0078] As used herein, “endogenous” refers to the property of originating or developing from within an organism, tissue, or cell. For example, endogenous substances, and endogenous processes are those that originate within a living system (e.g. an organism or a cell).As used herein, “transfected” or the act of “transfection” refer to the process of artificially introducing foreign genetic material (like DNA or RNA) into eukaryotic (animal / plant) cells, bypassing viral infection, to study gene function, produce proteins, or modify the cell's properties for research, therapy (like gene therapy), or bioproduction. It's a fundamental technique in molecular biology that uses physical (electroporation), chemical (lipids, polymers), or biological (viral vectors) methods to deliver the desired nucleic acid across the cell membrane.

[0079] As used herein, a “nanoparticle” refers to a RNA encapsulation vehicle for the targeted delivery and controlled release of therapeutic agents. Nanoparticles refer to a large family of materials both organic and inorganic. Each material has uniquely tunable properties and thus can be selectively designed for specific applications. Examples of materials used for encapsulation include polymers, dendrimers, inorganic nanocrystals, organic nanocrystals, liposomes, viral vectors, albumin and peptides.

[0080] As used herein, an “antigen” refers to a molecule, or portion thereof, that can elicit an immune response. An antigen can bind to a specific antibody or cell receptor such as a receptor on a T cell or other immune cell. The presence of antigens in the body may trigger an immune response. Antigens can be proteins, peptides (amino acid chains), polysaccharides (chains of simple sugars), lipids, or nucleic acids. Antigens exist on normal cells, cancer cells, parasites, viruses, fungi, and bacteria. Vaccines are examples of antigens in an immunogenic form, which are intentionally administered to a recipient to induce the memory function of the adaptive immune system towards antigens of the pathogen invading that recipient. The vaccine for seasonal influenza is a common example.

[0081] As used herein, an “adjuvant” refers to a substance that increases or modulates the immune response to a vaccine. The word "adjuvant" comes from the Latin word adjuvare, meaning to help or aid. "An immunologic adjuvant is defined as any substance that acts to accelerate, prolong, or enhance antigen-specific immune responses when used in combination with specific vaccine antigens.

[0082] As used herein, “chimeric antigen receptors” or its abbreviation “CAR” or “CARs” refers to receptor proteins that have been engineered to give cells the new ability to target a specific antigen. The receptors are chimeric in that they combine both antigen-binding and cell activating functions into a single receptor. CARs are most commonly applied to T cells generating what is called a CAR-T cell. Other termsto describe CAR include chimeric immunoreceptors, chimeric T cell receptors, or artificial T cell receptors.

[0083] As used herein, “immune checkpoint” or “checkpoint therapy” refers to a form of immunotherapy. The therapy targets immune checkpoints, key regulators of the immune system that when stimulated can enhance or dampen the immune response to an immunologic stimulus. Some cancers can protect themselves from attack by stimulating immune checkpoint targets. Checkpoint therapy can block inhibitory checkpoints, restoring immune system function. Inhibitory checkpoint molecules are targets for cancer immunotherapy due to their potential for use in multiple types of cancers. Currently approved checkpoint inhibitors block CTLA4, PD-1 and PD-L1.

[0084] As used herein, “genome editing” refers to a type of genetic engineering in which DNA is inserted, deleted, modified or replaced in the genome of a living organism. Unlike early genetic engineering techniques that randomly insert genetic material into a host genome, genome editing targets the insertions to site-specific locations Currently there are four families of editing technologies: meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector-based nucleases (TALEN), and the clustered regularly interspaced short palindromic repeats (CRISPR / Cas9).

[0085] As used herein, "therapeutic agent" refers to any agent that, when administered to a subject, has a therapeutic, and / or prophylactic effect and / or elicits a desired biological and / or pharmacological effect.

[0086] As used herein, "animal" refers to any member of the animal kingdom. In some cases , "animal" refers to humans at any stage of development. In some cases, "animal" refers to non-human animals at any stage of development. In certain cases, the non-human animal is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, or a pig). In some cases , animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and worms. In some cases , the animal is a transgenic animal, genetically-engineered animal, or a clone. As used herein, "subject" or "patient" refers to any organism to which a composition in accordance with the present technology may be administered, e.g., for experimental, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans) and / or plants.As used herein, “preventing” a disease or medical condition means reducing the likelihood, to any degree, of a subject developing, acquiring, or progressing the disease or medical condition or any symptoms associated therewith.

[0087] As used herein, “treating” a disease or medical condition means reducing or alleviating, in whole or to any degree, a disease or medical condition or any symptom associated therewith that the subject has.

[0088] The present technology also can be summarized with the following listing of features.

[0089] 1. A linear RNA molecule comprising (i) a 5’ modified end segment (5’-MES), (ii) a 3’ modified end segment (3’-MES), and (iii) an internal ribosome entry site (IRES); wherein the 5’-MES reduces exonuclease-mediated degradation of the linear RNA molecule from its 5’ end and the 3’-MES reduces exonuclease-mediated degradation of the linear RNA molecule from its 3’ end.

[0090] 2. The linear RNA molecule of feature 1, wherein the linear RNA molecule is translatable in a cap-independent manner.

[0091] 3. The linear RNA molecule of feature 1, wherein the linear RNA molecule is not translatable in a cap-dependent manner.

[0092] 4. The linear RNA molecule of any of the preceding features, wherein the 5’-MES and / or the 3’-MES comprise one or more internucleoside linkages selected from the group consisting of a carbophosphonate, a methylphosphonate, an ethylphosphonate, a phenylphosphonate, a pyridyl carbophosphonate, an aminomethylphosphonate, an aminoethylphosphonate, a phosphonoacetate, a phosphonoformate, a thiophosphonoacetate, a methanephosphonamidate, a phosphoramidite, a phosphorodiamidate, a phosphorodithioate, a thionophosphate, an alaninolphosphotriester, an S-methylthiourea, an inverted 3’ to 3’ internucleoside linkage, an inverted 5’ to 5’ internucleoside linkage, a peptide nucleic acid (PNA) linkage, a threose nucleic acid (TNA) linkage, and a morpholino nucleic acid (MNA) linkage.

[0093] 5. The linear RNA molecule of any of the preceding features, further comprising one or more modifications to an internucleoside linkage or to a base between the 5’-MES and the 3’-MES, said one or more modifications reducing endonuclease-mediated degradation of the linear RNA molecule.

[0094] 6. The linear RNA molecule of feature 5, wherein the one or more modifications between the 5’-MES and the 3’-MES are selected from the group consisting of apseudouridine, an N1 -methylpseudouridine, a 5-alkyl pyrimidine, a 5-O-alkyl pyrimidine, a 5-halo pyrimidine, a 7-deaza-guanosine, and a phosphorothioate internucleoside linkage located 5’ to a pyrimidine, and wherein the linear RNA molecule is translatable.

[0095] 7. The linear RNA molecule of any of the preceding features that is resistant to exonuclease degradation by 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, 98% or more, or 99% or more compared to a linear RNA molecule having an identical nucleotide sequence but lacking said 5’-MES and said 3’-MES, and lacking a cap, wherein said exonuclease degradation is measured using an in vitro assay comprising exposure to a 5’ exonuclease and / or a 3’ exonuclease selected from the group consisting of XRN1, RNase R, and an exosome complex.

[0096] 8. The linear RNA molecule of any of the preceding features that is resistant to exonuclease degradation by 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, 98% or more, or 99% or more compared to a second linear RNA molecule having an identical nucleotide sequence to said linear RNA molecule but lacking said 5’-MES and said 3’-MES and instead comprising a 5’ 7-methylguanosine (m7G) linked to a first nucleotide by a 5'-5' triphosphate internucleoside linkage and a 3' poly adenosine tail, wherein said exonuclease degradation is measured using an in vitro assay comprising exposure to a decapping enzyme, a 5’ exonuclease, and a 3’ exonuclease selected from the group consisting of RppH, XRN1, and RNase R.

[0097] 9. The linear RNA molecule of any of the preceding features that is degraded by 1% or less, 2% or less, 5% or less, 10% or less, 20% or less, 30% or less, 40% or less, or 50% or less after in vitro exposure to a 5’ and / or a 3’ exonuclease selected from the group consisting of XRN1, RNase R, and an exosome complex for 12 hours at 37°C.

[0098] 10. The linear RNA molecule of any of the preceding features, further comprising one or more translatable coding sequences.

[0099] 11. A pharmaceutical composition comprising the linear RNA molecule of any of the preceding features, or a pharmaceutically acceptable salt or derivative thereof, and one or more excipients.

[0100] 12. A delivery vehicle comprising the linear RNA molecule of any of features 1 -10 packaged in or with a polymeric complex or nanoparticle, liposome, or lipid carrier.13. A kit for making the linear RNA molecule of any of features 1 -10, the kit comprising a 5’-MES and a 3’-MES, and optionally one or more reagents for bonding the 5’-MES and the 3’-MES to a user-supplied linear RNA containing an IRES.

[0101] 14. A method of making the linear RNA molecule of any of features 1 -10, the method comprising the steps of:

[0102] (a) providing a 5’-MES, a 3’-MES, and a linear RNA segment comprising an IRES;

[0103] (b) covalently bonding the 5’-MES to a 5’ end of the linear RNA segment; and (c) covalently bonding the 3’-MES to a 3’ end of the linear RNA segment, thereby making the linear RNA molecule of any of the preceding features.

[0104] 15. The method of making of feature 14, whereby the covalently bonding of (b) and / or (c) comprises use of a ligase, click chemistry, or in vitro transcription.

[0105] 16. The method of making of feature 14 or feature 15, further comprising adding a 5’ monophosphate, 5’ diphosphate, a 5' adenosine diphosphate, or a 5’ click chemistry group to either a 5’-MES, a 3’-MES, or a linear RNA segment comprising an IRES.

[0106] 17. The method of making of any of features 14-16, wherein the linear RNA segment further comprises a coding sequence.

[0107] 18. The method of any of features 14-17, further comprising treating the product of (c) with an exonuclease to remove RNA molecules that do not contain a 5’-MES or a 3’-MES.

[0108] 19. A method of transfecting a cell, the method comprising introducing the linear RNA molecule of any of features 1 -10 into a cell.

[0109] 20. The method of feature 19, wherein the linear RNA molecule comprises a coding sequence, and whereby a polypeptide is expressed in the cell from the coding sequence.

[0110] 21. The method of feature 19 or feature 20, wherein the linear RNA molecule has a half-life in the cell of at least 12 hours, at least 18 hours, at least 24 hours, at least 48 hours, at least 72 hours, at least 4 days, at least 5 days, at least 7 days, at least 10 days, or at least 14 days.

[0111] 22. The method of feature 20, whereby a polypeptide is expressed in the cell from the coding sequence, and whereby a rate of expression in the cell of the polypeptide declines with a half-life of at least 12 hours, at least 18 hours, at least 24 hours, atleast 48 hours, at least 72 hours, at least 4 days, at least 5 days, at least 7 days, at least 10 days, or at least 14 days.

[0112] 23. The method of any of features 19-22, wherein the linear RNA molecule of any of features 1 -10, or the pharmaceutical composition of feature 11 , or the delivery vehicle of feature 12 is administered to a human or non-human mammalian subject.

[0113] 24. The method of feature 23, wherein the human or non-human mammalian subject has or is suspected of having a disease or medical condition, and wherein the disease or medical condition is at least in part treated or prevented.

[0114] 25. The method of feature 24, wherein the disease or medical condition is selected from the group consisting of a cancer, a neoplastic disease, an infectious disease, a genetic disease, a metabolic disease, an autoimmune disease, an ocular disease, a cardiovascular condition, a wound, a neurological condition, an immunological condition, or a dermatological condition.

[0115] BRIEF DESCRIPTION OF THE DRAWINGS

[0116] Fig. 1 is a schematic illustration of an embodiment of a linear RNA molecule 100 according to the present technology. The 5’ end is terminated with 5’ modified end segment (5’-MES) 110, and the 3’ end is terminated with 3’ modified end segment (3’-MES) 140. Internal ribosome entry site 120 lies between the 5’-MES and coding sequence 130.

[0117] Fig. 2 is an image of a polyacrylamide gel showing degradation of 5’ and 3’ end-modified RNA with the indicated concentrations of canine plasma. Mock 32 Control had AAA modifications at both ends using phosphodiester linkages, while Mock 32 End Modified had AAA modifications at both ends using methyl-phosphonate linkages. See Example 1.

[0118] Fig. 3 is an image of a polyacrylamide gel showing degradation of 5’ and 3’ end-modified RNA at the indicated times in hours (ON = 16 hrs). Control and End Modified were same as Mock 32 Control and Mock 32 End Modified in Fig. 1. Full Modified had the same end modifications as End Modified plus internal phosphorothioate linkages. See Example 1.

[0119] Fig. 4 shows an image of the band densities of RNA constructs before and after RppH / XRN-1 digestion on a 1 % agarose gel stained with SYBR Green. See Example 2.Fig. 5 shows RNase R digestion 3’-MES constructs. Reactions were stopped and run on an agarose gel. RNase R digested the control oligonucleotide in 1 hour, but the 3’-MES protected RNA remained intact after 2 hours, demonstrating the resistance of modified oligonucleotides.

[0120] Fig. 6 shows the ligation of a 3’-MES to the 3’ end of a linear RNA transcript visualized on an agarose gel.

[0121] Figs. 7A-7B show the results of analysis of control and ligated RNA from Fig. 6 using an RNA Nano chip. Fig. 7A is a gel electropherogram overlay of Ligase (-) and Ligase (+) samples. Fig. 7B is an enlarged view of the area of the gel in 7A surrounding the peak area. A 35 nucleotide size increase was found, showing successful ligation of the 3’MES oligonucleotide to the RNA.

[0122] DETAILED DESCRIPTION

[0123] The present technology provides linear mRNA molecules or constructs having extended half-life or duration of protein expression in a cell, with stability achieved by placing exonuclease-resistant chemical moieties at or near both the 5’ and 3’ ends of the construct. The linear RNA constructs of the present technology can be used like endogenous mRNA in a living cell, but with vastly increased stability, resulting in higher and / or more sustained levels of protein expression.

[0124] In general, mRNA has a very short half-life due to nuclease susceptibility (5’ and 3’ exonuclease, de-capping and endonuclease activity). The bulk of the degradation process is driven by exonuclease activity at either end (5’ or 3’) of the mRNA.

