Fish pathogenic virus
By identifying and isolating the barramundi herpesvirus, vaccines and diagnostic tools have been developed, solving the problem of detection and prevention of desquamation disease in Asian sea bass and reducing the impact of the disease.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INTERVET INT BV
- Filing Date
- 2017-08-10
- Publication Date
- 2026-06-09
AI Technical Summary
Existing technologies have failed to effectively identify and address the emerging disease of desquamation in Asian sea bass, leading to high mortality and serious health problems.
A novel virus belonging to the Heteroherpesviridae family, named LCHV, was identified and isolated. Corresponding vaccines and diagnostic test kits were developed, and the presence of the virus was confirmed by PCR testing and gene sequence comparison.
It provides detection methods and vaccines to combat Asian sea bass desquamation disease, reducing the incidence and mortality of the disease and ensuring the health management of fish farms.
Smart Images

Figure GDA0003659266580000031 
Figure GDA0003659266580000041 
Figure GDA0003659266580000191
Abstract
Description
Invention Field
[0001] This invention relates to a fish pathogenic virus that causes disease in fish, comprising a cell culture of the virus, a DNA fragment of the virus and a corresponding protein, a vaccine based on the virus, DNA and / or protein, an antibody that reacts with the virus, and a diagnostic test kit for detecting the virus.
[0002] General background
[0003] In recent decades, a rapid increase in fish consumption has been observed worldwide. This is equally true for cold-water fish (such as salmon, turbot, halibut, and cod) and tropical fish (such as Asian sea bass (Australian lungfish), tilapia, flounder, yellowtail, amberjack, grouper, and cobia). Consequently, an increase in the number and size of fish farms has been observed to meet the growing market demand. As is known from livestock farming, for example, the densely packed large numbers of animals are susceptible to all types of diseases, even those that were virtually unknown or unseen before the era of large-scale commercial livestock farming. The same is true for fish farming.
[0004] In 2015, an outbreak of a novel disease was reported in fish farms (particularly in Vietnam and Singapore) in Asian sea bass (Latescalcarifer). Fish were observed exhibiting scale drop-like symptoms. Scale drop disease is caused by a virus of the family Iridoviridae, recently isolated and described in WO2014 / 191445. However, these cases were negative for scale drop disease when tested using scale drop virus DNA-specific PCR primers. When found in the field (e.g., in fish farms, and therefore not in a controlled laboratory setting), the main clinical signs typically associated with this novel disease (not necessarily all of these symptoms are seen in every affected fish) can be described as follows.
[0005] The disease presents with acute onset of clinical signs and a high morbidity rate, affecting many fish, with mortality rates as high as 60% (typically 30-70%) within 4-7 days of clinical onset. These clinical signs can be described as follows: Affected fish exhibit systemic skin lesions, become lethargic, and show marked loss of appetite. As the disease progresses, the skin lesions become more severe, leading to darkening of the skin and pale white patches and erosions on the fins and tail, giving the fish a ghostly appearance. The eyes become swollen and slightly cloudy. Internal signs frequently observed include enlarged spleen and kidneys. The kidneys become fragile and easily detached. Some pale liver tissue can often be observed. As the disease progresses, the gills become pale.
[0006] Purpose of the invention
[0007] The purpose of this invention is to provide the pathogen of this disease. This enables the provision of detection methods and vaccines designed to combat said disease. Invention Overview
[0009] The pathogen of the disease described above has been identified as a member of the Alloherpesviridae family. It is an icosahedral virus belonging to the double-stranded DNA virus family. This virus shares some, but low, similarity with viruses in the Alloherpesviridae family, a family of herpesviruses pathogenic to fish and amphibians. Viruses in the Alloherpesviridae family are enveloped and have icosahedral to spherical to polymorphic geometries. They are approximately 150-200 nm in diameter. The genome is linear and non-segmented, with a length of approximately 100-250 kbp.
[0010] The virus of this invention has a genome of approximately 130 kbp. Figure 1 Displaying a phylogenetic tree that indicates the relationship between known anomalous herpesviruses and newly discovered viruses. The new virus is referred to as LatesCalcarifer Herpes Virus (LCHV) in this tree. The tree was created using MEGA program version 5 and standard settings. (MEGA5: Molecular Evolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Koichiro Tamura, Daniel Peterson, Nicholas Peterson, Glen Stecher, Masatoshi Nei and Sudhir Kumar. Mol. Biol. Evol. 28(10): 2731-2739. 2011 doi: 10.1093 / molbev / msr121 AdvanceAccess published May 4, 2011).
[0011] The family Heteroherpesviridae, and more specifically, the family of Heteroherpesviridae found in fish, is outlined in a review paper by Hanson, L. et al. (Viruses 3: 2160-2191, 2011). The herpesvirus according to the invention has been found in Asian sea bass (barracuda). To date, no herpesviruses pathogenic to Asian sea bass have been described. Pathogenicity to other (sub)tropical fish cannot be ruled out. Among the known Heteroherpesviridae, Ictaluridherpesvirus 1 (IHV1) is the closest known member. This virus is pathogenic to channel catfish. However, the overall sequence identity at the nucleotide level between the virus according to the invention and Ictaluridherpesvirus 1 is well below 60%. The sequence identity is even lower with more distantly related Anguilid Herpesvirus (AHV) and Koi Herpesvirus (KHV). Table 1 shows a comparison between several genes identified in the novel herpesvirus and their homologs in IHV1. The table shows the most important identified ORFs (left column), provided that identified ORFs with fewer than 300 base pairs were not used in the sequence numbering (and are simply ignored for the purposes of this table). The table shows the location on the DNA (for a representative example of a virus, deposited at the Pasteur Institute, see below), the corresponding ORF in IHV1, and the level of amino acid sequence identity with these known ORFs.
[0012] A representative example of the virus has been deposited at the National Collection of Cultures of Microorganisms (CNCM), Pasteur Institute, 25 Rue du Docteur Roux, F-75724 Paris Cedex 15, France, with accession number CNCM I-5118 (Peresk herpesvirus).
[0013] Table 1: Comparison of the herpesvirus of the present invention with IHV1
[0014]
[0015]
[0016] Explanation of Table 1
[0017] ORF: Open Reading Frame (number) in LCHV
[0018] Reading frames: Reading frames on the genome (1, 2, 3, negative numbers indicate opposite strands).
[0019] Length: Length of LCHV ORF in base pairs
[0020] AA length: The length of an amino acid hit in a BLAST search.
[0021] IHV Id.: Percentage amino acid identity between LCHV ORF and the corresponding IHV ORF
[0022] IHV-1: Catfish Herpesvirus-1
[0023] Homologous: The presumed function of a protein encoded by an LHCV ORF based on its homology with known proteins.
[0024] definition
[0025] The current wild-type form of the virus is a replicative form, which can be isolated from diseased fish, particularly Asian sea bass, and can induce the same disease in healthy fish of the same species from which the wild-type form of the virus has been isolated. By definition, an inactivated or attenuated wild-type virus can induce disease in its wild-type form.
[0026] An isolated virus is one that is released from tissues normally associated with the virus in a diseased host in nature and transferred to a container, such as a dish, flask, or bioreactor, in the absence of other viruses and bacteria. An example of an isolated virus is a virus present in cell cultures of a specific cell line within a bioreactor.
[0027] The isolated DNA fragment is a segment of DNA taken from the natural (intact) DNA of a corresponding, naturally occurring, replicable organism. Such DNA fragments may exist in a stable solution or may recombine and transfer into the DNA of another organism. In each case, the DNA fragment remains isolated for the purposes of this invention.
[0028] Isolated proteins are proteins taken from their natural environment, that is, proteins that have been separated from their natural binding with the corresponding naturally occurring, replicable organism.
[0029] A vaccine is a pharmaceutical composition that is safe to administer to a host animal and is able to induce protective immunity against a pathogenic microorganism in that animal, i.e., induce successful prophylactic treatment. In this sense, successful prophylactic treatment is treatment that helps prevent or reduce infection with the pathogen or symptoms caused by such infection, resulting from a post-treatment attack by the pathogen, particularly reducing its burden in the host after such an attack, and optionally helping to prevent or reduce one or more clinical manifestations caused by post-treatment infection with the pathogen.
