A rice purity quantitative detection method based on molecular biology and a detection kit thereof
By extracting DNA from rice samples using molecular biology methods and performing quantitative real-time PCR amplification, combined with specific probes and endogenous reference probes, the problem of quantitative detection of fragrant rice purity was solved, enabling rapid and accurate determination of fragrant rice purity.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- WILMAR SHANGHAI BIOTECH RES & DEV CENT
- Filing Date
- 2020-10-12
- Publication Date
- 2026-06-26
AI Technical Summary
Existing technologies are insufficient for the rapid and accurate quantitative detection of the purity of fragrant rice, especially under the influence of different varieties and environmental factors, resulting in poor accuracy in adulteration detection.
Using molecular biology methods, DNA was extracted from rice samples and amplified by PCR using primers with differentially expressed fragment sequences. Combined with quantitative real-time PCR technology, the purity of fragrant rice was determined by quantitative analysis using specific probes for fragrant and non-fragrant rice and endogenous reference probes.
It enables rapid and accurate quantitative detection of the purity of fragrant rice, reduces the probability of human error, improves the sensitivity and efficiency of detection, and avoids the influence of variety and environmental factors.
Smart Images

Figure CN114350762B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to biological detection technology, and more specifically, to a method for quantitatively detecting the purity of fragrant rice using molecular biology techniques. Background Technology
[0002] Rice (Oryza sativa) is the staple food for over 3 billion people worldwide and is one of the most important food crops. Fragrant rice, a type of cultivated rice, is highly favored by consumers both domestically and internationally due to its unique aroma, leading to continuously increasing demand. Fragrant rice is fragrant, soft, delicious, and nutritious, commanding a market price 1-2 times higher than ordinary rice. This has led some unscrupulous individuals to adulterate fragrant rice with non-fragrant rice of similar appearance for exorbitant profits. Therefore, how to easily, accurately, and quickly identify the purity of fragrant rice in fragrant rice has always been a challenging problem.
[0003] Currently, various methods have been established for detecting aroma in rice materials. Among them, the chewing method and the KOH method are the most commonly used methods in traditional breeding processes. However, these two methods mainly rely on human senses to determine the strength of the aroma, resulting in poor accuracy and making it difficult to quantitatively detect the aroma content of fragrant rice. This is because the aroma of fragrant rice is affected not only by different varieties but also by external environmental factors such as climate in different years. In recent years, with the rapid development of rice functional genomics and sequencing technologies, significant progress has been made in the research of rice aroma genes. The genetic basis of aroma in fragrant rice is relatively complex, but most researchers believe that aroma is controlled by a single recessive gene. The recessive gene fgr, located on rice chromosome 8, is a gene closely related to aroma, and this gene has now been isolated and cloned. Further research shows that the gene fgr encodes betaine aldehyde dehydrogenase homologue 2 (Badh2). Inhibiting the expression of the fgr gene or knocking out the fgr gene will result in the loss of Badh2 enzyme function, leading to an increase in 2-AP precursor substances, which in turn accumulate 2-AP and produce aroma in rice. It is inferred that this gene controls the synthesis of aroma. Cloning analysis revealed that the rice aroma gene has 15 exons and 14 introns. In fragrant rice varieties, the gene has an 8bp deletion in the 7th exon and 3 SNP differences, which leads to premature termination of translation, resulting in the production of non-functional BADH2 protein. The accumulation of 2-AP causes the rice to produce aroma.
[0004] Rice companies have a clear need for variety identification when purchasing fragrant rice. They hope to find a simple, easy-to-operate, and quick method to identify the rice variety to ensure that the purchased paddy is indeed high-purity fragrant rice. Reagents and methods for qualitative and quantitative detection of adulteration in fragrant rice are still needed in this field. Summary of the Invention
[0005] This invention proposes a detection method and kit for fragrant rice, which can be effectively used for the detection of fragrant rice. This invention effectively solves the problem of quantitative identification of other non-fragrant rice varieties mixed with fragrant rice.
[0006] This invention provides a method for quantitative detection of the purity of fragrant rice.
[0007] The method provided by this invention includes:
[0008] 1) Extract DNA from rice samples;
[0009] 2) PCR amplification was performed using primers that could amplify differential fragment sequences between fragrant rice and non-fragrant rice;
[0010] 3) Conduct quantitative analysis to determine the purity of the rice sample.
[0011] In one specific embodiment of the present invention, the quantitative analysis includes one or more of sequencing and fluorescence detection.
[0012] In one specific embodiment of the present invention, the PCR amplification in step 2) further includes a non-fragrant rice-specific probe and a fragrant rice-specific probe, as well as, optionally, an endogenous reference probe.
[0013] In one specific embodiment of the present invention, the extraction of rice sample DNA includes extracting the DNA of the rice sample to be tested.
[0014] In one specific embodiment of the present invention, DNA is extracted from a standard rice sample.
[0015] In one specific embodiment of the present invention, the standard sample rice sample is a rice sample containing different proportions of fragrant rice and / or non-fragrant rice.
[0016] In one specific embodiment of the present invention, the standard sample rice sample comprises one or more of the following rice samples in proportions, preferably comprising more than five: 100% fragrant rice, 95% fragrant rice, 90% fragrant rice, 85% fragrant rice, 80% fragrant rice, 75% fragrant rice, 70% fragrant rice, 65% fragrant rice, 60% fragrant rice, 55% fragrant rice, 50% fragrant rice, 45% fragrant rice, 40% fragrant rice, 35% fragrant rice, 30% fragrant rice, 25% fragrant rice, 20% fragrant rice, 15% fragrant rice, 10% fragrant rice, 5% fragrant rice, and 0% fragrant rice.