[0125] Endogenous mRNA and viral mRNA have evolved natural methods to enhance construct durability and to enhance protein expression longevity. These methods include secondary and tertiary structures at the mRNA ends that slow exonuclease mediated degradation of linear mRNA. Natural methods also include structural elements that attract proteins that block nucleases from binding to the mRNA or recruit enzymes that can add nucleotides to the mRNA at the 3’ end and offset exonuclease degradation. The most common and well understood structural element or motif is the poly-adenylated tail at the 3’ end of a linear mRNA.

[0126] By comparison, the modifications employed in this technology at both the 5’ and 3’ ends of the mRNA construct are chemical in nature and are directly resistant to exonuclease activity or natural hydrolysis. While many modifications of a nucleotide,base sugar, or internucleoside linkage can be more resistant to exonuclease activity than their naturally occurring counterparts, many such modifications won’t possess the necessary durability to make this technology commercially useful. The required hurdle for usefulness is an in vivo chemical bond half-life, when incorporated at the end of a linear RNA imparts a quantifiable level of exonuclease resistance. To date, there are no public examples of such modifications in use for functional, translatable mRNA.

[0127] Many research groups have pursued chemical modifications at only one end (either the 5’ or 3’ end) of a linear RNA. Durable modifications that would meet the required durability have been limited to aptamer, RNA interference, siRNA, antisense, and ASO applications. However, the modifications that are most exonuclease resistant can interfere with functionality through mechanisms such as oligonucleotide hybridization, protein interactions, and enzymatic activity.

[0128] The same issues arise when applying such modification to the 3’ end of translatable mRNA. Modifications at the 3’ end can have increased durability but none of the most resistant modification have been applied to translatable mRNA due a loss of functionality at the 3’ end and the resulting negative impact on mRNA translation.

[0129] Similarly, modifications to the 5’ ends have focused on the mRNA cap structure in order to preserve cap functionality and cap-dependent translation. Modifications that impart significant stability to the 5’ cap also render the mRNA cap non-functional, eliminating mRNA translation and protein production.

[0130] By comparison, the canonical functionality of the 5’ and 3’ ends of the mRNA and its associated cap-dependent translation are not required for this technology. Instead, translation can be driven at an internal site in a cap-independent manner.

[0131] This is similar in function to the use of a circular mRNA, where exonuclease degradation is not possible as both the 5’ and 3’ ends are eliminated by conjugation to each other. By comparison, this technology uses chemical protection of the 5’ and 3’ ends of a linear design instead of a circularized design. The linear design has added benefits with regard to amount of genetic material that can be packaged, the efficiency of construction, the possibility to modify the internal nucleotides of the mRNA to enhance endonuclease resistance (and thus further improve overall durability), and the freedom to operate.

[0132] Accordingly, the present technology provides a translatable, linear mRNA comprising of exonuclease resistant modifications at both the 5’ and 3’ ends (i.e. , linear RNA that contains modified 5’ and 3’ end segments that flank and internal linear RNA,LRS-MES). See Fig. 1. These exonuclease resistant end segments (MES) are bound to both ends of a previously synthesized linear RNA segment (LRS) and can be incorporated into the overall construct during synthesis or after the initial synthesis of the internal linear RNA segment (LRS). The use of modifications can render the 5’ end non-functional with respect to cap mediated protein translation. The use of durable, exonuclease resistant modifications at both ends markedly improves mRNA stability.

[0133] The modifications within the end segments don’t necessarily need to be located at the terminal nucleotides or terminal positions of the end segment. The modifications must merely prevent exonuclease digestion from reaching the internal linear RNA segment (LRS) that contains the translatable genetic information. As such, the exonuclease modifications can be part of a larger end segment (MES).

[0134] In some embodiments, translational is driven by an internal ribosome entry site (IRES). See Fig. 1. IRES can include but are not limited to viral IRES sequences such as cricket paralysis virus intergenic region (CrPV IGR), encephalomyocarditis virus (EMCV), coxsackie virus B3 (CVB3), human rhinovirus B3 (iHRV-B3), hepatitis C virus (HCV) respiratory syncytial virus (RSV) m6A methylation sites. Viral IRES fall into four categories of type I, II, III or IV IRES. Human IRES sequences can also be considered such as fibroblast growth factor 1 (FGF1), vascular endothelial growth factor D (VEGF-D), NF-kappaB repressing factor 2 (NRF). Synthetic IRES sequences also provide significant protein expression such as a 9 nucleotide long repeating aptamers that recruit elF4A or an iHRV-B3 IRES with proximal loop Apt-elF4G insertion.

[0135] Described above are three distinct regions of a final mRNA construct: a 5’ modified end segment (5’-MES), an internal linear RNA segment (LRS), and a 3’ modified end segment (3’-MES). The types of modifications that can be used in a modified end segment (MES) are limitless since functionality of the end segments other than exonuclease resistance is not required. Ultimately, the essential modifications needed for the modified end segments are exonuclease resistant internucleoside linkages. By comparison the types of modifications possible in the internal linear RNA segment (LRS) are far more limited because the internal linear RNA segment contains translatable genes and any modifications must still allow for interaction with the ribosome or tRNA and subsequently allow for translation of the mRNA into protein. The internal linear construct is most likely be synthesized by InVitro Transcription (IVT) and therefore modifications must also be capable of being incorporated by the RNA polymerase enzymatic process.

[0136] Possible modifications include modified nucleotides containing one or more structural modifications to the nucleobase, sugar, or phosphate linkage of the mRNA. The below diagram illustrates the locations of possible modifications within each individual nucleotide within any segment of the overall design (either 5’ or 3’ end

[0137]

[0138] segment or internal linear segment containing the ORF) where n represents an arbitrary nucleotide position within an oligonucleotide of more than n nucleotides in length.

[0139] where n is the position of nucleotide within an oligonucleotide where the total length of said oligonucleotide is n plus (+) some arbitrary additional number of nucleotides

[0140] where, each of Xn is independently hydroxyl (OH), borane (BH3), amine (NH2), thiol (SH), Selenium, alkyl, O-alkyl, carboxyl, formyl, acetyl, ester, or triazole;

[0141] each of Yn is independently oxygen (0) or suphur (S);

[0142] each of Zn is independently oxygen (0), suphur (S) or amine (NH);

[0143] each of Zn is independently hydrogen (H) in a terminal position of an oligonucleotide of a 3’ end segment;

[0144] each of Wn is independently oxygen (0), sulphur (S) or amine (NH);

[0145] In some embodiments, where an internucleoside linkage is required to be exonuclease resistant within an end modified segment (MES), Xn, Yn, Zn, and Wn and their total internucleoside linkage Ln can be one or more modified internucleoside linkages selected from the group consisting of a carbophosphonate, a methylphosphonate, an ethylphosphonate, a phenylphosphonate, a pyridylcarbophosphonate, an aminomethylphosphonate, an aminoethylphosphonate, a phosphonoacetate, a phosphonoformate, a thiophosphonoacetate, a methanephosphonamidate, a phosphoramidite, a phosphorodiamidate, a phosphorodithioate, or a thionophosphate.

[0146] The chirality of such modifications can also be taken into account as certain chemical isomers (Sp or Rp) and epimers within the internucleoside link can often be a poor substrate for exonuclease recognition and activity.

[0147] In some embodiments, where a modified nucleotide is required to be endonuclease resistant within an internal linear RNA segment (LRS) the modification at Yn can be sulphur (S) at one or more phosphorothioate internucleoside linkages located 5’ to a pyrimidine (cytosine or uracil). For reference, this covers the use of alpha-thio-cytosine and alpha-thio-uridine within a linear RNA segment (LRS).

[0148] Each Rn can be independently hydrogen (H), hydroxyl (OH), alkyl, O-alkyl, halogen, or anthraquinone. In some embodiments, a modification at Rn creates a modified nucleobase Kn selected from the group consisting of 2'-fluoro (2'-F), 2'-O-methoxy-ethyl (2'-M0E), and 2'-O-methylation (2'-0Me).

[0149] Each Wn can be the Rn+1 of the adjacent nucleotide to create a 2’ to 3’ threose nucleic acid (TNA) linkage.

[0150] In some embodiments, where an internucleoside linkage is required to be exonuclease resistant within an end modified segment (MES) the modification can be one or more threose nucleic acid (TNA) linkages.

[0151] Each Vn can be independently CH or linked to an 0 at position Rn to create a locked nucleic acid (LNA, a nucleotide comprising an additional carbon atom bound to the 2' oxygen and 4' carbon of ribose).

[0152] Each Wn can be Zn-1 of the adjacent nucleotide to create an inverted 3’ to 3’ nucleoside linkage, at which point the nucleotides would be in the opposite direction, left to right, with W on the left and V on the right at positions n, n+1 , n+2, etc.

[0153] In some embodiments, where an internucleoside linkage is required to be exonuclease resistant within an end modified segment (MES) the modification can be an inverted 3’ to 3’ internucleoside linkages.

[0154] Each Vn-1 is linked to Zn while removing the ribonucleobase at position n (Kn) to create and inverted 5’ to 5’ nucleoside linkage, at which point the nucleotides would be in the opposite direction, left to right, with W on the left and V on the right at position n-1 , n-2, etc.In some embodiments, where an internucleoside linkage is required to be exonuclease resistant within an end modified segment (MES) the modification can be an inverted 5’ to 5’ internucleoside linkages.

[0155] Each Ln (the nucleotide backbone or internucleoside linkage) does not contain a phosphorous or follow the traditional phosphodiester-like structure.

[0156] In some embodiments, where an internucleoside linkage is required to be exonuclease resistant within an end modified segment (MES) the modification Ln can be independently one or more of an amine, methylhydroxylamine, acetate, carbamate, an alaninolphosphotriester, or S-methylthiourea.

[0157] In some embodiments, where an internucleoside linkage is required to be exonuclease resistant within an end modified segment (MES) the modification Ln can be independently one or more of a methylenemorpholine ring linked through phosphorodiamidate group to create a morpholino nucleic acid (MNA) or a N-(2-aminoethyl)-glycine to create a peptide nucleic acid (PNA) structure.

[0158] Each Bn can be independently a natural, modified or unnatural nucleoside base.

[0159] For a modified purine at Bn (adenosine or guanosine) each is independently modified with a C substitution at position 7 (7-deaza) on guanosine.

[0160] For a modified purine at Bn (adenosine or guanosine) each is independently modified with a CH (methyl) addition the nitrogen at position 6 on adenosine.

[0161] In some embodiments, where a modified nucleobase is required to be endonuclease resistant within the linear RNA segment (LRS) the modification at Bn can be one or more 7-deaza-guanosine.

[0162]

[0163] For a modified pyrimidine at Bn (cytosine or uracil) each can be independently modified with alkyl, O-alkyl, carboxyl, acetyl, formyl, or halogen addition at position 5.Examples include 5-methyl, 5-methoxy, 5-hydroxymethyl, 5-fluoro, 5-formyl versions of cytosine or uracil.

[0164] For a modified pyrimidine at Bn (cytosine or uracil) each can be independently modified with an NH (amine) substitution for 0 (oxygen) or C (carbon) at position 2 or position 4 within uracil.

[0165] For a modified pyrimidine at Bn (uracil) each can be independently modified with an NH (amine) substitution for C (carbon) at position 5. For example, Bn can be independently pseudouridine (5-ribosyluracil) or N1 -Methylpseudoundine.

[0166]

[0167] In some embodiments, where a modified nucleobase is required to be endonuclease resistant within the linear RNA segment (LRS) the modification at Bn can be one or more of the group consisting of a 5-alkyl pyrimidine, a 5-o-alkyl pyrimidine, or a 5-halo pyrimidine. For example, in some embodiments Bn can independently 5-aminoallylcytosine, 5-aminoallyluracil, 5-bromouracil, 5-bromocytosine, 5-carboxycytosine, 5-carboxym ethylesteruracil, 5-carboxyuracil, 5-fluorouracil, 5-formylcytosine, 5-formyluracil, 5-hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5-iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5-methyluracil, 5-propynylcytosine, 5-propynyluracil, pseudouridine, N1 -Methylpseudouridine

[0168] In some embodiments, modifications can also be present at the terminus of an oligonucleotide where there is no n+1 nucleotide or n-1 nucleotide.

[0169] Each of a 5’ n-1 terminal position (Vn-1 ) or a 3’ n+1 terminal position (Zn or Wn) of an end segment can also be a non-nucleotide compound.

[0170] In some embodiments, such non-nucleotide compounds can independently be a polyethylene glycol (PEG), a hydrocarbon chain (alkyl or o-alkyl), a glycol chain, a pyrenylmethylpyrrolindol, a trimethoxystilbene, or a fluorescent dye.In the case of an inverted 5’ to 5’ internucleoside linkage, the phosphate backbone Ln may be more than one phosphate group where m is position of the phosphate group within the phosphate internucleoside linkage and m can be 2, 3, 4, 5, or more. At each single position [Ln]m (the Zn, Xn, Yn, and Wn positions) are each independently as described above (denoted as [Zn]m, [Xn]m, [Yn]m, and [Wn]m in such an inverted internucleoside linkage). This type of multi-phosphate linkage is found in the canonical mRNA cap structure where m = 3 and Z, X, Y, and W are each oxygen at each position m 1, 2, and 3 and Bn-1 contains a 7-methyl guanosine.

[0171] In some embodiments, the cap-like structure can have numerous nucleotides both in front of (n-1, n-2) and behind (n+1, n+2) the phosphate bond without a nucleobase Kn at position n.

[0172] As described above in various embodiments, some of the above modifications have specific purposes or use as an exonuclease resistant modification or as a endonuclease resistant modification that preserves translational capabilities.

[0173] All of the total possible modifications listed above can be used within the modified end segments (MES) as long as there is one or more modification of the group consisting of a carbophosphonate, a methylphosphonate, an ethylphosphonate, a phenylphosphonate, a pyridyl carbophosphonate, an aminomethylphosphonate, an aminoethylphosphonate, a phosphonoacetate, a phosphonoformate, a thiophosphonoacetate, a methanephosphonamidate, a phosphoram idite, a phosphorodiamidate, a phosphorodithioate, or a thionophosphate, a threose nucleic acid (TNA) linkages, an inverted 3’ to 3’ internucleoside linkage, an inverted 5’ to 5’ internucleoside linkage, a non-phosphorous internucleoside linkage (such as an amine, a methylhydroxylamine, an acetate, a carbamate, an alaninolphosphotriester, a S-methylthiourea, a morpholino nucleic acid, or a peptide nucleic acid.