[0030] An open reading frame (ORF) is part of a reading frame that has the potential to encode a protein or peptide. An ORF is a continuous sequence of codons that does not contain a stop codon.
[0031] Implementation Plan
[0032] In a first embodiment, the virus of the present invention is characterized by an isolated herpesvirus, which is a member of the Heteroherpesviridae family and causes disease in Asian sea bass in its wild-type form, the disease being characterized by the following signs (after intraperitoneal challenge with the virus in a laboratory setting): clinical signs appearing approximately 3 days after challenge, resulting in systemic skin lesions (occurring in a significant number of cases, usually exceeding 50%), causing blackening and pale patches of skin and fin erosion, lethargy and observed loss of swimming balance (“observed” means that it can be seen, but not in all cases, only in extremely lethargic fish), (almost completely) loss of appetite, increased gill respiration rate, and death occurring approximately 2 weeks after challenge.
[0033] In another embodiment, the virus has DNA corresponding to a DNA sequence according to SEQ ID NO: 1. In practice, this means that the level of identity across the full length of the DNA exceeds 70%, preferably exceeding 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98%, exceeding 99% or even up to 100%. Notably, it is currently believed (in 130 k base pairs) that the virus has internal repeats around position 80,000. Based on homology with other herpesviruses, the virus may exist in four genomic isoforms (as explained by Mahiet et al. below: Structural variability of the Herpes Simplex Virus 1 genome In Vitro and In Vivo; Journal of Virology, August 2012, Volume 86, Number 16, pp 8592-8601). In addition to the repeat near bp 80,000, the virus of the present invention may have one or more additional internal repeats. However, this has not been determined. SEQ ID NO: 1 corresponds to one of the possible genomic isoforms of the virus of the present invention. In another embodiment of the virus, at least 95% of its open reading frames (particularly ORFs containing at least 300 base pairs), such as at least 96%, 97%, 98%, 99%, or 100%, have at least 80% sequence identity with the corresponding open reading frames of DNA having the sequence according to SEQ ID NO: 1, such as at least 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, or even up to 100% identity.
[0034] It is worth noting that, for the purposes of this invention, the appropriate procedure for determining the level of identity is the nucleotide BLAST procedure (blastn) of the NCBI Basic Local Alignment Search Tool, using the "Align two or more sequences" option and standard settings (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi).
[0035] In another embodiment, the isolated herpesvirus, as a member of the Heteroherpesviridae family, possesses at least one identifying characteristic of the virus deposited at the Pasteur Institute in Paris, France, National Center for Culture Collection of Microorganisms (CNCM), accession number CNCM I-5118. This means that the virus can be identified as a heteroherpesvirus, i.e., perch herpesvirus, according to the present invention. In another embodiment, the identifying characteristic is selected from: 1) the virus having a DNA sequence that, in its full length, is identical to that according to SEQ ID The sequence of NO:1 has at least 70% (or at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or 100%) identity, subject to the aforementioned condition regarding internal duplication; or 2) the virus in its wild-type form causes disease in Asian sea bass, the disease characterized by the following signs: attack Clinical signs appear approximately 3 days later, resulting in systemic skin lesions (occurring in a significant number of cases, usually exceeding 50%), including blackening of the skin and pale patches and fin erosion, lethargy, and observed loss of swimming balance (“observed” means it can be seen, but not in all cases, only in extremely lethargic fish), (almost completely) loss of appetite, increased gill respiration rate, and death occurring approximately 2 weeks after attack; or 3) the virus contains a major envelope protein (MEP) gene with at least 80% identity to the nucleotide sequence shown in SEQ ID NO: 2; or 4) the virus contains a dUTP enzyme gene with at least 80% identity to the nucleotide sequence shown in SEQ ID NO: 4; or the virus contains a termination enzyme gene with at least 80% identity to the nucleotide sequence shown in SEQ ID NO: 6; or the virus contains a polymerase gene with at least 80% identity to the nucleotide sequence shown in SEQ ID NO: 8.
[0036] In yet another embodiment of the herpesvirus of the present invention (which is a member of the Heteroherpesviridae family and causes disease in Asian sea bass in its wild-type form), the virus is characterized in that it has DNA corresponding to DNA having the sequence according to SEQ ID NO: 1. This means that the virus has DNA that is at least 70% identical in its full length to the DNA according to SEQ ID No. 1 (with the above-mentioned condition regarding internal repeatability). The level of identity can be higher, for example 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or even 100%.
[0037] In yet another embodiment of the herpesvirus of the present invention (which is a member of the Heteroherpesviridae family and causes disease in Asian sea bass in its wild-type form), the virus is characterized by having DNA in which at least 95% of open reading frames (particularly ORFs containing at least 300 base pairs), for example at least 96%, 97%, 98%, 99%, or 100%, have at least 80% sequence identity with the corresponding open reading frames of DNA having the sequence according to SEQ ID NO: 1, for example at least 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, or even up to 100% identity.
[0038] In other embodiments, the virus of the present invention can be distinguished from known members of the Heteroherpesviridae family based on the DNA sequences encoding its major envelope protein (ORF28) and its dUTP enzyme (ORF1). It has been shown that the major envelope protein of the virus shares only 30% sequence identity with even the closest MEP of other species in the Heteroherpesviridae family. The dUTP enzyme shares only 45% sequence identity with the closest dUTP enzyme of other species in the Heteroherpesviridae family. Typical examples of the DNA sequences encoding the MEP and dUTP enzyme are shown in SEQ ID NO: 2 and 4, respectively. Their respective amino acid sequences, i.e., the proteins encoded by the DNA fragments according to SEQ ID NO: 2 and NO: 4 (the term "encoded by" does not exclude other DNA resulting in the same protein, or in other words, "encoded by a specific DNA sequence" means that the protein can be synthesized based on a specific sequence, but may also be synthesized by using another sequence), are shown in SEQ ID NO: 3 and 5. It should be understood that natural variation can exist between individual representatives of the pathogen for the specific proteins covered herein. Genetic variation leading to, for example, minor changes in the sequence of the main envelope protein does exist. The same is true for dUTP enzymes. First, there is the so-called "wobbling in the second and third bases," which explains the possible nucleotide changes that remain unnoticed in the amino acid sequences they encode: for example, the triplet TTA, TTG, TCA, TCT, TCG, and TCC all encode leucine. Furthermore, minor variations can be seen in the amino acid sequences between representatives of the novel virus according to the invention. These variations can be reflected by differences in one or more amino acids throughout the sequence, or by deletions, substitutions, insertions, inversions, or additions of one or more amino acids in the sequence. For example, Neurath et al. in "The Proteins" Academic Press New York (1979) has described amino acid substitutions that do not substantially alter biological and immunological activity. These substitutions are between relevant amino acids, or substitutions that frequently occur during evolution, particularly Ser / Ala, Ser / Gly, Asp / Gly, Asp / Asn, and Ile / Val (see Dayhof, MD, Atlas of protein sequence and structure, Nat. Biomed. Res. Found., Washington DC, 1978, vol. 5, suppl. 3). Other amino acid substitutions include Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Thr / Phe, Ala / Pro, Lys / Arg, Leu / Ile, Leu / Val, and Ala / Glu.Based on this information, Lipman and Pearson developed a method for rapid and sensitive protein comparison (Science 227, 1435-1441, 1985) and for determining functional similarity between homologous proteins. Such amino acid substitutions, as well as variations with deletions and / or insertions, in exemplary embodiments of the present invention are all within the scope of the invention. This explains why, for example, when isolated from different representatives of the virus according to the invention, MEP and dUTP enzymes can have significantly lower than 100% homology levels while still representing the MEP or dUTP enzyme of the virus according to the invention. Typically, the proteins that are MEP or dUTP enzymes according to the present invention have at least 70% sequence identity with the amino acid sequences of SEQ ID NO: 3 and SEQ ID NO: 5, respectively, and therefore have 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or even 100% sequence identity with these sequences.
[0039] Therefore, the implementation scheme (AG) involving these proteins (i.e., MEP and dUTP enzymes) is as follows:
[0040] A: An isolated herpesvirus containing a major envelope protein (MEP) gene, characterized in that the virus is a member of the Heteroherpesviridae family, causes disease in Asian sea bass, and the nucleotide sequence of the MEP gene has at least 80% (e.g., 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or 100%) identity with the nucleotide sequence shown in SEQ ID NO: 2.
[0041] B: An isolated herpesvirus containing the dUTP enzyme gene, characterized in that the virus is a member of the Heteroherpesviridae family, causes disease in Asian sea bass, and the nucleotide sequence of the dUTP enzyme gene has at least 80% (e.g., 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or 100%) identity with the nucleotide sequence shown in SEQ ID NO: 4.
[0042] C: An isolated herpesvirus having both a MEP gene and a dUTP enzyme gene, characterized in that the nucleotide sequence of the MEP gene has at least 80% identity with the nucleotide sequence shown in SEQ ID NO: 2, and the nucleotide sequence of the dUTP enzyme gene has at least 80% (e.g., 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or 100%) identity with the nucleotide sequence shown in SEQ ID NO: 4.
[0043] D: An isolated herpesvirus containing the major envelope protein (MEP) gene, characterized in that the virus is a member of the Heteroherpesviridae family, causes disease in Asian sea bass, and the MEP gene reacts in a PCR reaction with primer sets as shown in SEQ ID NO: 21 and 22 to produce a PCR product of 277+ / -10 base pairs.
[0044] E: An isolated herpesvirus containing the dUTP enzyme gene, characterized in that the virus is a member of the Heteroherpesviridae family, causes disease in Asian sea bass, and the dUTP enzyme gene reacts in a PCR reaction with primer sets as shown in SEQ ID NO: 23 and 24 to produce a PCR product of 346+ / -10 base pairs.
[0045] F: An isolated herpesvirus containing the MEP gene and the dUTP enzyme gene, characterized in that the MEP gene reacts with the primer sets shown in SEQ ID NO: 21 and 22 in a PCR reaction to produce a PCR product of 277+ / -10 base pairs, and the dUTP enzyme gene reacts with the primer sets shown in SEQ ID NO: 23 and 24 in a PCR reaction to produce a PCR product of 346+ / -10 base pairs.
[0046] G: An isolated herpesvirus, characterized in that the nucleotide sequence of the MEP gene has at least 80% (or at least 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or 100%) identity with the nucleotide sequence shown in SEQ ID NO: 2, and the nucleotide sequence of the dUTP enzyme gene has at least 80% (or at least 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or 100%) identity with the nucleotide sequence shown in SEQ ID NO: 4, and characterized in that the viral DNA in the PCR reaction is identical to that shown in SEQ ID NO: 2. The primer sets shown in IDNO: 21 and 22 are reacted to produce a PCR product of 277+ / -10 base pairs, and reacted in the PCR reaction with primer sets shown in SEQ ID NO: 23 and 24 to produce a PCR product of 346+ / -10 base pairs.
[0047] Implementation schemes D to G utilize PCR-tests, which employ primer sets for the major envelope protein gene sequence or dUTP enzyme gene sequence of the virus according to the present invention. Two different primer sets are selected, the sequences of which are described in SEQ ID NO: 21-22 and SEQ ID NO: 23-24. PCR-tests using the first primer set (SEQ ID NO: 21-22) reacting with the major envelope protein gene of the virus use two primers, LCHV MEP FW and LCHV MEP REV (see Table 2b in the Examples section). PCR-tests using the second primer set (SEQ ID NO: 23-24) reacting with the dUTP enzyme gene of the virus use two primers, LCHV dUTP FW and LCHV dUTP REV (see Table 2c in the Examples section). The tests described in more detail in the Examples section are standard PCR tests. If analysis of the PCR product from the first primer set shows a PCR product of approximately 277 base pairs, or if analysis of the PCR product from the second primer set shows a PCR product of approximately 346 base pairs, and the virus is a member of the Heteroherpesviridae family and causes disease in Asian sea bass, then this definitively confirms that the analyzed virus is the virus according to the invention. For the purposes of this invention, a PCR product of approximately 277 base pairs is a PCR product with a length between 277+10 and 277-10 base pairs. A PCR product of approximately 346 base pairs is a PCR product with a length between 346+10 and 346-10 base pairs.
[0048] Other embodiments (HK) involving other virus-specific proteins (i.e., termination enzymes and polymerases) of the present invention are as follows:
[0049] H: An isolated herpesvirus containing a terminase gene, characterized in that the virus is a member of the Heteroherpesviridae family, causes disease in Asian sea bass, and the terminase gene reacts in a PCR reaction with primer sets as shown in SEQ ID NO: 25 and 26 to produce a PCR product of 585+ / -10 base pairs.
[0050] I: An isolated herpesvirus containing a polymerase gene, characterized in that the virus is a member of the Heteroherpesviridae family, causes disease in Asian sea bass, and the polymerase gene reacts in a PCR reaction with primer sets as shown in SEQ ID NO: 27 and 28 to produce a PCR product of 314+ / -10 base pairs.
[0051] J: An isolated herpesvirus containing a terminase gene and a polymerase gene, characterized in that the terminase gene reacts in a PCR reaction with primer sets as shown in SEQ ID NO: 25 and 26 to produce a PCR product of 585+ / -10 base pairs, and the polymerase gene reacts in a PCR reaction with primer sets as shown in SEQ ID NO: 27 and 28 to produce a PCR product of 314+ / -10 base pairs.
[0052] K: An isolated herpesvirus, characterized in that the nucleotide sequence of the terminase gene has at least 80% (or at least 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or 100%) identity with the nucleotide sequence shown in SEQ ID NO: 6, and the nucleotide sequence of the polymerase gene has at least 80% (or at least 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or 100%) identity with the nucleotide sequence shown in SEQ ID NO: 8, and characterized in that the viral DNA in the PCR reaction is identical to that shown in SEQ ID NO: 6. The primer sets shown in NO: 25 and 26 are reacted to produce a PCR product of 585+ / -10 base pairs, and reacted in the PCR reaction with primer sets shown in SEQ ID NO: 27 and 28 to produce a PCR product of 314+ / -10 base pairs.
[0053] Implementation schemes H to K utilize a PCR test, which employs a primer set for the termination enzyme gene sequence or polymerase gene sequence of the virus according to the invention. Two different primer sets are selected, the sequences of which are described in SEQ ID NO: 25-26 and SEQ ID NO: 27-28. The PCR test using the first primer set (SEQ ID NO: 25-26) reacting with the terminal enzyme gene of the virus uses two primers, LCHV TER FW and LCHV TER REV (see Table 2d in the Examples section). The PCR test using the second primer set (SEQ ID NO: 27-28) reacting with the polymerase gene of the virus uses two primers, LCHVPOL FW and LCHV POLREV (see Table 2e in the Examples section). The test described in more detail in the Examples section is a standard PCR test. If analysis of the PCR product of the first primer set shows a PCR product of approximately 585 base pairs, or if analysis of the PCR product of the second primer set shows a PCR product of approximately 314 base pairs, and the virus is a member of the Heteroherpesviridae family and causes disease in Asian sea bass, then this definitively confirms that the virus analyzed is the virus according to the invention.
[0054] Based on the DNA coding sequences of the main envelope protein and dUTP enzyme of the virus of the present invention described above, the following embodiments of the present invention are also provided:
[0055] L: A (isolated) DNA fragment containing a gene encoding a major envelope protein, characterized in that the gene has at least 80% (or at least 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or 100%) nucleotide sequence identity with the MEP gene shown in SEQ ID NO: 2.
[0056] M: The (isolated) major envelope protein encoded by this DNA fragment.
[0057] N: A (isolated) DNA fragment containing a gene encoding the dUTP enzyme, characterized in that the gene has at least 80% (or at least 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or 100%) nucleotide sequence identity with the dUTP enzyme gene shown in SEQ ID NO: 4.
[0058] O: The (isolated) dUTP enzyme encoded by this DNA fragment.
[0059] Several other genes are also considered to be useful for identifying the virus according to the present invention. One of these genes is the gene corresponding to ORF224 (SEQ ID NO: 10), which encodes a membrane (glycoprotein) (SEQ ID NO: 11). Another gene is homologous to the TK (thymidine kinase) gene of catfish herpesvirus 1 (IHV1). In IHV-1, this gene corresponds to ORF5 (Hanson et al., Virology. 1994 Aug 1; 202(2): 659-64). This virus has a conserved "deoxyribonucleoside kinase" domain, which shares 33% amino acid identity with ORF5 of IHV-1. Another gene (SEQ ID NO: 12) used to identify the virus of the present invention is the gene containing ORF206, which encodes the major capsid protein (SEQ ID NO: 13).