[0174] By contrast, only a few modifications that impart endonuclease resistance can be used within the internal linear RNA segment (LRS) while preserving translational functionality of the mRNA construct. Many of the possible modifications listed above would eliminate recognition of the mRNA codons by tRNAand stall or abort translation. However, many individual instances of functional modification can be used throughout the internal linear RNA segment (LRS). As described above, and summarized here, one or more of the following group of modifications can be used within the internal linear RNA segment (LRS)dification of the group consisting of 5-aminoallylcytosine, 5-aminoallyluracil, 5-bromouracil, 5-bromocytosine, 5-carboxycytosine, 5-carboxymethylesteruracil, 5-carboxyuracil, 5-fluorouracil, 5-formylcytosine, 5-formyluracil, 5-hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5-iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5-methyluracil, 5-propynylcytosine, 5-propynyluracil, pseudouridine, N1 -Methylpseudouridine, alpha-thio-cytosine, or alpha-thio-uridine.

[0175] However, it should be noted that several modifications that do not impart endonuclease resistance can be used within the internal linear RNA segment. Of note are N6-methyl adenosine as that may improve translation rates and overall protein expression levels.

[0176] In some embodiments, the internal translatable linear RNA segment (LRS) contains a 5' untranslated region (5' UTR) wherein the 5’UTR is between the 5’ modified end segment (5’-MES) and the ORF.

[0177] In some embodiments, the internal translatable linear RNA segment (LRS) contains a 3' untranslated region (3' UTR) wherein the 3’UTR is between the ORF and the 3’ modified end segment (3’-MES).

[0178] The UTR can provide additional functionality with respect to stability and translational efficiency. UTR can include motifs or elements such as poly A protein binding regions (PABP), YTH-domain family protein binding regions (YTHDF), viral UTR which can recruit ribosome associated proteins (elF4) or directly interact with ribosome subunits.

[0179] In some embodiments, the internal translatable linear RNA segment (LRS) contains the RNA structures or elements to initiate translation and produce one or more proteins encoded into one or more open reading frames (ORF).

[0180] The use of a linear construct with all of the translatable material (LRS) is synthesized in a separate section from the modified end segments (MES), it is possible to construct a long RNA with multiple ORF. By comparison, construction of circular mRNA has size limitation as efficiency of the joining of the 5’ and 3’ ends whether by self-splicing or splinted ligation, or click chemistry drops off significantly as the construct size exceeds 2,000 bases in length (2kb).

[0181] The methods to achieve high efficiency and high purity in the generation or construction of translatable linear RNA that contains modified 5’ and 3’ end segments (LRS-MES) are numerous. Initially, the modified end segments (MES) must be synthesized separately from the internal linear RNA segment (LRS). Given the currentstate of art in generating long segments of RNA, the internal linear RNA segment (LRS) can be synthesized using In Vitro Transcription (IVT).

[0182] In some embodiments, the IVT is carried out with a T7, T3, or SP6 RNA polymerase and the appropriate template with the associated RNA polymerase promoter sequence.

[0183] In some embodiments the modified 5’ end segment (5’-MES) is co-transcriptionally bound to the internal linear RNA segment (LRS) during IVT by acting as a primer and initiating RNA synthesis.

[0184] In some embodiments the modified 5’ end segment (5’-MES) is bound to the internal linear RNA segment (LRS) after IVT synthesis of the internal linear RNA segment (LRS). In this method of construction, the initiating primer of the IVT synthesis will have a 5’ end or be converted to a 5’ end that is compatible with the 3’ end of the modified 5’ end segment (5’-MES) such that they can be conjugated or bound together. In some embodiments, this conjugation will be mediated by chemical ligation, enzymatic ligation, or click-chemistry.

[0185] In some embodiments the modified 3’ end segment is bound to the internal linear RNA segment after IVT synthesis of the internal linear RNA segment. In this method of construction, the final nucleotide of the linear segment (LRS) made during IVT synthesis will have a 3’ end or be converted into a 3’ end that is compatible with the 5’ end of the modified 3’ end segment (3’-MES) such that they can be conjugated or bound together. In some embodiments, this conjugation will be mediated by chemical conjugation / ligation, enzymatic ligation, or click-chemistry conjugation.

[0186] In some embodiments, for the purposes of chemical conjugation / ligation, the compatible ends are defined as a 2’ hydroxyl and 3’ hydroxyl group on a ribose sugar at the 3’ end of an oligonucleotide that can be turned into a 2’, 3’ dialdehyde after treatment with sodium periodate (NaICU). In this case a strong nucleophile such as an amine, hydroxylamine, alkoxyamine, hydrazide, or alcohol can generate a new bond.

[0187] In some embodiments, for the purposes of enzymatic ligation, the compatible ends are defined by a 5’ monophosphate or a 5’ adenylated end of an oligonucleotide with a 3’ hydroxyl group of the complementary oligonucleotide.

[0188] In some embodiment, for the purposes of enzymatic ligation, the enzymes can be RNA ligase, DNA ligase, or DNAzymes. In some embodiments of enzymatic ligation, DNA fragments or sequences within the internal linear RNA segmentsequence or modified end segment serve to act as splints or secondary structure disruptors to enhance ligation efficiency.

[0189] In some embodiments, for the purposes of click chemistry conjugation the 3’ end of one segment (modified 5’ end segment or internal linear RNA segment) and the 5’ end of the other segment (internal linear RNA segment or modified 3’ end segment) contain a pair of click chemistry groups that react with each other. Click chemistry pairings include: azide with alkyne such as 3’ o-propargyl associated with the copper(l)-catalyzed azide-alkyne cycloaddition (CuAAC), azide with an alkyne such as dibenzocyclooctyne (DBCO) associated with the strain-promoted azide with alkyne cycloaddition (SPAAC), alkyne with nitrone such as bicyclononyne (BCN) associated with the strain-promoted alkyne-nitrone cycloaddition (SPANC), or the tetrazine with trans-cyclooctene (TCO) associated with an inverse-demand Diels-Alder cycloaddition.

[0190] In some embodiments, the 5’ end of a modified 5’ end segment (5’-MES) or the 3’ end of a modified 3’ end segment (3’-MES) are modified such that they are not reactive during a chemical ligation, enzymatic ligation, or click-chemistry reaction and therefore can only bind / join at the desired location once. Further, they will be unable to form self-reactive conjugation to form concatemers. This embodiment allows for chemical reactions where a modified end segment (MES) is used in molar excess of the internal linear RNA segment (LRS) and therefore can help to drive conjugation efficiency to near 100% efficiency. Examples of such non-reactive ends include dideoxy nucleotides, an inverted nucleotide, a hydrocarbon spacer, an ethyleneglycol spacer a hexanediol, or chemical compounds without a nucleotide at one end.

[0191] In some embodiments, when the modified 5’ end segment (5’-MES) is co-transcriptionally added to the internal linear RNA segment (LRS) during IVT, the modified end segment will contain 2, 3, or 4 nucleotides that are homologous to the DNA template and serve the purpose of initiating transcription.

[0192]

[0193]

[0194]

[0195] Synthetic Scheme for a Linear RNA Construct Containing a 5’-MES and a 3’-MES

[0196] In such a case the primer can possess one or more modifications as previously described. In some embodiments, the co-transcriptionally added modified 5’ end segment (5’-MES) blocks cap-dependent translation at the 5’ end of the final mRNA construct.

[0197] In some embodiments, the modified end segments (MES) are the same for both 5’ and 3’ ends. In such cases, the 5’ and 3’ ends of the internal linear RNA segment (LRS) is synthesized or altered in a way that creates an oligonucleotide with similar functional groups at both the 5’ and 3’ ends (as needed for the type of binding whether chemical ligation, enzymatic ligation, or click-chemistry). In this case, a single modified end segment (MES) is used for binding to both ends of the linear RNA segment (LRS) in a single reaction.

[0198] In some embodiments, the modified end segments (MES) are specific for binding at either the 5’ end or the 3’ end of the previously synthesized internal linear RNA segment (LRS).

[0199] While not intending to limit the technology in any way, examples of preferred moieties for use as 5’-MES include the following.

[0200] [mAs*] [mAs*] [rG]

[0201] [msU*] [mAs*] [mAs*] [rG]

[0202] [rG] [Inv-dA] [rA] [rG]

[0203] [ddA-5] [2fA*] [rG][ddA-5] [2fA*] [2fA*] [rG]

[0204] [mp-dA] [mp-dA] [rG]

[0205] [rG] [mAs*] - [mAs*] [rG]

[0206] [mp-dA] [mp-dA] [mp-dA] [mp-dA] [mp-dA] [rA]

[0207] [mG] [+T] [mp-dC] [+G] [mp-dG] [+C] [mp-dT] [rC]

[0208] While not intending to limit the technology in any way, examples of preferred moieties for use as 3’-MES include the following.

[0209] [5Phos] [rA] [rA] [rA] [mp-dA] [mp-dA] [mp-dA] [mp-dA] [rA] [rA] [rA] [rA] [3-FAM]

[0210] [5Phos] [rA] [rA] [2fA*] [2fA*] [2fA*] [2fA*] [mp-dA] [mp-dA] [mp-dA] [mp-dA] [rA] [ddC-3] [5'Phos] [rA] [rA*] [mG] [mG] [+T] [mp-dC] [+G] [mp-dG] [+C] [mp-dT] [+T] [mp-dA] [+C] [mG] [rA] [rA] [rA] [rA] [rA] [rA] [3-FAM]

[0211] [5'Phos] [rA] [rA] [rA] [rA] [rA] [rA] [mAs*] [mAs*] [mAs*] [rA] [ddA]

[0212] [5'Phos] [rA] [rA] [mAs*] [mAs*] [mAs*] [rA] [3'lnvdT]

[0213] [5Phos] [rA] [rA] [2fA*] [mp-dA] [2fA*] [mp-dA] [2fA*] [mp-dA] [2fA*] [mp-dA] [rA] [ddC] [5Phos] [rA] [rA] [mAs*] [rA] [3'lnvdT]

[0214] [5Phos] [rA] [rA] [rA] [rA] [rA] [tn A] [tn A] [tn A] [tn A]

[0215] For the above listed preferred 5’-MES and 3’-MES, the following definitions apply.

[0216] “[ ]” represents each individual nucleotide.

[0217] “5’Phos” represents a monophosphate at the 5’ terminus.

[0218] “mAs*” represents a 2’0-methyl adenosine, with an oxygen to sulphur replacement at two positions in the internucleoside linkage to create a phosphorodithioate at the internucleoside linkage that is positioned 3’ to the adenosine.

[0219] “mils*” represents a 2’0-methyl uracil, with an oxygen to sulfur replacement at two positions in the internucleoside linkage to create a phosphorodithioate at the internucleoside linkage that is positioned 3’ to the uracil.

[0220] “rG” represents ribonucleic guanosine.

[0221] “rA” represents ribonucleic adenosine.

[0222] “2fA*” represents a 2’ fluoro adenosine, with an oxygen to sulphur replacement at one position in the internucleoside linkage to create a phosphorothioate at the internucleoside linkage that is positioned 3’ to the adenosine.“ddA-5” represents an inverted dideoxy adenosine linked with a 5’ to 5’ phosphodiester bond to the subsequent ribonucleotide at the 5’ end of an oligonucleotide.

[0223] “Inv-dA” represents an inverted 5’ to 5’ internucleoside linkage between two ribonucleic acids internal to an oligonucleotide.

[0224] “mp-dA” represents a methylphosphonate internucleoside linkage that is positioned 3’ to a adenosine deoxyribonucleoside. “mp-dC” and “mp-dT” are also used (cytosine and thymidine).

[0225] “ - “ represents a 5’ to 5’ internucleoside linkage that inverts the orientation of the oligonucleotide.

[0226] “mG” represents a 2’ O-methyl guanosine nucleoside.

[0227] “rA*” represents a phosphorothioate in the internucleoside linkage 3’ to an adenosine ribonucleoside.

[0228] “+T” represents a locked nucleic acid of thymidine deoxyribonucleoside. “+G” and “+C” are also used.

[0229] “ddA” represents dideoxy adenosine. “ddC” is also used.

[0230] “3’lnvdT” represents an inverted 3’ to 3’ internucleoside linkage between two ribonucleic acids at the 3’ end of an oligonucleotide.

[0231] “tnA” represents a threose nucleic acid where the phosphodiester group links from a 2’ position to a 3’ position of the next nucleobase.

[0232] “3-FAM” represents a fluorescein attached to the 3’ hydroxyl group of the previous ribonucleotide.

[0233] In some embodiments, at least 2%, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the nucleotides or internucleoside linkages in the nucleic acids of a modified end segment (MES) or an internal linear segment (LRS) is replaced with a modified nucleotide or modified internucleoside linkage.

[0234] In some embodiments, purification of a final construct containing modified end segments at both the 5’ and 3’ ends of an internal linear RNA segment (LRS-MES) is accomplished by HPLC, by beads coated with non-specific or specific binders such as paramagnetic beads coated with sequences that selectively bind the desired final construct, or by enzymatic degradation of overall RNA construct when said construct does not contain one or both modified end segments. This final example is the use ofexonucleases that degrade any linear RNA that does not contain exonuclease resistant end segments.

[0235] In some embodiments, the present technology provides a method comprising introducing any one or more of the modified mRNAs provided herein (LRS-MES), a delivery agent containing the LRS-MES construct provided herein, or a composition provided herein, into a cell.

[0236] In some embodiments, the present technology of a modified mRNA (LRS-MES) is delivered or transfected into a cell. Transfection into a cell can be accomplished using nanoparticles, electroporation, mechanoporation, or other methods of delivery.

[0237] In some embodiments, the present technology provides a transfection or delivery agent comprising one or more of the modified mRNAs (LRS-MES) provided herein, wherein the delivery agent comprises a lipid, a peptide, a protein, an antibody, a carbohydrate, a nanoparticle, or a microparticle.

[0238] In some embodiments, a nanoparticle or microparticle provided herein is a lipid nanoparticle or a lipid microparticle, a polymer nanoparticle or a polymer microparticle, a protein nanoparticle or a protein microparticle, or a solid nanoparticle or a solid microparticle.

[0239] In some embodiments, the present technology provides a composition comprising any one or more of the modified mRNAs provided herein (LRS-MES), a delivery agent provided herein, or a cell provided herein.

[0240] In some embodiments, the present technology is used to treat or prevent disease.

[0241] In some embodiments, the modified mRNAs provided herein (LRS-MES), encodes an antigen or a therapeutic protein.

[0242] In some embodiments, the therapeutic protein modulates the immune system response.

[0243] In some embodiments, the antigen is a viral antigen, bacterial antigen, protozoal antigen, or fungal antigen.

[0244] In some embodiments, the therapeutic protein is an enzyme, transcription factor, cell surface receptor, growth factor, or clotting factor

[0245] In some embodiments, the cell surface receptors provide CAR or immune checkpoint functionality into a cell.While not intending to limit the technology in any way, preferred therapeutic proteins include the following.

[0246] Chimeric Antigen Receptors in T cells for cancer or autoimmune disease.

[0247] Erythropoietin for treating anemia and restoring red blood cell count after cancer treatments (especially in blood cancers where hemopoietic stem cells are destroyed in an effort to get rid of cancerous stems cells.

[0248] Haemoglobin / Hemoglobin subunit beta (also known as beta globin or haemoglobin / hemoglobin beta) for treating Sickle Cell Disease or Beta Thalassemia disease.

[0249] Protein Inhibitor 1-1 c (constitutively active form of phosphatase inhibitor-1 ) for treating congestive heart failure.

[0250] Phenylalanine hydroxylase (PAH) for treating Phenylketonuria disease.

[0251] Alpha-1 antitrypsin (AAT, SERPINA1 gene) for treating Alpha-1 Antitrypsin Deficiency.

[0252] Glucose-6-phosphatase (glucose-6-phosphatase enzyme, G6PC gene) for treating Glycogen storage disease la (GSDIa).

[0253] Antigens (viral, bacterial, or cancer) for prophylactic vaccines. For these proteins, more durable mRNA is expected to produce a stronger immune response (e.g., B cell activation and IgG antibody responses).

[0254] In some embodiments, the modified mRNAs provided herein (LRS-MES) encodes genome editing proteins such as for use in CRISPR or TALEN technologies.

[0255] In some embodiments, the composition further comprises an additional agent. In some embodiments, the additional agent is an agent which has a therapeutic effect when administered to a subject. In some embodiments, the additional agent is a nucleotide, a nucleic acid, an amino acid, a peptide, a protein, a small molecule, an aptamer, a lipid, or a carbohydrate. In some embodiments, the additional agent is a shRNA, a siRNA, a shRNA or an ASO. In some embodiments, the additional agent is an antigen or adjuvant.

[0256] In some embodiments, the composition is a pharmaceutical composition, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.

[0257] In some embodiments, the present technology provides a method comprising introducing any one or more of the modified mRNAs provided herein (LRS-MES), adelivery agent provided herein, a cell provided herein, or a composition provided herein into a subject.

[0258] In some embodiments, the present technology provides a method of preventing a disease in a subject in need thereof comprising introducing an effective amount any one or more of the modified mRNAs provided herein (LRS-MES), a delivery agent provided herein, a cell provided herein, or a composition provided herein into the subject, wherein the open reading frame of the modified mRNA encodes a protein.

[0259] In some embodiments, the subject is a mammal.

[0260] In some embodiments, the subject is a human.

[0261] In some embodiments, the subject is a dog.

[0262] In some embodiments, the present technology provides a kit comprising a modified 5’ end segment (5’-MES) and a modified 3’ end segment (3’-MES) of a method of producing any one of the modified mRNAs provided herein.

[0263] EXAMPLES

[0264] Example 1. Inhibition of Ribonuclease Digestion by 5’-MES and 3’-MES End Segments.

[0265] A synthetic 32 nucleotide long RNA with incorporated 5’-MES and 3’-MES was exposed to ribonuclease degradation to analyze ribonuclease impact on RNA stability. Canine plasma contains significant ribonucleases, and was used to degrade RNA. A 32 nucleotide long oligonucleotide Control RNA was synthesized with three adenosines on each of the 3’ and 5’ ends (SEQ ID NO:1), while same seguence and length Mock 32 End Modified RNA contained three modified methyl-phosphonate adenosines on each of the terminal 5’ and 3’ ends (serving as examples of the 5’-MES and 3’-MES segments as defined herein) (SEQ ID NO:2). The seguences were as follows:

[0266] AAAAGGAGAAUGCAAAAAUGUGAUCUUGCAAA (SEQ ID NO:1)

[0267] [mp-dA] [mp-dA] [mp-dA] AGGAGAAUGCAAAAAUGUGAUCUUGC [mp-dA] [mp-dA] [mp-dA], (SEQ ID NO:2)

[0268] where “mp-dA” represents a methylphosphonate (i.e. , a phosphodiester group having a methyl group in place of an oxygen) at the internucleoside linkage positioned 3’ toan adenosine deoxyribonucleoside; “A” represents ribonucleic adenosine, “C” represents ribonucleic cytidine, “G” represents ribonucleic guanosine, and “U” represents ribonucleic uracil.

[0269] To evaluate the durability of the Control RNA and Mock 32 End Modified RNA, 5 pl of each RNA construct (5pM) was incubated with 5 pl of serially diluted canine plasma in 1x PBS at pH 7.4 for 1 hour at 37°C. 2x RNA dye (5 pl) was added to stop the reaction, after which the mixture was denatured at 70°C for 5 minutes and run on a 15% polyacrylamide denaturing gel for 30 minutes at 200 V constant voltage. The gel was stained with SYBR green stain for 10 minutes and visualized on a 470nm wavelength transilluminator.

[0270] As shown in Fig. 2, the Control RNA was completely digested in 1 hour at all concentrations of canine plasma, while the Mock 32 End Modified RNA withstood 2.5% plasma for 1 hour. This demonstrates that 5’ and 3’ MES oligonucleotides confer resistance to degradation.

[0271] Ribonuclease digestion of another modified oligonucleotide (Mock 32 Full Modified RNA, or Full Modified) was investigated. The oligonucleotide had phosphorothioate modifications at every nucleotide position not considered part of the 5’MES or 3’MES segments (which were identical to those of the Mock 32 End Modified RNA). The sequence was as follows:

[0272] [mp-dA] [mp-dA] [mp-dA] *A*G*G*A*G*A*A*U*G*C*A*A*A*A*A*U*G*U*G*A*U*C*U*U*G*C [mp-dA] [mp-dA] [mp-dA] (SEQ ID NO:3)

[0273] “mp-dA” represents a methylphosphonate (i.e., a phosphodiester group having a methyl group in place of an oxygen) at the internucleoside linkage positioned 3’ to an adenosine deoxyribonucleoside; “A” represents ribonucleic adenosine, “C” represents ribonucleic cytidine, “G” represents ribonucleic guanosine, “U” represents ribonucleic uracil, and represents a phosphorothioate at the internucleoside linkage that is positioned 3’ to the nucleoside (i.e. , a phosphodiester group having an oxygen to sulfur replacement).

[0274] The Mock 32 End Modified RNA (End Modified) and the Mock 32 Full Modified RNA (Full Modified) were exposed to serum at a concentration of 1.25% at 1 , 2, 4, and overnight (16 hours, ON) as described above. The additional internal phosphorothioate modifications made the Mock 32 Full Modified RNA construct fullyresistant to nuclease degradation at 16 hours (see Fig. 3), demonstrating greatly enhanced durability of such a design construct.

[0275] Example 2. Resistance to Ribonuclease Digestion of Longer RNA Constructs.

[0276] Protection of longer RNA constructs using 5’-MES and 3”-MES along with internal modifications was tested. Longer linear RNA was synthesized based on In Vitro Transcription (IVT) methods with co-transcriptional addition of a 5’-MES segment to the 5’ end during IVT synthesis. A model 74 nucleotide long IVT RNA product was designed and co-transcriptionally capped using a variety of short 2 to 4 nucleotide length oligonucleotides that produced IVT products ranging from 74 to 76 nucleotides in length. The DNA template was a pair of 98 nucleotide DNA oligonucleotides, which when hybridized together contained a T7 RNA polymerase initiation promoter with an adenosine inserted class III phi 6.5 transcription initiation site. The adenosine inserted phi 6.5 initiation site was used to foster incorporation of short primers ending in an “AG” adenosine-guanosine dinucleotide into the IVT product. The coding strand of the DNA template showing the overhangs and T7 RNA promoter is shown below as SEQ ID NO:4.

[0277] AGCTTACTAATACGACTCACTATAAGGAAATGATGGATGGACGCATTAAAACAGCGGATGGGTAC CCCACCATCCGACCCACTGGGTGTAGTACAAAA (SEQ ID NO: 4)

[0278] Primers and caps that were co-transcriptionally added to the RNA during IVT included a control 5’ mRNA cap (CleanCap, CleanCap AG from Trilink, product # N-7113), AAGv.1 , AAGv.2, UAAG, and pApG. The products are SEQ ID NOS:5-8 below.

[0279] AAGv.1

[0280] [mAs]* [mAs]* rG, where “mAs” represents 2’ O-methyl phosphorothioate adenosine, represents a second oxygen to sulfur replacement (within the phosphorothioate) to create a phosphorodithioate at the internucleoside linkage that is positioned 3’ to the adenosines, and “rG” represents a ribonucleic guanosine.

[0281] [mAs]*[mAs]*GGAAAUGAUGGAUGGACGCAUUAAAACAGCGGAUGGGUACCCCACCAUCCGACC CACUGGGUGUAGUACAAAA (SEQ ID NO: 5)

[0282] AAGv.2[mAs]* [mA] rG, where “mAs” represents a 2’ O-methyl phosphorothioate adenosine, represents a second oxygen to sulfur replacement (within the phosphorothioate) to create a phosphorodithioate at the internucleoside linkage that is positioned 3’ to the adenosines, “mA” represents a 2’0-methyl adenosine, and “rG” represents a ribonucleic guanosine.

[0283] [mAs]*[mA]*GGAAAUGAUGGAUGGACGCAUUAAAACAGCGGAUGGGUACCCCACCAUCCGACCC ACUGGGUGUAGUACAAAA (SEQ ID NO: 6)

[0284] UUAG

[0285] [msll]* [mAs]* [mAs]* rG, where “mils” represents a 2’ O-methyl phosphorothioate uracil, “mAs” represents a 2’0-methyl phosphorothioate adenosine, “*” represents a second oxygen to sulfur replacement (within the phosphorothioate) to create a phosphorodithioate at the internucleoside linkage that is positioned 3’ to the uracil or adenosine, and “rG” represents a ribonucleic guanosine.

[0286] [msU]*[mAs]*[mAs]*GGAAAUGAUGGAUGGACGCAUUAAAACAGCGGAUGGGUACCCCACCAUCC GACCCACUGGGUGUAGUACAAAA (SEQ ID NO: 7)

[0287] PAG

[0288] [pA][G], where “pA” represents ribonucleic adenosine with a 5’ monophosphate and “G” represents ribonucleic guanosine.

[0289] [pA]GGAAAUGAUGGAUGGACGCAUUAAAACAGCGGAUGGGUACCCCACCAUCCGACCCACUGG GUGUAGUACAAAA (SEQ ID NO: 8)

[0290] To verify 5’ exonuclease resistance the enzymes used included RNA 5' pyrophosphohydrolase (RppH) which removes both pyrophosphate from the 5' end of triphosphorylated RNA as well as a 7-methylguanosine (m7G) pyrophosphate which is linked to the first nucleotide of an mRNA by a 5'-5' triphosphate internucleoside linkage (mRNA cap) to leave a 5' monophosphate RNA. Also used is XRN-1, which is a highly processive 5'^3' exonuclease that degrades exposed 5’ monophosphates and an associated ribonucleoside on a RNA. The RppH and XRN-1 combination is used to efficiently remove 5’ Cap or 5’ triphosphate structures typically found on mRNA. This enzyme combination was used to assess the efficiency with which short5’-MES oligonucleotides were incorporated into the mRNA as well as the ability of 5’-MES to resist digestion. The 5’ capped constructs were digested with RppH / XRN-1 (New England Biolabs, Ipswich, MA) per manufacturer’s instructions. RNA constructs were digested for 1 hour at 37°C.

[0291] The 5’-MES capping structures demonstrated significant resistance to enzymatic digestion or “decapping” compared to the control CleanCap mRNA construct. A semi-quantitative protocol was developed using the iBright FL1500 from ThermoFisher Scientific by measuring the difference in the band densities of the RNA constructs pre and post RppH / XRN-1 digestion on a 1% agarose gel stained with SYBR Green. As shown in the gel image of Fig. 4, nearly all of the CleanCap was digested while 5’-MES constructs showed significantly less digestion of between 40% and 60% of the starting material. It was believed that digestion of some of the 5’-MES containing constructs is due to impurities and a lack of co-transcriptional incorporation of 5’-MES (i.e. , some of the mRNA was transcribed without containing the desired short durable 5’-MES oligonucleotide). This efficiency was later improved with increasing concentrations of 5’-MES reagent and varying the IVT conditions.

[0292] Example 3. Synthesis and Durability of Linear RNA Constructs Containing 3’-MES.

[0293] 3’-MES durability and covalent bonding to a linear RNA construct was investigated. To accomplish this task, oligonucleotides having varying modifications were designed with and without fluorescent labels for ease of identification based on gel electrophoresis.

[0294] An initial test of 3’-MES included two 3’-MES moieties named semi. dura.17. FAM (SEQ ID NO:9) and semi. dura.18 (SEQ ID NO:10), which were compared to a control oligonucleotide named Ctrl.20. FAM (SEQ ID NO: 11).

[0295] [5’Phos] AAmA*mA*mA*mA*mA*mA*mA*mA*mA*mA*mA*mA*mA*mA*A [3’-FAM] (SEQ ID NO:9)

[0296] “5’Phos” represents a monophosphate at the 5’ terminus, “A” represents adenosine, “mA*” represents a 2’0-methyl phosphorothioate adenosine, and “3’-FAM” represents a fluorescein attached to the 3’ hydroxyl group of the previous ribonucleotide.

[0297] [5’Phos] AAmA*mA*mA*mA*mA*mA*mA*mA*mA*mA*mA*mA*mA*mA*A [3’lnvdT] (SEQ ID NQ:10)“5’Phos” represents a monophosphate at the 5’ terminus, “A” represents adenosine, “mA*” represents a 2’0-methyl phosphorothioate adenosine, and “3’lnvdT” represents the inverted deoxyribonucleotide thymidine linked in a 3’ to 3’ phosphodiester bond to the previous ribonucleotide.

[0298] [5’Phos] AAA A*A*A*A*A*A*A*A*A*A*A*A*A*A*A*A [3’-FAM] (SEQ ID NO:11)

[0299] “5’Phos” represents a monophosphate at the 5’ terminus, “A” represents adenosine, “A*” represents a phosphorothioate adenosine, and “3’-FAM” represents a fluorescein attached to the 3’ hydroxyl group of the previous ribonucleotide.