[0060] Another embodiment of the invention relates to any (isolated) DNA fragment having an open reading frame of at least 100 nucleotides in length, wherein said DNA has at least 80% (or at least 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or 100%) sequence identity with an open reading frame having the sequence according to SEQ ID NO: 1. Although a length of 30-40 nucleotides has been found sufficient to distinguish the viral DNA of the invention from the DNA of any publicly known virus, the practically relevant length, particularly for corresponding subunit vaccines based on the corresponding protein, is at least 100 nucleotides (or at least 150, 200, 250 or even at least 300 nucleotides) to correspond to proteins having relevant and distinguishing 3D identity with relevant immunogenic epitopes corresponding to viral proteins. Therefore, in another embodiment, the invention also relates to (isolated) proteins encoded by such DNA fragments.
[0061] In one embodiment, the invention also relates to cell cultures (i.e., artificial cultures of a limited number of cells of a certain type (also called cell lines) in an artificial culture vessel; the process of growing cells under controlled conditions outside their natural environment is also described) containing a virus according to the invention capable of replication. Several fish cell lines may be used to support the replication of the virus according to the invention. An example of a cell line that can be used to grow the virus according to the invention is a cell line derived from the brain cells of Asian sea bass. Methods for isolating such cell lines have been described in particular in Hasoon et al., In VitroCell.Dev.Biol.-Animal 47:16-25 (2011). Another example of a cell line that may be used to support viral replication is disclosed by Chi et al.: “Persistent infection of betanodavirus in a novel cell line derived from the brain tissue of barramundi Lates calcarifer”, Chi SC, Wu YC, Cheng TM, Dis Aquat Organ. 2005 Jun; 65(2):91-8. PMID: 16060261. It has also been determined that primary cell cultures from sea bass fins using conventional methods can be used to support viral replication. Other cell lines that may be used to grow the virus are cells from the skin, brain, and heart—organs where the virus may replicate.
[0062] In yet another embodiment, the present invention relates to a vaccine for combating herpesvirus disease in fish, wherein the vaccine comprises a herpesvirus according to the invention, or an immunogenic protein as described above, and a pharmaceutically acceptable carrier. Such a carrier can be as simple as water, provided it is suitable for administering the material in clinically relevant amounts without causing unacceptable side effects. Typical carriers are oil and water emulsions, suspensions of insoluble adjuvants (typically aluminum salts or other salts, or large immunostimulatory polymer molecules) in water, or solutions of soluble adjuvants (such as saponins, PAMPs, carbomers, or other immunostimulatory molecules). Typically, the carrier includes stabilizers and preservatives known in the art. In a further embodiment, the vaccine comprises the herpesvirus according to the invention in either a live attenuated (i.e., capable of replication but no longer capable of inducing the full suite of symptoms induced by the wild-type pathogen of origin) or inactivated form.
[0063] Experimental vaccines for herpes simplex virus have been designed using various techniques. The vaccines consist of the following: peptides, (recombinant) viral proteins, mixtures of viral proteins, whole and graded killed viruses (see, for example, Yasumoto, S. et al. in Fish Pathology 41:141-145 (2006), which describes inactivated whole koi herpesvirus containing liposomal compartments), replication-deficient viruses, and attenuated replicating viruses (as outlined by Koelle, DM and L. Corey. 2003: Recent Progress in Herpes Simplex Virus Immunobiology and Vaccine Research. Clin Microbiol Rev. 16(1):96-113). Each method has its specific advantages and disadvantages, which were discussed by Stanberry in 2000 (Stanberry, LR, A. Cunningham, A. Mindel, L. Scott, S. L. Prunance, F. Y. Aoki and C. J. Lacey. 2000: Prospects for control of herpes simplex virus disease through immunization. Clin. Infect. Dis. 30: 549-566.).
[0064] It is known that continuous in vitro passage of virulent herpesvirus strains in cell cultures results in attenuated progeny, or in other words, nonvirulent replicating strains that elicit a protective immune response without causing clinical symptoms of disease. For example, Marek's disease virus (MDV) was attenuated through continuous in vitro passage of virulent virus until the resulting isolate became nonvirulent, yielding a protective vaccine called Rispens or CVI988 (Rispens BH, Vloten H, Mastenbroek N, Maas HJ, Schat KA. 1972: Control of Marek's disease in the Netherlands. 1. Isolation of an avirulent Marek's disease virus (strain CVI988) and its use in laboratory vaccination trials. Avian Dis. 16: 108-125). Accordingly, multiple genes typically involved in pathways involving DNA replication and transcriptional regulation are described for their involvement in the re-attenuation of MDV, providing targets for the rational design of future MD and therefore corresponding herpesvirus vaccines. Fish herpesviruses have also been described as being attenuated through successive passages (see in particular Noga, EJ et al., Can. J. Fish. Aquat. Sci. 38: 925-929, 1981).
[0065] As is generally known, viral attenuation can be spontaneous or induced by drugs (mutation or other types, such as, for example, UV light; see, for example, Mutation Research 768, 2016, 53-67 and J.gen.Virol, 1985, 66, 2271-2277).
[0066] The underlying genetic mechanisms behind attenuation are generally still poorly understood, but genetic changes (mutations, deletions, etc.) and / or their accumulation in the viral genome form the basis for attenuation of herpesvirus strains. Mutations may involve a variety of viral mechanisms, including replication capacity and viral transmission. Certain molecular pathways essential for viral replication and in vivo infectivity may not be necessary for replication culture, and those genes involved in these pathways may be more prone to genetic alteration during long-term culture.
[0067] Characterizing these random mutations and deletions in the genome, and with the development of next-generation sequencing technologies, sequencing the entire genome of large viruses such as herpesviruses has become relatively simple, making it possible to rationally design attenuated viruses. From the literature on herpesvirus attenuation, several genes have emerged as potential targets, with gene dysfunction leading to functional attenuation of the virus. Roizman and Knipe provided a detailed overview in 2001 of genes involved in viral replication that may have mutated in live attenuated herpes simplex vaccines (Roizman, B., and DMKnipe: Herpes simplexviruses and their replication, pp. 2399-2459. In DMKnipe, PM Howley, and DEGriffin (eds.), Fields Virology, 4th ed., vol. 2. Lippincott, Philadelphia, Pa).
[0068] Furthermore, this mutation can be used to develop vaccine methods with discontinuously replicating viruses. The mutated virus is grown in genetically engineered cell lines that provide the desired non-mutated gene in a trans form. For example, when a herpes simplex virus lacking the late gene UL22 encoding gH infects non-complementary cells, progeny viral particles can leave the cells but cannot infect secondary cells (Koelle and Corey, 2003, cited above).
[0069] Below is a list of herpesvirus genes, and dysfunction or deletion of these genes has been described to result in functional attenuation of koi herpesvirus, atypical herpesvirus, or other herpesviruses. These genes are target genes for attenuation of herpesviruses according to the present invention:
[0070] 1) Thymidine kinase (TK) gene of koi herpesvirus. The TK gene has also been described in channel catfish herpesvirus (CCV), which is a virus that is relatively closely related to the virus described in this invention (Hanson LA, Kousoulas KG, and RL Thune. 1994: Channel catfish herpesvirus (CCV) encodes a functional thymidine kinase gene: elucidation of a point mutation that confers resistance to Ara-T. Virology 202(2): 659-64).
[0071] 2) The d-UTP enzyme gene of koi herpesvirus.
[0072] 3) The gene encoding koi herpesvirus ORF57 is given in Genbank accession number NC_009127, where the start and stop codons of ORF57 are located at positions 99382 and 100803 (Boutier M, Ronsmans M, Ouyang P, Fournier G, Reschner A, et al. (2015): Rational Development of an Attenuated Recombinant Cyprinid Herpesvirus 3 Vaccine Using Prokaryotic Mutagenesis and In Vivo Bioluminescent Imaging. PLoS Pathog 11(2): e1004690).