[0300] The three oligonucleotides were exposed to Ribonuclease R (RNase R). RNase R is a ubiquitous, magnesium-dependent 3' to 5' exoribonuclease that is able to digest extensively structured linear RNA molecules but does not digest circular RNA. This property makes it a powerful tool in RNA-based research, particularly in the study of RNA stability. RNase R was purchased from New England BioLabs, Ipswich, MA and used per the manufacturer’s instructions.

[0301] Fig. 5 shows Rnase R digestion of one microgram (1 pg) of each of SEQ ID NOS:9, 10, and 11 digested with 0 or 10 units (U) of 10X RNase R for 60 and 120 minutes at 37°C. Reactions were stopped by the addition of 5 pl 2X RNA dye (NEB) and run on 2% Gel Green Agarose / TBE gel for 30 minutes @ 100V. The products were visualized on a Maestrogen UltraSlim UV Transilluminator at 470 nm. As shown, Rnase R digested the control oligonucleotide in 1 hour, while the semi. dura.17. FAM oligo remained intact in excess of the 2 hours tested, demonstrating the resistance of modified oligonucleotides.

[0302] Ligation of 3’-MES moieties to larger linear mRNA constructs was performed. A linear construct complete with IRES and open reading frame (ORF) was designed and synthesized. The linear mRNA was constructed via in vitro transcription from a DNA template. The coding strand of the DNA template had a restriction site to linearize the template, a T7 RNA polymerase initiation promoter with an adenosine inserted class III phi 6.5 transcription initiation site, a transcription enhancer sequence, a Cricket Paralysis Virus (CrPV) IGR IRES (Intergenic Region Internal Ribosome Entry Site), an eGFP open reading frame, two stop codons, a poly A binding protein element, a spacer sequence, and a restriction site to linearize the template when reading from the 5’ to 3’ direction as shown in SEQ ID NO: 12.AAGCTTACTAATACGACTCACTATAAGGAAATGATGGATGGACGCATTCTAGCACTAGTAAAGCA AAAATGTGATCTTGCTTGTAAATACAATTTTGAGAGGTTAATAAATTACAAGTAGTGCTATTTTTGT ATTTAGGTTAGCTATTTAGCTTTACGTTCCAGGATGCCTAGTGGCAGCCCCACAATATCCAGGAA GCCCTCTCTGCGGTTTTTCAGATTAGGGCGTCGAAAAACCTAAGAAATTGCCCTGCAAGCAAGG GCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGC CACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAG TTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTAC GGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCA TGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCC GCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACT TCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTA TATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAG GACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGT GCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAA GCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGA GCTGTACAAGTGATAAAAAAAAAAAAAACCAAAAAAAAAAAACAAAAAAAAAAAATAATTGACTGC GAGAAAAAGCTT (SEQ ID NO: 12)

[0303] In vitro transcription was carried out with a short oligonucleotide that acted as a primer to initiate transcription and overcame the lack of guanine at position +1 of the adenosine inserted class III phi 6.5 promoter. In this case, the primer itself acted as the 5’-MES due to the presence of exonuclease resistant but was not among the most durable 5’-MES tested. It consisted of phosphoroth ioate internucleoside linkages combined with additional modifications of 2’ 0 methyl groups on the adenosines, namely mA*mA*rG, where “mA*” represents a 2’0-methyl adenosine, with an oxygen to sulphur replacement to create a phosphorothioate at the internucleoside linkage that is positioned 3’ to the adenosines, and “rG” represents a ribonucleic guanosine. The IVT reaction resulted in a linear mRNA containing a 5’-MES with the following SEQ ID NO: 13, which was cleaned up via overnight lithium chloride (LiCI) precipitation to remove free nucleotides and unbound 5’-MES prior to ligation of a 3’-MES.

[0304] mA*mA*GGAAAUGAUGGAUGGACGCAUUCUAGCACUAGUAAAGCAAAAAUGUGAUCUUGCUUG UAAAUACAAUUUUGAGAGGUUAAUAAAUUACAAGUAGUGCUAUUUUUGUAUUUAGGUUAGCUA UUUAGCUUUACGUUCCAGGAUGCCUAGUGGCAGCCCCACAAUAUCCAGGAAGCCCUCUCUGC GGUUUUUCAGAUUAGGGCGUCGAAAAACCUAAGAAAUUGCCCUGCAAGCAAGGGCGAGGAGC UGUUCACCGGGGUGGUGCCCAUCCUGGUCGAGCUGGACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUC UGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGU GCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGC CCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAACUACAAGACCCGC GCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCGCAUCGAGCUGAAGGGCAUCGACU UCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACAACAGCCACAACGUC UAUAUCAUGGCCGACAAGCAGAAGAACGGCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUC GAGGACGGCAGCGUGCAGCUCGCCGACCACUACCAGCAGAACACCCCCAUCGGCGACGGCCC CGUGCUGCUGCCCGACAACCACUACCUGAGCACCCAGUCCGCCCUGAGCAAAGACCCCAACG AGAAGCGCGAUCACAUGGUCCUGCUGGAGUUCGUGACCGCCGCCGGGAUCACUCUCGGCAU GGACGAGCUGUACAAGUGAUAAAAAAAAAAAAAACCAAAAAAAAAAAACAAAAAAAAAAAAUAAU UGACUGCGAGAAAA (SEQ ID NO: 13)

[0305] “mA*” represents a 2’0-methyl phosphorothioate ribonucleic adenosine.

[0306] In this example, the 3’-MES (SEQ ID NO: 14) had a string of methylphosphonates to provide durability combined with locked nucleic acids and 2’ O-methyl ribonucleotides to aid in hybridization melting temperature. The unique sequence and higher melting temperature of this 3’-MES was designed for splinted ligation as well as probe-based purification methods.

[0307] [5’Phos] [rA] [*rA] [mG] [mG] [+T] [mp-dC] [+G] [mp-dG] [+C] [mp-dT] [+T] [mp-dA] [+C] [mG] [rA] [rA] [rA] [rA] [rA] [rA] [3-FAM] (SEQ ID NO: 14)

[0308] “5’Phos” represents a monophosphate at the 5’ terminus, “rA” represents ribonucleic adenosine, “*rA” represents a phosphorothioate in the internucleoside linkage 3’ to an adenosine ribonucleoside, “mG” represents a 2’ O-methyl guanosine nucleoside, “+T” represents a locked nucleic acid of thymidine deoxyribonucleoside, “mp-dC” represents a methylphosphonate at the internucleoside linkage that is positioned 3’ to a cytosine deoxyribonucleoside, “+G” represents a locked nucleic acid of guanosine deoxyribonucleoside, “mp-dG” represents a methylphosphonate at the internucleoside linkage that is positioned 3’ to a guanosine deoxyribonucleoside, “+C” represents a locked nucleic acid of cytosine, deoxyribonucleoside, “mp-dT” represents a methylphosphonate at the internucleoside linkage that is positioned 3’ to a thymidine deoxyribonucleoside, “mp-dA” represents a methylphosphonate at the internucleoside linkage that is positioned 3’ to an adenosine deoxyribonucleoside, and “3-FAM”represents a fluorescein attached to the 3’ hydroxyl group of the previous ribonucleotide.

[0309] Ligation of 3’ modified end segment (3’-MES) to the 3’ end of the RNA transcript was done using NEB T4 RNA 2 ligase (New England Biolabs, Ipswich, MA.). Ligation buffer was optimized to contain 1 x T4 Ligase buffer, 10mM ATP, 16.67 % PEG 8000 and RNAse Inhibitor 1 U / ul (New England Biolabs, Beverly, MA). A total volume of 30 pl containing a 4:1 ratio of RNA (50 pmol) and 200 pmol of a 20-mer, 3’-MES was ligated for 2-4 hours at ambient temperature (22C to 25 C) using 2 ul of T4 RNA Ligase 2 High Concentration (60 U / reaction). Successful ligation of RNA, was visualized in a 2% Agarose gel, by the fluorescent signal generated from the 20mer 3’-MES oligonucleotide (see Fig. 6). Ligation occurred specifically and rapidly, with slower migrating fluorescent bands (higher MW) appearing in as little as 30 minutes (Lane 2). No fluorescent bands were seen when T4 RNA Ligase 2 was omitted from the reaction (Lane 1). The gel was then stained (Panel B) with a total nucleic acid stain, SYBR Green to verify that RNA was present in all samples.

[0310] The RNA constructs (control and ligated RNA) were analytically evaluated in the Agilent RNA 2100 using the RNA Nano chip per manufacturer’s instructions (see Figs. 7A-7B). Fig. 7A, is the gel electropherogram of overlay of Ligase (-) and Ligase (+) 30 minute samples. Fig. 7B is an enlarged view of surrounding peak area. A 35 nucleotide size difference was calculated by the Agilent software showing successful ligation of the 3’-MES oligonucleotide to the RNA.

[0311] Example 4. Cap-Independent Expression of GFP from a Linear RNA Construct.

[0312] The ability to express protein in a cap-independent manner using an IRES was tested for an uncapped linear mRNA construct containing a 5’-MES and a 3’-MES. mRNAs containing functional caps (as defined by a 7-methylguanosine (m7G) pyrophosphate linked to the first nucleotide of an mRNA by a 5'-5' triphosphate internucleoside linkage) were compared to the uncapped construct.

[0313] Cell-free protein synthesis (NEBExpress, Ipswich, MA) was used as an alternative to the heterologous in vivo expression of proteins. Cell-free protein expression (CFPS) possesses the necessary translational cellular machinery needed to direct protein synthesis (e.g., ribosomes, translation factors and tRNAs) from an mRNA construct as long as the mRNA contains a proper ribosome binding site for efficient translation. Here, this method was used to verify protein expression of anRNA transcript containing a synthetic variation of the iHRV-B3 IRES with a proximal loop Apt-elF4G insertion (SEQ ID NO: 15). Remarkably, without an mRNA cap or poly A tail (or any poly A protein binding region), protein expression was equivalent, if not higher than that of the positive expression control of a commercially-available, gold-standard eGFP mRNA (Trilink L-7601).

[0314] AGGAAAUGAUGGAUGGACGCAUUAAAACAGCGGAUGGGUACCCCACCAUCCGACCCACUGGG UGUAGUACUCUGGUACUUCGUACCUUUGUACGCCUGUUCUUCCCAUUGUACCCUUCCUGAAC UUCCAACCCAAGUAACGUUAGAAGCUCAACAUUUAGUACAACAGGAAGCACCACAUCCAGUGG UGUUUAGUACAAGCACUUCUGUUUCCCCGGAGCGAGGUAUAGGCUGUACCCACUGCCAAAAA CCUUUAACCGUUAUCCGCCAACCAACUACGUAAAAGCUAGUAGUAUUAUGUUUUUAACUAGGC GUUCGAUCAGGUGGAUUUCCCCUCCACUAGUUUGGUCGAUGAGGCUAGGAAUUCCCCACGG GUGACCGUGUCCUAGCCUGCGUGGCGGCCAACCCAGCCCACUCACUAUUUGUUUUCGCGCC CAGUUGCAAAAAGUGUCGGGGCUGGGACGCCUUUUUAUAGACAUGGUGUGAAGACUCGCAUG UGCUUGGUUGUGAUUCCUCCGGCCCCUGAAUGCGGCUAACCUUAACCCUGGAGCCUUGUGU CACAAACCAGUGAUGAUAAGGUCGUAAUGAGCAAUUCCGGGACGGGACCGACUACUUUGGGU GUCCGUGUUUCUUAUUUUUCUUAUUAUUGUCUUAUGGUCACAGCAUAUAUAUAACAUAUACUG UGAUCAUGGUGAGCAAGGGCGAGGAGCUGUUCACCGGGGUGGUGCCCAUCCUGGUCGAGCU GGACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACC UACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCAC CCUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGC AGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUC AAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAA CCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGG AGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAACGGCAUCAAGG UGAACUUCAAGAUCCGCCACAACAUCGAGGACGGCAGCGUGCAGCUCGCCGACCACUACCAG CAGAACACCCCCAUCGGCGACGGCCCCGUGCUGCUGCCCGACAACCACUACCUGAGCACCCA GUCCGCCCUGAGCAAAGACCCCAACGAGAAGCGCGAUCACAUGGUCCUGCUGGAGUUCGUGA CCGCCGCCGGGAUCACUCUCGGCAUGGACGAGCUGUACAAGUGAUAAUAGGCUGGAGCCUC GGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCG UACCCCCGUGGUCUUUGAAUAAAGUCUGAA (SEQ ID NO:15)

[0315] The NEBExpress assay was run in a shaking, microtiter plate in 50 pl volume per manufacturer’s instructions. The fluorescence generated by successful expression of the enhanced green binding protein, eGFP was measured at the indicated intervals @ 488nm. Water was used as the negative control and results below expressed as net eGFP fluorescent signal which is positive EGFP signal minus negative eGFP signal. The results are shown in Table 1. Three varieties of co-transcriptional addition wereused to create a capped or 5’MES mRNA. Clean Cap AG (CleanCap AG from Trilink, product # N-7113), pApG (SEQ ID N0:8), and fAG ([ddA-5] * [2fA] * [rG]), where “ddA-5” represents an inverted dideoxy adenosine linked with a 5’ to 5’ phosphodiester bond to the subsequent ribonucleotide, represents an oxygen to sulfur replacement (within the phosphodiester internucleoside linkage) to create a phosphorothioate, “2fA” represents a 2’ fluor ribonucleic adenosine, and “rG” represents a ribonucleic guanosine.

[0316] Remarkably, an unpurified but slightly durable 5’-MES (listed as fAG) outperformed at the 2 hour time point despite a slow start to translation, suggesting that future purification of this construct or more durable species of 5’-MES should further boost performance.

[0317] Table 1

[0318]

[0319] Example 5. Analysis Techniques for Linear RNA Constructs.

[0320] Modified RNAs are characterized according to multiple biochemical and analytical parameters, including size, purity, end modification(s), resistance to exonuclease and endonuclease degradation, and the ability to translate encoded protein. These methods were developed for conventional RNA molecules; however, they are used here for a linear mRNA comprising (i) a 5’ modified end segment (5’-MES), (ii) a 3’ modified end segment (3’-MES), and (iii) an internal ribosome entry site (IRES).

[0321] Gel Electrophoresis

[0322] Gel electrophoresis is used to rapidly evaluate the relative size, purity, and ribonuclease resistance of a composition containing RNA, with pure, non-degraded RNA producing a single band on a gel, and an impure or degraded composition devoidof RNA or containing multiple RNA molecules of different sizes multiple bands, or a smeared band, on a gel.

[0323] Liquid Chromatography Mass Spectroscopy (LCMS / MS)

[0324] Liquid chromatography-tandem mass spectrometry (LCMS / MS) is an analytical technique that yields accurate and reproducible information about the qualitative and quantitative characteristics of RNA modifications including the reaction efficiency of the capping, the % incorporation of internal modified nucleotide bases, the ligation efficiency of “durable” ends, degree of nuclease degradation of durable mRNA constructs, and sequencing of mRNA constructs.

[0325] 5’ Capping Efficiency using LCMS / MS

[0326] The simplest method of ribonucleotide resistance is the direct removal of the 5’-MES structure via ribonuclease with 5’to 3’ exonuclease RppH / XRN-1 at elevated temperature for a length of time usually 15 or more minutes. This liberates the 5' terminal MES containing structures are which then separated from the sample matrix using LCMS / MS.

[0327] A second example of efficiency is using a complementary DNA probe which hybridizes to the RNA sequence downstream of the 5’ end. Full-length mRNA is typically too large for standard LC / MS analysis, so smaller structures need to be generated to be analyzed in LC / MS. A DNA probe is used to hybridize 30 bases downstream of the 5’ end of RNA construct so that successful directed RNASE H cleavage occurs liberating this 30 bp fragment. The smaller fragment is measured for mass changes between unmodified RNA and 5’-MES modified RNA.

[0328] A third example of efficiency follows the same general method described above with the exception that a catalytic DNA probe (DNAzyme) is used which cleaves the RNA in a similar manner releasing a segment of know size to be measured by LC / MS.

[0329] Internal Modified Nucleotide by LC / MS

[0330] Characterization of modified nucleosides in RNA involves two types of analyses. Initially, the RNA is hydrolyzed to nucleosides and the resident modifications are measured. Subsequently, the RNA is digested to oligonucleotides and their nucleotide sequences are determined to locate the site of modification. Both types of analyses involve employment of reversed-phase liquid chromatography (RP-LC). RP-LC resolves molecules based on their hydrophobicity thereby reducing the complexity of sample mixture before mass spectrometric analysis. During nucleoside analysis, modified nucleosides may exhibit varied hydrophobicity depending on the attached chemical group, therefore, they are retained for different times on a reversed-phase column. The separated modified nucleosides are detected by a mass spectrometer connected directly to the liquid chromatography column. The nucleosides are identified by their characteristic mass-to-charge (m / z) values of ionized molecules in the gas phase. The modified nucleosides display a characteristic mass shift compared to canonical nucleoside depending on the attached chemical group.

[0331] High performance liquid chromatography (HPLC)

[0332] High performance liquid chromatography (HPLC) is used to purify the end modified RNA constructs (EM-RNA) at each step of the process. All RNA preparations are purified on a Thermo UltiMate3000 HPLC system using a RNASep Prep (ADS BIOTECH, Omaha, NE) column made up of 7.8 x 50 mm, non-porous PS\DVB resin matrix in a TEAA buffer matrix, per manufacturer’s instructions and methods. RNA is purified at each step of the process to allow for optimal development of the individual process involved in preparing the functional end modified RNA. These steps include: Process 1, 5’-MES co-transcriptionally modified IVT RNA, and Process 2, 3’-MES ligation to 5’-MES IVT RNA which produces the final RNA construct containing both 5’-MES and 3’-MES (see below).

[0333] PROCESS ONE

[0334] PROCESS TWO

[0335] FINAL PRODUCT

[0336]

[0337] HPLC is also used to measure 5’ and 3’ MES efficiencies using methods described for LCMS / MS above except that size only is used.

[0338] Cell-based Assays

[0339] Cell based screens are used to evaluate the effects on protein translation. Here these cell-based methods are used to evaluate the effect of protein translation our 5’and 3’ MES RNA. Modified and unmodified mRNAs, are transfected into separate populations of cells. Following transfection, the rates of protein production are evaluated by one of multiple methods known in the art, including flow cytometry and photo-microscopy.

[0340] Flow Cytometry

[0341] The flow cytometer, Miltenyi MacsQuant 10, evaluates the cells posttransfection by monitoring the eGFP protein expression which is quantitated in the “green” channel measuring fluorescence at 488 nm. Cells are transfected with 1 pg RNA / 1 e7 cells using 20 psi in the CellFE Infin ity / 8 pM chip system and plated in 6 well tissue culture plates. At various time points, the cells are harvested, spun and washed and diluted to 1.0 e6 cells / ml in a suitable buffer and examined in the MacsQuant 10. Proper gating (FSH / SSC) and green channel FL is established previously to ensure reproducible results over the time course examined. Efficiency (%) of transfection is established by examining control, un-transfected cells and transfected counterparts (Transfected fluorescence / Control fluorescence X 100). The shift in fluorescent signal over time from control is used for monitoring protein expression.

[0342] Quantitative Real-Time PCR (qPCR)

[0343] qPCR is used to determine RNA half-life (T1 / 2) is important for understanding mechanisms of gene expression that alters gene transcription levels and ultimately protein expression. Assays require high sensitivity and the ability to multiplex multiple RNA transcripts, real-time quantitative PCR (qPCR) is the method of choice. Therefore, a fast and reliable RNA half-life measurement method is used, based on real-time multiplexed fluorescence qPCR to compare the half-life length of the target eGFP mRNA. The multiplexed qPCR (2-plex) assay simultaneously measured the hydrolysis of two (2) different fluorophores on the TaqMan probe sequences of control and target eGFP RNA. Fluorescein (FAM) is synthesized on the control housekeeping TaqMan probe, hypoxanthine phosphoribosyltransferase (HRPT), while a Rhodamine fluorophore is synthesized on the TaqMan probe specific for the target eGFP RNA. The control gene (HRPT) is used as internal reference gene for mRNA stability since the expression levels in cells or copy number in the genome is shown to be constant. The end modified RNA constructs encoded the green fluorescent protein eGFP. Changes in RNA content in cellular samples after different transfected time periodswere determined by multiplex fluorescence quantitative PCR, and the half-live of the eGFP gene was established and assessed. Control or transfected cells are harvested, spun and washed prior to use in the qPCR assay. Pelleted cells (~1 e6 / ml) were frozen at -80 C over the course of the experiment to standardize the downstream assays and analysis.

[0344] Cell pellets are thawed and used directly in a One-Step qPCR kit. In another method the RNA was extracted using silica columns (QuantaBio, Beverly, MA). The resulting RNA can then be directly transcribed to cDNA and quantitated and stored at -80°C or used directly in a Two-Step qPCR kit (QuantaBio, Beverley MA). Real-time quantitative PCR analysis of the genes to evaluate the absolute or relative concentrations of mRNAs in each sample were generated automatically from the QuantaBio software.

[0345] Example 6. Proof of Cap-Independent Translation from a Linear RNA Construct.

[0346] In many cases, the linear mRNA comprising (i) a 5’ modified end segment (5’-MES), (ii) a 3’ modified end segment (3’-MES), and (iii) an internal ribosome entry site (IRES) has a 5’-MES that eliminates cap-dependent translation. This creates an mRNA construct according to the claims that produces protein only in a capindependent manner. The only method to validate this mechanism is to design a nearly identical sequence where the IRES is mutated or removed from the transcript to eliminate cap-independent translation in such a construct.

[0347] In this example, a mutated version of SEQ ID NO: 15 is generated that disrupts stems and loops of the iHRV-B3 IRES with a proximal loop Apt-elF4G insertion (SEQ ID NO: 16). The two transcripts are synthesized by IVT and both constructs also contain 5-methyl undine throughout the transcript to further enhance mRNA stability. The 5-methyl undine was incorporated by using of 5-methyluridine-5’-triphosphate during the IVT synthesis reaction (TriInk product N-1024).

[0348] AGGAAAUGAUGGAUGGACGCAUUAAAACAGCGGAUGGGUACGUACUUCGUACAAGUAACGUU AGAAGCUCCUUUGUACGCCUGUUCUUCCCAAAAAGUGGAUGUUGAACAUAUUACCCUUCCUG AACUUCCAACCCAACAUUUUUUGGGUGUCAGUACAACAGGAAGCACCACAUCCAGUGGUGUU UAGUACAGGGAAAGCACUUCUGUGCGCCCUUUCCCCGGAGCCGGGAGGUAUAGGCCAUGUG UACCCACUGGACUACGUAAGUUACCAACUAGCCUUCUUACUGUUCUUUAACUGUCGGUGUCG UGCGUUAUCCGCCAACCAUUCCCCUUAUCCACUAUAGUGUUAGUAUUAACUAGGUGUUUCUU AUUUUGUCUUUUCGAUCAGGUUCGAUGAGGAUCCCUAGGAACCCACGGGUGACCGCGGCCAAGUAUUAUGUUUCCCAGCCCACUCACUAUAGCUACCAACUUCUUAUGGUCACAGCAUAUAUGGC UGAUACUGUGAUCAUGGUGAGCAAGGGCGAGGAGCUGUUCACCGGGGUGGUGCCCAUCCUG GUCGAGCUGGACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCG AUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCC UGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCCGACCA CAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCA UCUUCUUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACC CUGGUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCA CAAGCUGGAGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAACGG CAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGACGGCAGCGUGCAGCUCGCCGACC ACUACCAGCAGAACACCCCCAUCGGCGACGGCCCCGUGCUGCUGCCCGACAACCACUACCUG AGCACCCAGUCCGCCCUGAGCAAAGACCCCAACGAGAAGCGCGAUCACAUGGUCCUGCUGGA GUUCGUGACCGCCGCCGGGAUCACUCUCGGCAUGGACGAGCUGUACAAGUGAUAAUAGGCU GGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCC UGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAA (SEQ ID NO: 16)

[0349] Both the original SEQ ID NO: 15 and the mutated SEQ ID NO: 16 contain 5’-MES mAs*mAs*rG and 3’-MES (SEQ ID NO: 17). 5’-MES addition is accomplished co-transcriptionally during IVT while the 3’-MES is ligated after IVT. 5’-MES addition modifies the first two nucleotides of SEQUENCE ID NO.s 15 and 16 while adding a modified adenosine to the 5’ terminus. The 3’-MES addition adds twelve adenosines to the 3’ terminus of SEQ ID NOS: 15 and 16. Prior to ligation, the 3’-MES contains a 5’ terminal monophosphate group, which facilitates the enzymatic ligation reaction. For 3’-MES mAs*mAs*rG, “mAs*” represents a 2’0-methyl adenosine, with an oxygen to sulphur replacement at two positions in the internucleoside linkage to create a phosphorodithioate at the internucleoside linkage that is positioned 3’ to the adenosine, and “rG” represents a ribonucleic guanosine.

[0350] AAAAAAAmAs*mAs*mAs*AddA (SEQ ID NO: 17)

[0351] “A” represents ribonucleic adenosine," mAs*” represents a 2’0-methyl adenosine, with an oxygen to sulphur replacement at two positions in the internucleoside linkage to create a phosphorodithioate at the internucleoside linkage that is positioned 3’ to the adenosine, and “ddA” represents dideoxy adenosine.

[0352] When transfected into a cell, the functional IRES produces eGFP protein, while the transcript containing the mutated IRES fails to produce any level of protein.Protein expression is assessed via flow cytometry and by overall fluorescence of aliquots of cell culture. Proof of mRNA stability and presence is measured via qPCR to demonstrate that the mRNA is still present in each case.

[0353] Example 7. Expression of Multiple ORFs using Multiple IRES in a Linear RNA Construct.

[0354] An advantage of a linear mRNA comprising (i) a 5’ modified end segment (5’-MES), (ii) a 3’ modified end segment (3’-MES), and (iii) an internal ribosome entry site (IRES) is the ability to package larger amounts of genetic information (e.g., peptide or protein coding sequence) as compared to another stable form of mRNA (circular mRNA). For example, multiple IRES and multiple ORF are inserted into a single construct. An alternative construct is the use of self-cleaving peptides to place control of multiple ORF under a single IRES. An example of this second design is the use of OFP (orange fluorescent protein), BFP (blue fluorescent protein) and eGFP, separated by T2Aand P2A self-cleaving peptide sequences under control of the iHRVwith elF4G proximal loop IRES to create an mRNA exceeding 3,000 bases in length (SEQ ID NO: 18). In each case expression of all fluorescent proteins is monitored in cells using a fluorescence-activated cell sorter (FACS).