[0073] 4) The gD(EHV enBHV) / gp50(PRV) gene, found in bovine herpesvirus, equine herpesvirus, and pseudorabies virus (pseudorabies). This gene encodes a glycoprotein that can produce neutralizing antibodies against it.
[0074] The present invention also relates to a method for prophylactically treating animals with the vaccine described above (i.e., for treating animals to prevent infection following treatment with the corresponding wild-type pathogen), comprising systemically administering the vaccine to the animal. Systemic administration of the vaccine means administering the vaccine so that it reaches the body's circulatory system (which includes the cardiovascular and lymphatic systems), thereby affecting the whole body rather than a specific site such as the gastrointestinal tract. Systemic administration can be performed, for example, by administering the antigen into muscle tissue (intramuscular), dermis (intradermal), subcutaneous, submucosal, intravenous, intracavitary, etc.
[0075] The present invention is also embodied in antibodies or antiserum reacting with the virus according to the invention, and diagnostic test kits for detecting antibodies reacting with the virus or its antigenic material according to the invention, wherein the test kits contain the virus or its antigenic material according to the invention. The present invention is also embodied in diagnostic test kits for detecting herpesviruses or their antigenic material according to the invention, wherein the test kits contain antibodies reacting with the virus or its antigenic material according to the invention or the PCR primer set as described above.
[0076] The present invention will now be further explained using the following examples. Example
[0077] Example 1: Discovery of herpesvirus in perch
[0078] Serum and tissue samples were collected to isolate infectious agents.
[0079] Diseased fish were observed in Asian sea bass (barbel) fish farms in Singapore. The clinical symptoms of the diseased fish appeared to be similar to those of desquamation disease to fishermen (Gibson-Kueh et al., J Fish Dis. 2012 Jan; 35(1): 19-27. doi: 10.1111 / j.1365-2761.2011.01319.x.PMID: 22103767; de Groof et al., PLoS Pathog. 2015 Aug 7; 11(8): e1005074. doi: 10.1371 / journal.ppat.1005074.PMID: 26252390).
[0080] However, upon closer examination of the disease symptoms, it appeared that the affected fish exhibited a more acute infection (3–10 days rather than more than 15 days) and a higher morbidity rate. The skin lesions were less severe but more systemic compared to shedding disease. The skin lesions differed from those of shedding disease in that the entire fish became darker and more sluggish, with patches of pale, slimy discharge. Some scale loss was observed, but this was not significant and was not a major clinical sign. This differed from scale loss caused by shedding disease virus, which presents as localized, patchy lesions that are more severely affected by necrosis and involve significant scale loss. Shedding disease virus typically also causes more chronic outbreaks. Based on the observed differences and the fact that PCR for shedding disease virus yielded negative results, and based on clinical observations of the affected fish farms, the presence of a distinct infectious viral agent was suspected. A decision was made to conduct follow-up studies aimed at virus isolation and the discovery of a novel virus.
[0081] Besides scale loss, other observations of diseased fish include lethargy, severe loss of appetite, cloudy / swollen eyes, and acute onset of high mortality (up to 30-70% in diseased fish). Samples were taken from diseased fish (serum, kidney, spleen). Combined serum samples were stored at -70°C until further analysis. Combined kidney samples were kept at +4°C until homogenization the next day.
[0082] Tissue homogenates from tissue samples are used to isolate infectious agents.
[0083] Kidney samples were homogenized manually using a homogenizer in SVDB (Standard Vaccine Diluent = PBS), and then diluted 1:9 (w / v) in SVDB and pretreated with gentamicin for 1 hour. The homogenized samples were centrifuged at 5,500 rpm at +4°C for 10 minutes, and the cell-free supernatant was collected.
[0084] One day before inoculating the monolayer, sea bass brain (SBB) cells were inoculated at 2 × 10⁻⁶. 4cells / cm 2 Cells were seeded in T75 flasks containing EMEM + 10% FBS + gentamicin + amphotericin B. For this experiment, cells were grown in a medium supplemented with HEPES and sodium bicarbonate, and the cells were optimized for growth under these CO2-free conditions. On the second day, the medium (15 mL) was replaced with fresh medium, and 0.1 mL or 0.3 mL of undiluted cell-free supernatant was added. The flasks were incubated at 28°C. CPE was observed in flasks containing undiluted cell-free supernatant (both 0.1 and 0.3 mL) after 3 days, and the cells were harvested on day 5 (passage 1). The putative infectious agent was named V511. Following the above protocol, the agent causing CPE was passaged three more times in SBB cells. The agent causing CPE was named V511 / SBB_4P.
[0085] Virus detection in culture supernatants of cells and serum from diseased fish that induce CPE
[0086] Serum samples from diseased fish and culture supernatants of the fourth-generation harvester V511 / SBB_4P, a factor causing CPE, were analyzed using the VIDISCA-454 technique described by De Vries et al. (2011) PLoS ONE 6(1): e16118. Sequences of fish pathogens suspected to be derived from this invention were obtained from both types of samples. These sequences were used to derive PCR primers for conventional and quantitative PCR (see Tables 2a-e). BLAST analysis of the new sequences showed that the CPE-causing factor in the culture supernatant and the suspected infectious factor in the serum exhibited a certain level of homology with viruses of the Heteroherpesviridae family. This novel virus was therefore named Lumbago Perch Herpesvirus (LCHV).
[0087] Whole genome sequencing
[0088] The viral culture supernatant samples were centrifuged at 10,000 × g for 10 min and treated with TurboDNase (Thermofisher) as described (de Vries M, et al. PLoS One. 2011; 6(1): e16118. doi: 10.1371 / journal.pone.0016118), followed by nucleic acid extraction using the Boom extraction method (Boom R, et al. J Clin Microbiol. 1990; 28(3): 495-503). The samples were cleaved using dsDNA fragmentation enzyme (New England Biolabs). The cleaved samples were purified with AMPure XP beads (agencourt AMPure XP PCR, Beckman Coulter) at a ratio of 1:1.8 (sample: beads) to remove the enzyme. After purification, the samples were end-repaired using DNA polymerase I, large (Klenow) fragment (New England Biolabs). The end-repaired sample was purified to remove enzyme using AMPure XP beads (agencourt AMPure XP PCR, Beckman Coulter) at a ratio of 1:1.8 (sample:bead). Then, the sample was A-tailed using the Klenow fragment (3'□5'Exo-) (New England Biolabs). The sample was also purified to remove polymerase using AMPure XP beads (agencourt AMPureXP PCR, Beckman Coulter) at a ratio of 1:1.8 (sample:bead). Bubble adaptors from NEBNext Multiplex Oligos for Illumina (New England Biolabs) were ligated to the A-tailed sample using T4 ligase (Thermofisher). Size selection was performed using AMPure XP beads (agencourt AMPure XP PCR, Beckman Coulter). Initially, a 1:0.5 ratio (sample:beads) was used to ensure that most fragments larger than 400 bp were removed. Then, additional AMPure XP beads (agencourt AMPure XP PCR, Beckman Coulter) were added to the supernatant to achieve a final ratio of 1:0.85 (sample:beads) to bind DNA fragments between 200-400 bp and remove fragments smaller than 200 bp.After size selection, the vesicular adaptor was opened using the USER enzyme from NEBNext Multiplex Oligos for Illumina (New England Biolabs). Next, 28 cycles of PCR were performed using adaptor-specific primers from NEBNext Multiplex Oligos for Illumina (New England Biolabs) and the Q5 hot-start master mix (New England Biolabs); cycles of 30 seconds at 98°C, 10 seconds at 98°C, and 75 seconds at 65°C, followed by a 5-minute cycle at 65°C. Following PCR, sample size selection was performed using AMPure XP beads (agencourt AMPure XP PCR, Beckman Coulter) at a 1:0.5 ratio (sample:beads) to remove fragments larger than 400 bp. Additional AMPure XP beads (agencourt AMPure XP PCR, Beckman Coulter) were added to the supernatant to achieve a final ratio of 1:0.85 (sample:beads) to bind DNA fragments between 200-400 bp and remove fragments smaller than 200 bp. Next, DNA concentration was measured using the Qubit dsDNA HS assay kit (Thermofisher), and size was checked on a bioanalyzer using a high-sensitivity DNA analysis kit. The DNA was diluted to a concentration of 2.49 ng / μl. Sequencing was performed using MiSeq (Illumina) with paired-end sequencing and v2 kit (Illumina).