[0355] AAGGAAAUGAUGGAUGGACGCAUUAAAACAGCGGAUGGGUACCCCACCAUCCGACCCACUGG GUGUAGUACUCUGGUACUUCGUACCUUUGUACGCCUGUUCUUCCCAUUGUACCCUUCCUGAA CUUCCAACCCAAGUAACGUUAGAAGCUCAACAUUUAGUACAACAGGAAGCACCACAUCCAGUG GUGUUUAGUACAAGCACUUCUGUUUCCCCGGAGCGAGGUAUAGGCUGUACCCACUGCCAAAA ACCUUUAACCGUUAUCCGCCAACCAACUACGUAAAAGCUAGUAGUAUUAUGUUUUUAACUAGG CGUUCGAUCAGGUGGAUUUCCCCUCCACUAGUUUGGUCGAUGAGGCUAGGAAUUCCCCACGG GUGACCGUGUCCUAGCCUGCGUGGCGGCCAACCCAGCCCACUCACUAUUUGUUUUCGCGCC CAGUUGCAAAAAGUGUCGGGGCUGGGACGCCUUUUUAUAGACAUGGUGUGAAGACUCGCAUG UGCUUGGUUGUGAUUCCUCCGGCCCCUGAAUGCGGCUAACCUUAACCCUGGAGCCUUGUGU CACAAACCAGUGAUGAUAAGGUCGUAAUGAGCAAUUCCGGGACGGGACCGACUACUUUGGGU GUCCGUGUUUCUUAUUUUUCUUAUUAUUGUCUUAUGGUCACAGCAUAUAUAUAACAUAUACUG UGAUCAUGGUGAGCAAGGGCGAGGAGCUGAUCAAGGAGAACAUGAGAAGCAAGCUGUACCUG GAAGGCAGCGUGAACGGCCACCAGUUCAAGUGCACCCACGAAGGGGAGGGCAAGCCCUACGA GGGCAAGCAGACCAACAGGAUCAAGGUGGUGGAGGGAGGCCCCCUGCCGUUCGCAUUCGAC AUCCUGGCCACCCACUUUAUGUACGGGAGCAAGGUGUUCAUCAAGUACCCCGCCGACCUCCC CGAUUAUUUUAAGCAGUCCUUCCCUGAGGGCUUCACAUGGGAGAGAGUCAUGGUGUUCGAAG ACGGGGGCGUGCUGACCGCCACCCAGGACACCAGCCUCCAGGACGGCGAGCUCAUCUACAACGUCAAGGUCAGAGGGGUGAACUUCCCAGCCAACGGCCCCGUGAUGCAGAAGAAAACACUGGG CUGGGAGCCCAGCACCGAGACCAUGUACCCCGCUGACGGCGGCCUGGAAGGCAGAUGCGAC AAGGCCCUGAAGCUCGUGGGCGGGGGCCACCUGCACGUCAACUUCAAGACCACAUACAAGUC CAAGAAACCCGUGAAGAUGCCCGGCGUCCACUACGUGGACCGCAGACUGGAAAGAAUCAAGG AGGCCGACAACGAGACCUACGUCGAGCAGUACGAGCACGCUGUGGCCAGAUACUCCAACCUG GGCGGAGGCAUGGACGAGCUGUACAAGGGAAGCGGAGAGGGCAGGGGAAGUCUUCUAACAU GCGGGGACGUGGAGGAAAAUCCCGGCCCCAUGAGCGAGCUGAUUAAGGAGAACAUGCACAUG AAGCUGUACAUGGAGGGCACCGUGGACAACCAUCACUUCAAGUGCACAUCCGAGGGCGAAGG CAAGCCCUACGAGGGCACCCAGACCAUGAGAAUCAAGGUGGUCGAGGGCGGCCCUCUCCCCU UCGCCUUCGACAUCCUGGCUACUAGCUUCCUCUACGGCAGCAAGACCUUCAUCAACCACACC CAGGGCAUCCCCGACUUCUUCAAGCAGUCCUUCCCUGAGGGCUUCACAUGGGAGAGAGUCAC CACAUACGAAGACGGGGGCGUGCUGACCGCUACCCAGGACACCAGCCUCCAGGACGGCUGCC UCAUCUACAACGUCAAGAUCAGAGGGGUGAACUUCACAUCCAACGGCCCUGUGAUGCAGAAG AAAACACUCGGCUGGGAGGCCUUCACCGAGACGCUGUACCCCGCUGACGGCGGCCUGGAAG GCAGAAACGACAUGGCCCUGAAGCUCGUGGGCGGGAGCCAUCUGAUCGCAAACGCCAAGACC ACAUAUAGAUCCAAGAAACCCGCUAAGAACCUCAAGAUGCCUGGCGUCUACUAUGUGGACUAC AGACUGGAAAGAAUCAAGGAGGCCAACAACGAGACCUACGUCGAGCAGCACGAGGUGGCAGU GGCCAGAUACUGCGACCUCCCUAGCAAACUGGGGCACAAGCUUAAUGGAAGCGGAGCCACGA ACUUCUCUCUGUUAAAGCAAGCAGGAGAUGUUGAAGAAAACCCCGGGCCUAUGGUGAGCAAG GGCGAGGAGCUGUUCACCGGGGUGGUGCCCAUCCUGGUCGAGCUGGACGGCGACGUAAACG GCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCU GAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCUGA CCUACGGCGUGCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAG UCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAACUA CAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCGCAUCGAGCUGAAG GGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACAACAG CCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAACGGCAUCAAGGUGAACUUCAAGAUCCG CCACAACAUCGAGGACGGCAGCGUGCAGCUCGCCGACCACUACCAGCAGAACACCCCCAUCG GCGACGGCCCCGUGCUGCUGCCCGACAACCACUACCUGAGCACCCAGUCCGCCCUGAGCAAA GACCCCAACGAGAAGCGCGAUCACAUGGUCCUGCUGGAGUUCGUGACCGCCGCCGGGAUCAC UCUCGGCAUGGACGAGCUGUACAAGUGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUU GCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUU GAAUAAAGUCUGAAAAAAAAAAAAAA (SEQ ID NO:18)

[0356] The initial three nucleotides of “AAG” at the 5’ end of SEQ ID NO: 18 contains internucleoside modifications and represents the 5’-MES and the final twelve nucleotides of “AAAAAAAAAAAA” at 3’ end contains internucleoside modifications and represents the 3’-MES (SEQ ID NO: 17).Example 8. Expression of Erythropoietin from a Linear RNA Construct.

[0357] The use of a linear mRNA comprising (i) a 5’ modified end segment (5’-MES), (ii) a 3’ modified end segment (3’-MES), and (iii) an internal ribosome entry site (IRES) with enhanced in vivo stability has tremendous advantages in producing protein over extended periods of time for clinical therapeutic applications, opening up applications not previously addressed by short-lived mRNA species. For example, chimeric antigen receptors (CAR) are transiently expressed for over a week in T cells (CAR-T cells). Another use is the production of erythropoietin in vivo by placing the protein under control of the EMCV (Encephalomyocarditis virus IRES and 3’ UTR) using the below construct (SEQ ID NO: 19).

[0358] GAAGGAAAUGAUGGAUGGACGCACCCCUCUCCCUCCCCCCCCCCUAACGUUACUGGCCGAAG CCGCUUGGAAUAAGGCCGGUGUGCGUUUGUCUAUAUGUUAUUUUCCACCAUAUUGCCGUCUU UUGGCAAUGUGAGGGCCCGGAAACCUGGCCCUGUCUUCUUGACGAGCAUUCCUAGGGGUCU UUCCCCUCUCGCCAAAGGAAUGCAAGGUCUGUUGAAUGUCGUGAAGGAAGCAGUUCCUCUGG AAGCUUCUUGAAGACAAACAACGUCUGUAGCGACCCUUUGCAGGCAGCGGAACCCCCCACCU GGCGACAGGUGCCUCUGCGGCCAAAAGCCACGUGUAUAAGAUACACCUGCAAAGGCGGCACA ACCCCAGUGCCACGUUGUGAGUUGGAUAGUUGUGGAAAGAGUCAAAUGGCUCUCCUCAAGCG UAUUCAACAAGGGGCUGAAGGAUGCCCAGAAGGUACCCCAUUGUAUGGGAUCUGAUCUGGGG CCUCGGUGCACAUGCUUUACAUGUGUUUAGUCGAGGUUAAAAAACGUCUAGGCCCCCCGAAC CACGGGGACGUGGUUUUCCUUUGAAAAACACGAUGAUAAUAUGGGCGUGCACGAGUGCCCCG CCUGGCUGUGGCUGCUGCUGAGCCUGCUGAGCCUGCCCCUGGGCCUGCCCGUGCUGGGCG CCCCCCCCCGGCUGAUCUGCGACAGCCGGGUGCUGGAGCGGUACCUGCUGGAGGCCAAGGA GGCCGAGAACAUCACCACCGGCUGCGCCGAGCACUGCAGCCUGAACGAGAACAUCACCGUGC CCGACACCAAGGUGAACUUCUACGCCUGGAAGCGGAUGGAGGUGGGCCAGCAGGCCGUGGA GGUGUGGCAGGGCCUGGCCCUGCUGAGCGAGGCCGUGCUGCGGGGCCAGGCCCUGCUGGU GAACAGCAGCCAGCCCUGGGAGCCCCUGCAGCUGCACGUGGACAAGGCCGUGAGCGGCCUG CGGAGCCUGACCACCCUGCUGCGGGCCCUGGGCGCCCAGAAGGAGGCCAUCAGCCCCCCCG ACGCCGCCAGCGCCGCCCCCCUGCGGACCAUCACCGCCGACACCUUCCGGAAGCUGUUCCG GGUGUACAGCAACUUCCUGCGGGGCAAGCUGAAGCUGUACACCGGCGAGGCCUGCCGGACC GGCGACCGGUGAUGAUAAUAGUGUAGUCACUGGCACAACGCGUUACCCGGUAAGCCAAUCGG GUAUACACGGUCGUCAUACUGCAGACAGGGUUCUUCUACUUUGCAAGAUAGUCUAGAGUAGU AAAAUAAAUAGATAGAGAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 19)

[0359] The initial four nucleotides of “GAAG” at the 5’ end contain internucleoside modifications and represent the 5’-MES (rG] [mAs*] - [mAs*] [rG]), where “rG” represents a ribonucleic guanosine, “mAs*” represents a 2’0-methyl adenosine, withan oxygen to sulphur replacement at two positions in the internucleoside linkage to create a phosphorodithioate at the internucleoside linkage that is positioned 3’ to the adenosine, and “ - ” represents an inverted internucleoside linkage where the two adenosines are linked in a 5’ to 5’ manner with a single phosphodiester bond. The final twelve nucleotides of “AAAAAAAAAAAA” at 3’ end contain internucleoside modifications and represents the 3’-MES (SEQ ID NO: 17).

[0360] The linear mRNA construct is packaged into a liposomal nanoparticle and injected into a patient to stimulate the bone marrow to create red blood cells and restore health, such as after cancer treatment.

[0361] Example 9. Internal Ribosome Entry Sites (IRES).

[0362] The following are nonlimiting examples of IRES suitable for use in the present linear RNA constructs. Any of the following can be combined in a single linear RNA construct, in any order, and can be combined with any 5’-MES and any 3’-MES.

[0363] CVB3 from Coxsackie Virus B3 IRES

[0364] Nucleosides 1-742 of the CVB3 virus genome UAAAACAGCCUGUGGGUUGAUCCCACCCACAGGGCCUAUUGGGCGCUAGCACUCUGGUAUCA CGGUACCUUUGUGCGCCUGUUUUAUAUCCCCUCCCCCAACUGUAACUUAGAAGUAACACACU CCGAUCAACAGUCAGCGUGGCACACCAGCCAUGUUUUGAUCAAGCACUUCUGUUACCCCGGA CUGAGUAUCAAUAGACUGCUCACGCGGUUGAAGGAGAAAGCGUUCGUUAUCCGGCCAACUAC UUCGAAAAACCCAGUAACACCAUAGAGGUUGCAGAGUGUUUCGCUCAGCACUACCCCAGUGU AGACCAGGCCGAUGAGUCACCGCAUUCCCCACGGGCGACCGUGGCGGUGGCUGCGUUGGCG GCCUGCCUAUGGGGAAACCCAUAGGACGCUCUAAUACAGACAUGGUGCGAAGAGUCUAUUGA GCUAGUUGGUAAUCCUCCGGCCCCUGAAUGCGGCUAAUCCUAACUGCGGACAGCACACCCUC AAACCAGAGGGCAGUGUGUCGUAACGGGCAACUCUGCAGCGGAACCGACUACUUUGGGUGUC CGUGUUUCAUUUUAUUCCUAUACUGGCUGCUUAUGGUGACAAUUGAGAGAUUGUUACCAUAU AGCUAUUGGAUUGGCCAUCCGGUGUCUAAUAGAGCUAUUAUAUAUCUCUUUGUUGGAUUUAU ACCACUUAGCUUGAGAGAGGUUAAAACAUUACAAUUCAUUGUUAAAUUGAAUACAACAAAAUG GCAGCUCAA (SEQ ID NO:20)

[0365] A synthetic variation of the CVB3 IRES with a proximal loop containing Apt-elF4G insertion.

[0366] UUAAAACAGCCUGUGGGUUGAUCCCACCCACAGGCCCAUUGGGCGCUAGCACUCUGGUAUCA CGGUACCUUUGUGCGCCUGUUUUAUACCCCCUCCCCCAACUGUAACUUAGAAGUAACACACA CCGAUCAACAGUCAGCGUGGCACACCAGCCACGUUUUGAUCAAGCACUUCUGUUACCCCGGACUGAGUAUCAAUAGACUGCUCACGCGGUUGAAGGAGAAAGCGUUCGUUAUCCGGCCAACUAC UUCGAAAAACCUAGUAACACCGUGGAAGUUGCAGAGUGUUUCGCUCAGCACUACCCCAGUGU AGAUCAGGUCGAUGAGUCACCGCAUUCCCCACGGGCGACCGUGGCGGUGGCUGCGUUGGCG GCCUGCCCAUGGGACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAAGUGUCGCCCAUGGGA CGCUCUAAUACAGACAUGGUGCGAAGAGUCUAUUGAGCUAGUUGGUAGUCCUCCGGCCCCUG AAUGCGGCUAAUCCUAACUGCGGAGCACACACCCUCAAGCCAGAGGGCAGUGUGUCGUAACG GGCAACUCUGCAGCGGAACCGACUACUUUGGGUGUCGUGUUUCAUUUUAUUCCUAUACUGGC UGCUUAUGGUGACAAUUGAGAGAUCGUUACCAUAUAGCUAUUGGAUUGGCCAUCCGGUGACU AAUAGAGCUAUUAUAUAUCCCUUUGUUGGGUUUAUACCACUUAGCUUGAAAGAGGUUAAAACA UUACAAUUCAUUGUUAAGUUGAAUACAGCAAA (SEQ ID NO:21)

[0367] HCV from Hepatitis C Virus GCCAGCCCCCGAUUGGGGGCGACACUCCACCAUAGAUCACUCCCCUGUGAGGAACUACUGUC UUCACGCAGAAAGCGUCUAGCCAUGGCGUUAGUAUGAGAGUCGUGCAGCCUCCAGGACCCCC CCUCCCGGGAGAGCCAUAGUGGUCUGCGGAACCGGUGAGUACACCGGAAUUGCCAGGACGA CCGGGUCCUUUCUUGGAUCAACCCGCUCAAUGCCUGGAGAUUUGGGCGUGCCCCCGCAAGA CUGCUAGCCGAGUAGUGUUGGGUCGCGAAAGGCCUUGUGGUACUGCCUGAUAGGGUGCUUG CGAGUGCCCCGGGAGGUCUCGUAGACCGUGCACCAUGAGCACGAAUCCUAAACCUCAAAGAA AAACCAAACGUAAC (SEQ ID NO:22)

[0368] EMCV from Encephalomyocarditis Virus

[0369] Nucleosides 1-833 of virus genome UUGAAAGCCGGGGGUGGGAGAUCCGGAUUGCCAGUCUGCUCGAUAUCGCAGGCUGGGUCCG UGACUACCCACUCCCCCUUUCAACGUGAAGGCUACGAUAGUGCCAGGGCGGGUACUGCCGUA AGUGCCACCCCAAAAUAACAACAGACCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC

[0370] cccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccc CCCCCCCCCCCCCCCUCUCCCUCCCCCCCCCCUAACGUUACUGGCCGAAGCCGCUUGGAAUA AGGCCGGUGUGCGUUUGUCUAUAUGUUAUUUUCCACCAUAUUGCCGUCUUUUGGCAAUGUGA GGGCCCGGAAACCUGGCCCUGUCUUCUUGACGAGCAUUCCUAGGGGUCUUUCCCCUCUCGC CAAAGGAAUGCAAGGUCUGUUGAAUGUCGUGAAGGAAGCAGUUCCUCUGGAAGCUUCUUGAA GACAAACAACGUCUGUAGCGACCCUUUGCAGGCAGCGGAACCCCCCACCUGGCGACAGGUGC CUCUGCGGCCAAAAGCCACGUGUAUAAGAUACACCUGCAAAGGCGGCACAACCCCAGUGCCA CGUUGUGAGUUGGAUAGUUGUGGAAAGAGUCAAAUGGCUCUCCUCAAGCGUAUUCAACAAGG GGCUGAAGGAUGCCCAGAAGGUACCCCAUUGUAUGGGAUCUGAUCUGGGGCCUCGGUGCAC AUGCUUUACAUGUGUUUAGUCGAGGUUAAAAAACGUCUAGGCCCCCCGAACCACGGGGACGU GGUUUUCCUUUGAAAAACACGAUGAUAAU (SEQ ID NO:23)

[0371] EMCV Variant

[0372] Nucleosides 260-833 of EMCV virus genomeCCCCUCUCCCUCCCCCCCCCCUAACGUUACUGGCCGAAGCCGCUUGGAAUAAGGCCGGUGUG CGUUUGUCUAUAUGUUAUUUUCCACCAUAUUGCCGUCUUUUGGCAAUGUGAGGGCCCGGAAA CCUGGCCCUGUCUUCUUGACGAGCAUUCCUAGGGGUCUUUCCCCUCUCGCCAAAGGAAUGCA AGGUCUGUUGAAUGUCGUGAAGGAAGCAGUUCCUCUGGAAGCUUCUUGAAGACAAACAACGU CUGUAGCGACCCUUUGCAGGCAGCGGAACCCCCCACCUGGCGACAGGUGCCUCUGCGGCCA AAAGCCACGUGUAUAAGAUACACCUGCAAAGGCGGCACAACCCCAGUGCCACGUUGUGAGUU GGAUAGUUGUGGAAAGAGUCAAAUGGCUCUCCUCAAGCGUAUUCAACAAGGGGCUGAAGGAU GCCCAGAAGGUACCCCAUUGUAUGGGAUCUGAUCUGGGGCCUCGGUGCACAUGCUUUACAUG UGUUUAGUCGAGGUUAAAAAACGUCUAGGCCCCCCGAACCACGGGGACGUGGUUUUCCUUUG AAAAACACGAUGAUAAU (SEQ ID NO:24)

[0373] Cricket Paralysis Virus Interqenic Region IRES (CrPV IGR)

[0374] Nucleosides 6025-6216 from viral genome UUCUAGCACUAGUAAAGCAAAAAUGUGAUCUUGCUUGUAAAUACAAUUUUGAGAGGUUAAUAA AUUACAAGUAGUGCUAUUUUUGUAUUUAGGUUAGCUAUUUAGCUUUACGUUCCAGGAUGCCU AGUGGCAGCCCCACAAUAUCCAGGAAGCCCUCUCUGCGGUUUUUCAGAUUAGGUAGUCGAAA AACCUAAGAAAUUUACCU (SEQ ID NO:25)

[0375] CrPV Variant UUCUAGCACUAGUAAAGCAAAAAUGUGAUCUUGCUUGUAAAUACAAUUUUGAGAGGUUAAUAA AUUACAAGUAGUGCUAUUUUUGUAUUUAGGUUAGCUAUUUAGCUUUACGUUCCAGGAUGCCU AGUGGCAGCCCCACAAUAUCCAGGAAGCCCUCUCUGCGGUUUUUCAGAUUAGGGCGUCGAAA AACCUAAGAAAUUGCCCU (SEQ ID NO:26)

[0376] Human Rhinovirus B3 Internal IRES (iHRV B3) UUAAAACAGCGGAUGGGUACCCCACCAUCCGACCCACUGGGUGUAGUACUCUGGUACUUCGU ACCUUUGUACGCCUGUUCUUCCCAUUGUACCCUUCCUGAACUUCCAACCCAAGUAACGUUAG AAGCUCAACAUUUAGUACAACAGGAAGCACCACAUCCAGUGGUGUUUAGUACAAGCACUUCUG UUUCCCCGGAGCGAGGUAUAGGCUGUACCCACUGCCAAAAACCUUUAACCGUUAUCCGCCAA CCAACUACGUAAAAGCUAGUAGUAUUAUGUUUUUAACUAGGCGUUCGAUCAGGUGGAUUUCC CCUCCACUAGUUUGGUCGAUGAGGCUAGGAAUUCCCCACGGGUGACCGUGUCCUAGCCUGC GUGGCGGCCAACCCAGCUUAUGCUGGGACGCCUUUUUAUAGACAUGGUGUGAAGACUCGCAU GUGCUUGGUUGUGAUUCCUCCGGCCCCUGAAUGCGGCUAACCUUAACCCUGGAGCCUUGUG UCACAAACCAGUGAUGAUAAGGUCGUAAUGAGCAAUUCCGGGACGGGACCGACUACUUUGGG UGUCCGUGUUUCUUAUUUUUCUUAUUAUUGUCUUAUGGUCACAGCAUAUAUAUAACAUAUACU GUGAUC (SEQ ID NO:27)

[0377] IHRV-B3 IRES VariantUUAAAACAGCGGAUGGGUACCCCACCAUCCGACCCACUGGGUGUAGUACUCUGGUACUUCGU ACCUUUGUACGCCUGUUCUUCCCAUUGUACCCUUCCUGAACUUCCAACCCAAGUAACGUUAG AAGCUCAACAUUUAGUACAACAGGAAGCACCACAUCCAGUGGUGUUUAGUACAAGCACUUCUG UUUCCCCGGAGCGAGGUAUAGGCUGUACCCACUGCCAAAAACCUUUAACCGUUAUCCGCCAA CCAACUACGUAAAAGCUAGUAGUAUUAUGUUUUUAACUAGGCGUUCGAUCAGGUGGAUUUCC CCUCCACUAGUUUGGUCGAUGAGGCUAGGAAUUCCCCACGGGUGACCGUGUCCUAGCCUGC GUGGCGGCCAACCCAGCCCACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAAGUGUCGGGG CUGGGACGCCUUUUUAUAGACAUGGUGUGAAGACUCGCAUGUGCUUGGUUGUGAUUCCUCC GGCCCCUGAAUGCGGCUAACCUUAACCCUGGAGCCUUGUGUCACAAACCAGUGAUGAUAAGG UCGUAAUGAGCAAUUCCGGGACGGGACCGACUACUUUGGGUGUCCGUGUUUCUUAUUUUUCU UAUUAUUGUCUUAUGGUCACAGCAUAUAUAUAACAUAUACUGUGAUC (SEQ ID NO:28)

[0378] For further IRES that can be used in the present constructs, see Kerr, Craig H., et al. "Molecular analysis of the factorless internal ribosome entry site in Cricket Paralysis virus infection." Scientific Reports 6.1 (2016): 37319; and Chen R, Wang SK, Belk JA, Amaya L, Li Z, Cardenas A, Abe BT, Chen CK, Wender PA, Chang HY. Engineering circular RNA for enhanced protein production. Nat Biotechnol. 2023 Feb;41(2):262-272. Each of the aforementioned publications is hereby incorporated by reference in its entirety.

[0379] As used herein, "consisting essentially of" allows the inclusion of materials or steps that do not materially affect the basic and novel characteristics of the claim. Any recitation herein of the term "comprising", particularly in a listing of components of a composition or elements of a device, constitutes inclusion of alternative embodiments in which “comprising” is replaced with "consisting essentially of" or "consisting of".

[0380] While the present invention has been described in conjunction with certain preferred embodiments, one of ordinary skill, after reading the foregoing specification, will be able to effect various changes, substitutions of equivalents, and other alterations to the compositions and methods set forth herein.

Claims

CLAIMSWhat is claimed is:

1. A linear RNA molecule comprising (i) a 5’ modified end segment (5’-MES), (ii) a 3’ modified end segment (3’-MES), and (iii) an internal ribosome entry site (IRES); wherein the 5’-MES reduces exonuclease-mediated degradation of the linear RNA molecule from its 5’ end and the 3’-MES reduces exonuclease-mediated degradation of the linear RNA molecule from its 3’ end.

2. The linear RNA molecule of claim 1 , wherein the linear RNA molecule is translatable in a cap-independent manner.

3. The linear RNA molecule of claim 1 , wherein the linear RNA molecule is not translatable in a cap-dependent manner.

4. The linear RNA molecule of claim 1 , wherein the 5’-MES and / or the 3’-MES comprise one or more internucleoside linkages selected from the group consisting of a carbophosphonate, a methylphosphonate, an ethylphosphonate, a phenylphosphonate, a pyridyl carbophosphonate, an aminomethylphosphonate, an aminoethylphosphonate, a phosphonoacetate, a phosphonoformate, a thiophosphonoacetate, a methanephosphonamidate, a phosphoram idite, a phosphorodiamidate, a phosphorodithioate, a thionophosphate, an alaninolphosphotriester, an S-methylthiourea, an inverted 3’ to 3’ internucleoside linkage, an inverted 5’ to 5’ internucleoside linkage, a peptide nucleic acid (PNA) linkage, a threose nucleic acid (TNA) linkage, and a morpholino nucleic acid (MNA) linkage.

5. The linear RNA molecule of claim 1 , further comprising one or more modifications to an internucleoside linkage or to a base between the 5’-MES and the 3’-MES, said one or more modifications reducing endonuclease-mediated degradation of the linear RNA molecule.

6. The linear RNA molecule of claim 5, wherein the one or more modifications between the 5’-MES and the 3’-MES are selected from the group consisting of a pseudouridine, an N1 -methylpseudouridine, a 5-alkyl pyrimidine, a 5-O-alkyl pyrimidine, a 5-halo pyrimidine, a 7-deaza-guanosine, and a phosphorothioate internucleoside linkage located 5’ to a pyrimidine, and wherein the linear RNA molecule is translatable.

7. The linear RNA molecule of claim 1 that is resistant to exonuclease degradation by 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, 98% or more, or 99% or more compared to a linear RNA molecule having an identical nucleotide sequence but lacking said 5’-MES and said 3’-MES, and lacking a cap, wherein said exonuclease degradation is measured using an in vitro assay comprising exposure to a 5’ exonuclease and / or a 3’ exonuclease selected from the group consisting of XRN1, RNase R, and an exosome complex.

8. The linear RNA molecule of claim 1 that is resistant to exonuclease degradation by 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, 98% or more, or 99% or more compared to a second linear RNA molecule having an identical nucleotide sequence to said linear RNA molecule but lacking said 5’-MES and said 3’-MES and instead comprising a 5’ 7-methylguanosine (m7G) linked to a first nucleotide by a 5'-5' triphosphate internucleoside linkage and a 3' poly adenosine tail, wherein said exonuclease degradation is measured using an in vitro assay comprising exposure to a decapping enzyme, a 5’ exonuclease, and a 3’ exonuclease selected from the group consisting of RppH, XRN1, and RNase R.

9. The linear RNA molecule of claim 1 that is degraded by 1 % or less, 2% or less, 5% or less, 10% or less, 20% or less, 30% or less, 40% or less, or 50% or less after in vitro exposure to a 5’ and / or a 3’ exonuclease selected from the group consisting of XRN1, RNase R, and an exosome complex for 12 hours at 37°C.

10. The linear RNA molecule of claim 1 , further comprising one or more translatable coding sequences.

11. A pharmaceutical composition comprising the linear RNA molecule of claim 1 and one or more excipients.

12. A delivery vehicle comprising the linear RNA molecule of claim 1 packaged in or with a polymeric complex or nanoparticle, liposome, or lipid carrier.

13. A kit for making the linear RNA molecule of claim 1 , the kit comprising a 5’-MES and a 3’-MES, and optionally one or more reagents for bonding the 5’-MES and the 3’-MES to a user-supplied linear RNA containing an IRES.

14. A method of making the linear RNA molecule of claim 1 , the method comprising the steps of:(a) providing a 5’-MES, a 3’-MES, and a linear RNA segment comprising an IRES;(b) covalently bonding the 5’-MES to a 5’ end of the linear RNA segment; and (c) covalently bonding the 3’-MES to a 3’ end of the linear RNA segment, thereby making the linear RNA molecule of claim 1.

15. The method of making of claim 14, whereby the covalently bonding of (b) and / or (c) comprises use of a ligase, click chemistry, or in vitro transcription.

16. The method of making of claim 14, further comprising adding a 5’ monophosphate, 5’ diphosphate, a 5' adenosine diphosphate, or a 5’ click chemistry group to either a 5’-MES, a 3’-MES, or a linear RNA segment comprising an IRES.

17. The method of making of claim 14, wherein the linear RNA segment further comprises a coding sequence.

18. The method of claim 14, further comprising treating the product of (c) with an exonuclease to remove RNA molecules that do not contain a 5’-MES or a 3’-MES.

19. A method of transfecting a cell, the method comprising introducing the linear RNA molecule of claim 1 into a cell.

20. The method of claim 19, wherein the linear RNA molecule comprises a coding sequence, and whereby a polypeptide is expressed in the cell from the coding sequence.

21. The method of claim 19, wherein the linear RNA molecule has a half-life in the cell of at least 12 hours, at least 18 hours, at least 24 hours, at least 48 hours, at least 72 hours, at least 4 days, at least 5 days, at least 7 days, at least 10 days, or at least 14 days.

22. The method of claim 20, whereby a polypeptide is expressed in the cell from the coding sequence, and whereby a rate of expression in the cell of the polypeptide declines with a half-life of at least 12 hours, at least 18 hours, at least 24 hours, at least 48 hours, at least 72 hours, at least 4 days, at least 5 days, at least 7 days, at least 10 days, or at least 14 days.

23. The method of claim 19, wherein the linear RNA molecule is administered to a human or non-human mammalian subject.

24. The method of claim 23, wherein the human or non-human mammalian subject has or is suspected of having a disease or medical condition, and wherein the disease or medical condition is at least in part treated or prevented.

25. The method of claim 24, wherein the disease or medical condition is selected from the group consisting of a cancer, a neoplastic disease, an infectious disease, a genetic disease, a metabolic disease, an autoimmune disease, an ocular disease, a cardiovascular condition, a wound, a neurological condition, an immunological condition, ora dermatological condition.