[0089] Systemic Evolutionary Analysis
[0090] Initial phylogenetic analysis was based on a 208 bp DNA fragment (SEQ ID NO: 14) of the barramundi herpesvirus found in disease outbreak samples. This fragment showed homology at the translated nucleotide level with the ORF62 of catfish herpesvirus 1NP_041153.2 and other fish viruses. Nucleotide and protein sequence alignments were generated using the BLAST basic local alignment search tool (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) and the multiple sequence alignment tool ClustalW. Phylogenetic trees were constructed using the neighbor-joining method with MEGA5 software, including partial deletions in the case of gaps or insertions (MEGA5: Molecular Evolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Koichiro Tamura, Daniel Peterson, Nicholas Peterson, Glen Stecher, Masatoshi Nei and Sudhir Kumar. Mol. Biol. Evol. 2011 28(10): 2731-2739. 2011 doi: 10.1093 / molbev / msr121). The results of this phylogenetic analysis are as follows: Figure 1 As shown, a phylogenetic tree of LCHV is depicted based on homology analysis of a 208 bp DNA fragment of LCHV with IHV1 ORF62. Phylogenetic analysis confirms that LCHV is a newly discovered virus in the Heteroherpesviridae family.
[0091] Example 2: Detection of herpesvirus in perch using PCR and qPCR analysis
[0092] Primer design
[0093] PCR primers were designed on a 208 bp DNA fragment of the barramundi herpesvirus found in disease outbreak samples. This fragment showed homology at the nucleotide level with ORF62 of the catfish herpesvirus 1NP_041153.2. Primers were also designed on the MEP, dUTP, terminase, and polymerase genes.
[0094] Table 2a: Primers designed for the 208 bp DNA fragment of the herpesvirus of the perch.
[0095]
[0096] Table 2b: Primers designed for the MEP of perch herpesvirus
[0097]
[0098] Table 2c: Primers designed for the dUTP enzyme of the perch herpesvirus
[0099]
[0100] Table 2d: Primers designed on the termination enzyme of perch herpesvirus
[0101]
[0102] Table 2e: Primers designed for the herpesvirus polymerase of perch
[0103]
[0104] PCR and gel electrophoresis
[0105] Routine PCR was performed using a Veriti 96-well thermal cycler (Applied Biosystems). A master mixture was prepared containing 1x Supertaq buffer, 0.02 U / μl Supertaq enzyme, 0.2 mM deoxyribonucleoside triphosphates (dNTPs), 1 μM forward primers, and 1 μM reverse primers. For each sample, 2.0 μl of DNA template was added to a 48 μl PCR mixture, and 2 μL of sterile water was used as a negative control. The PCR program was designed to begin with initialization at 95 °C for 60 seconds, followed by denaturation, annealing, and extension at 95 °C, primer set-specific annealing temperatures based on primer Tm, and 72 °C, repeated 40 times. The program ended with a final extension at 72 °C for 10 minutes. Samples were loaded onto a 1.5% agarose gel with 1x ethidium bromide and 1x TAE buffer, and incubated at 115 V for 60 minutes.
[0106] qPCR analysis
[0107] Quantitative polymerase chain reaction (qPCR) was performed using a BioRad CFX 96 system. qPCR experiments were conducted using Probe Fast Master Mix and sequence-specific probes. Each reaction contained an 18 μl master mixture containing 1x Probe Fast q-PCR Master Mix (KAPA), 200 nM forward primer, 200 nM reverse primer, and 200 nM probe. Primer pair 2 was used for qPCR analysis, with an optimized Tm of 60.7 °C. The probe DNA sequence was CGCGGGATGACCTCTTCTCG (SEQ ID NO: 31), labeled 5′6FAM and 3′TAMRA. 2 μl of DNA template was added to the 18 μl master mixture. Each reaction was performed in duplicate, and all plates were centrifuged at 2,200 × g for 4 minutes before being inserted into the CFX system. Amplification was performed using the following program: starting at 95.0 °C for 3 minutes, followed by 3 seconds at 95.0 °C and 30 seconds at 60.7 °C, repeated 40 times.
[0108] Standard line
[0109] A series of dilutions containing the pUC57 vector (synthesized via GenScript [the 208 bp fragment as described above was synthesized and cloned into a plasmid vector]) containing the herpesvirus-identity-sequence construct of the perch was used as a positive control, an indicator for efficiency and accuracy, and for sample quantification. The vector was dissolved and diluted in water at a range of 1.0 × 10⁻⁶ per qPCR reaction. 1 Copy / 2μL to 1.0×10 9 Copy / 2 μL. The dilution series was included in all qPCR experiments and stored at -20°C. Quantification of LCHV DNA in the samples was performed using supporting software (CFX-Manager version 3.1), which used data from the dilution series to create a standard line. All qPCR experiments performed showed efficiencies between 98.0% and 100.2% and accuracies between 0.997 and 0.999, highlighting the robustness of the qPCR method designed for quantifying LCHV DNA.
[0110] Example 3: Experimental infection of Asian sea bass with infectious agents
[0111] Experimental infection of V511 / SBB_4P in Asian sea bass (Gastrodon scuttler)
[0112] In this experiment, fish were infected intraperitoneally and commensal with V511 to investigate whether V511 was the cause of disease outbreaks in the field. Samples were taken from different organs at different time points after infection to determine the infection process.
[0113] Table 3: Allocation of Treatment Groups and Tanks
[0114] sink Group Dosage (IP) Number of fish 1A V511 / SBB_4P - Unadulterated 0.3mL 25 1B Symbiosis - 25
[0115] A group of 25 Asian sea bass were challenged via intraperitoneal (IP) injection of 0.3 mL of undiluted cell-free supernatant (CFS) grown on the SBB cell line V511 / SBB_4P. The viral titer of CFS was 3.2 × 10⁻⁶. 6 TCID 50 / mL (titration protocol below). The second group of 25 fish co-habited in the same tank separated by a net (Table 3). The net allowed free water movement between the two tank halves and permitted close proximity, but not direct contact between the fish from the two treatment groups. At the start of the experiment, the average weight of the fish was 18 grams.
[0116] Fish were starved for approximately 24 hours prior to attack to ensure their gastrointestinal tract was emptied, reducing the risk of injury. Prior to attack, the fish were anesthetized with Aqui-S sedation according to standard procedure. Fish in the IP attack group were netted, sedated, and injected with IP along the midline between the base and tip of the pelvic fin. After attack, the fish were placed in designated tanks for recovery and observation. Uninfected symbiotic fish were introduced into adjacent tank sections separated by nets.
[0117] Mortality and clinical signs were recorded. Three fish from the symbiotic group were randomly sampled and necropsies performed on days 4, 7, 11, 14, and 18 post-attack to collect fish tissue for further testing. Samples included spleen, heart, brain, serum, liver, intestine, gills, skin, and kidneys to better understand the infection process following natural transmission of the novel factor.
[0118] On days 4, 7, 11, and 14 post-infection, three fish from the IP-infected group were randomly sampled and necropsies were performed to collect kidney tissue for further testing. On day 17, spleen, heart, brain, serum, liver, intestine, gills, skin, and kidney samples were obtained from the three experimentally infected fish. On day 18 post-infection, all fish were either sampled or had died from the infection (see Table 6). Sample collection is summarized in Tables 4 and 5.
[0119] Table 4: Sampling of fish tissue in the experimental IP infection group
[0120] Days after IP infection IP infection. Merged organs (3 fish / merged tissue) 4、7、11、14 kidney 17 Kidneys, spleen, heart, brain, serum, liver, intestines, gills, skin
[0121] Table 5: Sampling of fish tissues in the symbiotic group
[0122]
[0123] Table 6: Clinical signs observed in the IP and symbiotic attack treatment group
[0124]
[0125] The results presented in Table 6 show that both IP and symbiotic attack pathways can produce clinical signs similar to those observed in the marker Asian sea bass farm. The overall clinical signs observed were lethargy, loss of appetite, and skin, fin, and eye lesions, which were also observed similarly in diseased farmed fish in the marker fish farm.
[0126] This indicates that in a controlled laboratory environment (when compared to field environments such as fish farms, where other pathogens are absent and fewer stressors are present), the typical symptoms after an IP attack are: 1) the onset of clinical signs approximately 3 days after the attack; 2) systemic skin lesions, which may lead to darkening of the skin with pale patches and fin erosion; 3) loss of swimming balance due to extreme lethargy; 4) almost complete loss of appetite; 5) increased gill cover respiration rate; and 6) mortality occurring approximately 2 weeks after the attack. Eye swelling and cloudiness were observed in some fish. Mortality rates and percentage cumulative mortality records are shown in Table 7.
[0127] Table 7: Daily Mortality Rates and Percentage Cumulative Mortality Rates*
[0128]
[0129] *Fish samples used for tissue collection are not included.
[0130] The V511 / SBB_4P virus supernatant was transmitted from IP-infected fish to naive symbiotic fish. Both groups experienced similar clinical symptoms. The clinical symptoms were also similar to those observed in marker fish farms (initial outbreaks). Compared to the symbiotic group, the IP-infected group experienced more acute and severe disease, with signs of disease appearing within 3 days of infection. In contrast, the symbiotically attacked fish showed initial clinical signs on day 7 post-infection.
[0131] Using infectious material derived from tissue samples collected during field disease surveys, and subsequent in vitro passages, we were able to replicate the clinical symptoms observed during the outbreak via both IP and symbiotic infection routes. We also confirmed the transmission of the disease from IP-infected fish to symbiotic primary fish in the same waters, thus confirming the infectiousness of this pathogen.
[0132] Example 4: Sample preparation, tissue homogenization, and DNA analysis of tissue samples collected during the infection experiment (Example 3). Leave
[0133] Homogenization of organ samples
[0134] Using a Precellys 24 homogenizer, fish organ samples (Tables 4 and 5) collected in the above experiments were homogenized. 10% organ homogenates in phosphate-buffered saline (PBS) were prepared using a program with two cycles: 6,500 rpm for 20 seconds and a 10-second interval. Homogenization of heart, spleen, kidney, brain, intestine, and liver samples was completed in one cycle, while skin and gill samples were homogenized twice. All samples were kept on ice and stored at -80°C during homogenization.
[0135] DNA extraction
[0136] DNA extraction was performed using the MagNA Pure 96 system and the MagNA Pure 96 DNA and Viral NA kit. For extraction, 250 μl of MagNA Pure 96 external lysis buffer was added to 200 μl of sample. DNA was separated using the pre-installed external lysis protocol and eluted in 50 μl of Milli-Q water. The DNA was stored at -20°C until further use.
[0137] Example 5: Virus culture and virus titration
[0138] Establishment and culture of sea bass brain (SBB) cell line:
[0139] The SBB cell line was originally derived from trypsin-digested suspensions of Asian sea bass brain cells at Intervet Norbio Singapore Pte Ltd (part of MSD AH). The derivation process of sea bass brain cells has been described by Hasoon et al. in In VitroCell.Dev.Biol.-Animal 47:16-25 (2011) and by Chi et al., Dis Aquat Organ. 2005 Jun;65(2):91-8.
[0140] SBB medium consists of 899 ml of E-MEM supplemented with 2 mM L-glutamine and 110 mg / L sodium pyruvate, 100 ml of FCS (10%), and (optionally) 1 ml of neomycin polymyxin antibiotic solution at 1000x stock solution. Cells are typically grown at 28°C and 5% CO2.
[0141] Maintain the culture medium at 4°C before initiating culture. Begin culture using a one-ampoule frozen stock solution (SBB). Rapidly thaw the cells from liquid nitrogen by warming the ampoule in water at 28°C. Add the cell suspension to the tube and slowly dilute with 9 volumes of culture medium. Subsequently, count the cells. Dispense the suspension into suitable culture flasks or roller flasks and incubate at 28°C and 5% CO2. The seeding density in flasks or roller flasks is approximately 3 × 10⁻⁶ cells / flask. 4 cells / cm 2After 6-24 hours or when cells have fully attached, replace the medium to remove residual DMSO (freezing medium consists of 90% medium and 10% DMSO). Incubate the cells for another 3-7 days or until confluence is achieved. For roller flasks, a roller speed of 0.2-0.5 rpm is required. Roller flasks are available in 480, 960, and 1750 cm⁻¹ sizes. 2 Different surface areas.
[0142] Once confluence is achieved, passage the cells. Passage can be performed every 3-4 days, with an initial seeding density of 3.0 × 10⁶ cells / day. 4 cells / cm 2 Or, when using 1.0 × 10 4 cells / cm 2 When plating cells at the desired density, passage can be performed every 7 days. Preheat the reagents used for cell passage (culture medium, PBS, trypsin / EDTA) to 28°C. Discard the culture medium and wash the confluent monolayer once with an appropriate volume of PBS (3 mL for a T25 flask). Then discard the PBS and incubate the cells for 15 minutes at 28°C in the same volume of PBS supplemented with 1% (vol / vol) 2.5% trypsin solution and 1% (vol / vol) 2% EDTA solution. After detachment, add the same volume of fresh culture medium, resuspend the cells, and count them. Set up new flasks at the desired cell density in a suitable culture volume for culture flasks or roller flasks.
[0143] For frozen cells, before the procedure, maintain the culture medium and 2x concentrated freezing medium (80% (vol / vol) medium plus 20% (vol / vol) DMSO) at 4°C. Treat the confluence cell culture as described above up to and including trypsin digestion. Resuspend the cells, count them, resuspend them again in an appropriate amount of medium, and add an equal volume of 2x freezing medium dropwise while vortexing the suspension. For ampoules used for liquid nitrogen storage, use 5.25 × 10⁻⁶ cells per ampoule. 6 Fill with cells to initiate T175 or use 2.25 × 10⁶ cells. 6 Cell filling is used to initiate T75.
[0144] SBB cells were inoculated with perch herpesvirus.
[0145] Before establishing the inoculation experiment, cells cultured in liquid nitrogen were passaged at least once. At a concentration of 3.0 × 10⁻⁶... 4 cells / cm 2 Before inoculating into tissue culture flasks, passage and culture the cells for 24 hours. The inoculum consists of undiluted supernatant from fresh or freeze-thawed cultures of previously passaged viral cells. Remove the culture medium from the flask. Inoculate the flask at 28°C for at least 60 minutes.
[0146] When inoculating cells in culture medium with a harvest of previously passaged LCHV virus, it is preferable to use 0.001-0.01 TCID per cell. 50 MOI.
[0147] After removing the inoculum (60 minutes later, although this is not absolute), add fresh culture medium and culture the cells until complete CPE is observed using an inverted optical microscope (usually after 2-4 days). Harvest the virus by collecting the culture supernatant, centrifuging it at 800×g for 5 minutes to remove debris. Alternatively, the supernatant can be clarified by filtration. Use the clarified supernatant for subsequent passage or PCR / DNA / EM analysis or freeze it at -70°C. Viral replication can be confirmed using (quantitative) PCR analysis and / or harvest titration. DNA sequencing technology is used to confirm the characterization of the virus and EM.
[0148] DNA for (quantitative) PCR was isolated from tissue culture medium using the MagNA Pure 96 system and the MagNA Pure 96 DNA and Viral NA kit (Example 4).
[0149] Virus titration on SBB cells
[0150] SBB cells were cultured as described above. The day before the test, cells were prepared in a medium (EMEM + 10% FCS + L-Glu + NaPyr) containing 6.0 × 10⁻⁶ cells. 4 SBB cell suspension at 100 μL / mL was used to seed 96 wells of a microtiter plate. The plate was incubated at 28 °C and 5% CO2 for 24 h. After this incubation period, the monolayer was approximately 50% confluent.
[0151] On the day of testing, each virus sample was prepared up to 10 times using the following methods. -7 10-fold serial dilutions: Transfer 0.5 mL of sample to a tube containing 4.5 mL of ice-cold (0–20 °C) titration medium (medium with reduced FCS; 50% EMEM + L-Glu + NaPyr + 50% medium), mix, and transfer 0.5 mL to the next tube containing 4.5 mL of titration medium. Mix carefully, transfer, etc. Columns 1 and 12, as well as rows A and H, are used as negative controls and inoculated with 100 μL / well of fresh titration medium. Dilute with 100 μL / well of virus dilution (10-fold serial dilutions). -2 10 -3 10 -4 10 -5 10 -6 10 -7Inoculate microtiter plates in rows B through G (10 wells / diluent). Maintain the temperature of the virus diluent between 0°C and 20°C during treatment. Incubate the plates at 28°C and 5% CO2 for 6 days. After the 6-day virus incubation period, screen the plates for LCHV-specific cell morphology (CPE) using an inverted optical microscope. CPE is characterized by cell aggregation followed by cell detachment / lysis. Figure 2 Each well displaying an LCHV-specific CPE was rated as positive. TCID 50 The determination was performed according to the methods and calculations described below: Reed and Muench, am. J. Epidemiol. (1938) 27(3): 493-497. qPCR analysis of DNA samples isolated from positive wells in the titration assay confirmed the presence and replication of the virus.
[0152] result
[0153] Tissue culture flasks were filled with 3.0 x 10 4 cells / cm 2 Inoculate and incubate for 24 hours. After 24 hours, count the cells in one flask after trypsin digestion to determine the actual number of cells present in the flask. Remove the culture medium from the subsequently inoculated flasks. 0.001 TCID₂ solution of undiluted culture supernatant consisting of previous passages of LCHV virus in the medium (virus passage number between 4 and 8) 50 / The inoculum for the cells was applied to a monolayer and incubated for 60 minutes. The inoculum was removed and fresh culture medium was added to the cell culture flask. The cells were cultured until complete CPE was observed using an inverted optical microscope. The virus was harvested by collecting the culture supernatant, which was centrifuged at 800×g for 5 minutes to remove debris. Samples were taken from (1) undiluted inoculum used to infect the monolayer, (2) culture supernatant harvested from the culture flask 1 hour after the inoculum was replaced with fresh culture medium, (3) a monolayer with 50% CPE, and (4) a monolayer with 100% CPE. Samples (1), (3), and (4) were titrated and qPCR analysis was performed on samples (1), (2), (3), and (4). The results are shown in Table 8. Photographs were taken at 40x magnification using an Olympus CKX41 inverted optical microscope. These are shown in Figure 2 middle. Figure 2 A shows the morphology of 90% confluent SBB cells (p18) and Figure 2 B shows the morphology of SBB cells (p18) at 50% CPE in a culture flask.
[0154] Table 8: Detailed results of LCHV growth in SBB cells
[0155]
[0156] *NA: Unanalyzed
[0157] Example 6: Electron Microscopy
[0158] Electron microscopy
[0159] A 400-mesh copper mesh with a pure carbon film was exposed to air via glow discharge for 20 seconds to make the membrane surface hydrophilic. A 10 μL volume of virus sample was placed on the carbon-coated mesh and incubated for approximately 2 minutes. Excess sample was blotted away with filter paper, and 10 μL of water was placed on the mesh and immediately removed by blotting. Then, 10 μL of 1% uranyl acetate was placed on the mesh for staining. After 30 seconds, excess dye was removed by blotting, and the sample was allowed to dry for several minutes before observation under an electron microscope. The sample was observed using a JEOL 1011 transmission electron microscope running at 80 kV. Images were recorded using a SISVeleta 2kx2k camera.
[0160] Photographs of LCHV culture samples were captured using a JEOL 1011 transmission electron microscope to confirm that the identified virus was herpesvirus and to rule out the presence of any other viruses. SBB(p9) cells were inoculated with LCHV at passage 5 at an MOI of 0.01. After harvest, the virus was stored in medium at -80°C to obtain a titer of 10. 4.43 TCID 50 / mL. A 1μl sample was prepared for electron microscopy, and two images are shown below. Figure 3 In Figure A, two dark spots with an approximate diameter of 100 nm are observed, which match the average diameter of the capsid of common herpesviruses (115-130 nm). Figure B shows a magnified view, where the icosahedral outline of the particle is clearly visible. No enveloped virus was found in the sample.
[0161] Figure 3 The image shows LCHV virus captured using an electron microscope. Figure 3 In A, two types of herpesviruses (dark spots) are identifiable. Scale bar is 500 nm. Figure 3 B shows an enlarged view of one of the spots, which clearly shows the outline of an icosahedron.
[0162] The above embodiments describe the detection and isolation of novel pathogens from diseased fish. After experimentally infecting healthy fish with the isolated pathogen, the same disease symptoms can be reproduced. The infectious agents isolated from the experimentally infected fish are the same as the initially isolated pathogen. This demonstrates that the aforementioned disease symptoms are solely attributable to the discovered pathogen, namely, the barramundi herpesvirus.
[0163] Example 7: Primary cell culture of sea bass fin cells
[0164] Established from sea bass Primary cell cultures of fin cells (SBF). Culture the cells in the culture for at least 5 generations.
[0165] The culture was established as follows: The fish were anesthetized. The tail fin was trimmed and washed three times in PBS + 0.3% gentamicin + 0.002% enrofloxacin + 0.5% amphotericin B. The fin was then dissected into tissue fragments using a scalpel. The fragments were transferred to a 25cm culture medium containing L15 medium. 2 In tissue culture flasks, the L15 medium was supplemented with 20% FCS and 0.3% gentamicin + 0.002% enrofloxacin + 0.5% amphotericin B. The flasks were incubated at 28°C in a humidified incubator (CO2-free). The medium (L15) was replaced as needed based on the presence of debris and pH. Cells were passaged in PBS with 0.125% trypsin until cell detachment, and separated at a low ratio of 1:1-3 depending on cell density. During the initial passage, cells were cultured in L15 medium supplemented with 20% FCS. In subsequent passages, the FCS percentage was reduced to 10%.
[0166] Inoculation with perch herpesvirus was performed using the procedure described in Example 5. 100% CPE was observed on day 4 post-infection.
[0167] Example 8: Additional strains of the virus of the present invention
[0168] Fish samples were taken from a different fish farm than the designated farm where clinical symptoms of herpesvirus infection in perch were observed. However, PCR analysis using primer set 2 (SEQ ID NO: 17 and SEQ ID NO: 18) described in Example 2 yielded negative PCR results. Alternatively, primer sets designed based on the polymerase (ORF21) and terminase (ORF37) sequences (ORFs with relatively high levels of amino acid conservation compared to other heteroherpesviridae families) were used for PCR. Primers used for PCR are presented in Tables 2d and 2e.
[0169] These PCRs yielded positive results. Sequencing of the stop enzyme PCR fragment showed 97% sequence identity with the barramundi herpesvirus shown in SEQ ID NO: 1. SEQ ID NO: 29 presents the PCR product of the stop enzyme PCR for LCHV as shown in SEQ ID NO: 1. SEQ ID NO: 30 shows the PCR product of the stop enzyme PCR for LCHV obtained from a fish farm different from the marked fish farm. The conclusion is that the disease outbreak was caused by another strain of LCHV.
[0170] PCT
[0171]
[0172] For use by the receiving office only
[0173]
[0174] For use by the International Bureau only
[0175]
Claims
1. An isolated herpesvirus, a member of the Heteroherpesviridae family, causing disease in Asian sea bass in its wild-type form, the disease characterized by the following signs: clinical signs appearing approximately 3 days after attack, resulting in systemic skin lesions including blackening of the skin with pale patches and fin erosion, lethargy accompanied by observed loss of swimming balance, loss of appetite, increased gill respiration rate, and death occurring approximately 2 weeks after attack, characterized by... The virus possesses the identification characteristics of the virus deposited at the Pasteur Institute, National Center for Culture Collection of Microorganisms (CNCM), France, with accession number CNCM I-5118, and is characterized in that the identification characteristics are: - The virus has a DNA sequence consisting of the sequence of SEQ ID NO:
1.
2. A DNA fragment, wherein the DNA fragment comprises the sequence of SEQ ID No.
1.
3. A cell culture containing a replicating virus, characterized in that, The culture contains the herpesvirus of claim 1.
4. A diagnostic test kit for detecting antibodies that react with the virus of claim 1, characterized in that, The test kit contains the virus of claim 1.
Citation Information
Patent Citations
Scale drop disease (SDD) causative virus and derivatives thereof
CN105247043A
Scale drop disease (SDD) causative virus and derivatives thereof
WO2014191445A1