[0017] In one specific embodiment of the present invention, the standard sample rice sample comprises five or more rice samples.
[0018] In one specific embodiment of the present invention, the differential sequence of the fragrant rice and the non-fragrant rice is located at position 21,748,989 on chromosome 8.
[0019] In one specific embodiment of the present invention, the primers for amplifying the differential fragment sequences of fragrant rice and non-fragrant rice are badh2-7-LF1 and badh2-7-LR1, (1) the primer badh2-7-LF1 has the sequence shown in SEQ ID NO:1 or a mutant with more than 70% sequence identity with it, (2) the primer badh2-7-LR1 has the sequence shown in SEQ ID NO:2 or a mutant with more than 70% sequence identity with it, or (3) the complementary sequence of (1) or (2).
[0020] In one specific embodiment of the present invention, the primer badh2-7-LF1 sequence is shown in SEQ ID NO:1, and the primer badh2-7-LR1 sequence is shown in SEQ ID NO:2.
[0021] In one specific embodiment of the present invention, the non-fragrant rice-specific probe is badh2-7-22MGB-P, the sequence of which is shown in SEQ ID NO:3; the fragrant rice-specific probe is badh2-7-VIC-P4, the sequence of which is shown in SEQ ID NO:5; and the endogenous reference probe is badh2-7-CY5-P5, the sequence of which is shown in SEQ ID NO:4. The non-fragrant rice-specific probe, the fragrant rice-specific probe, and the endogenous reference probe are labeled with different fluorescent markers.
[0022] In one specific embodiment of the present invention, the fluorescent labels used for the non-fragrant rice specific probe, the fragrant rice specific probe, and the endogenous reference probe are selected from one of FAM, VIC, and CY5, respectively.
[0023] In one specific embodiment of the present invention, the analysis of the quantitative real-time PCR data involves subtracting the CT value of the non-fragrant rice-specific probe from the CT value of the endogenous reference probe (ΔCT), then subtracting the ΔCT value from the ΔCT value of a reference sample with 0% fragrant rice content. The negative number of ΔCT is then squared to obtain a relative content value, which is used for the quantitative determination of the non-fragrant rice content in the sample. Alternatively, the CT value of the fragrant rice-specific probe is subtracted from the CT value of the endogenous reference probe (ΔCT), then subtracted from the ΔCT value of a reference sample with 100% fragrant rice content. The negative number of ΔCT is then squared to obtain a relative content value, which is also used for the quantitative determination of the fragrant rice content in the sample.
[0024] This invention also provides a method for quantitatively detecting the purity of fragrant rice.
[0025] The method provided by this invention includes:
[0026] 1) Extract DNA from the rice sample to be tested and the standard sample rice sample, wherein the standard sample rice sample is a rice sample containing fragrant rice and / or non-fragrant rice; in a preferred embodiment of the present invention, the standard sample rice sample contains one or more of the following proportions: 100% fragrant rice, 95% fragrant rice, 90% fragrant rice, 85% fragrant rice, 80% fragrant rice, 75% fragrant rice, 70% fragrant rice, 65% fragrant rice, 60% fragrant rice, 55% fragrant rice, 50% fragrant rice, 45% fragrant rice, 40% fragrant rice, 35% fragrant rice, 30% fragrant rice, 25% fragrant rice, 20% fragrant rice, 15% fragrant rice, 10% fragrant rice, 5% fragrant rice, and 0% fragrant rice; in a preferred embodiment of the present invention, the standard sample rice sample contains five or more of the above proportions;
[0027] 2) Using the DNA extracted in step 1) as templates, real-time fluorescent PCR was performed with primers badh2-7-LF1 and badh2-7-LR1, non-fragrant rice-specific probe badh2-7-22MGB-P, fragrant rice-specific probe badh2-7-VIC-P4, and endogenous reference probe badh2-7-CY5-P5.
[0028] The primer badh2-7-LF1 sequence is shown in SEQ ID NO:1; the primer badh2-7-LR1 sequence is shown in SEQ ID NO:2; the badh2-7-22MGB-P sequence is shown in SEQ ID NO:3; the badh2-7-VIC-P4 sequence is shown in SEQ ID NO:5; and the badh2-7-CY5-P5 sequence is shown in SEQ ID NO:4.
[0029] The non-fragrant rice-specific probe, the fragrant rice-specific probe, and the endogenous reference probe use different fluorescent labels; in a preferred embodiment of the present invention, the fluorescent labels are selected from FAM, VIC, CY5, HEX, Texas Red, and ROX; in a preferred embodiment of the present invention, the fluorescent labels used for the non-fragrant rice-specific probe, the fragrant rice-specific probe, and the endogenous reference probe are selected from FAM, VIC, and CY5.
[0030] 3) Analyze the quantitative PCR data to determine the purity of fragrant rice and / or non-fragrant rice in the rice samples to be tested.
[0031] In one specific embodiment of the present invention, the analysis of the quantitative real-time PCR data involves subtracting the CT value of the non-fragrant rice-specific probe from the CT value of the endogenous reference probe (ΔCT), then subtracting the ΔCT value from the ΔCT value of a reference sample with 0% fragrant rice content. The negative number of ΔCT is then squared to obtain a relative content value, which is used for the quantitative determination of the non-fragrant rice content in the sample. Alternatively, the CT value of the fragrant rice-specific probe is subtracted from the CT value of the endogenous reference probe (ΔCT), then subtracted from the ΔCT value of a reference sample with 100% fragrant rice content. The negative number of ΔCT is then squared to obtain a relative content value, which is also used for the quantitative determination of the fragrant rice content in the sample.
[0032] The present invention also provides a kit for quantitative detection of the purity of fragrant rice.
[0033] The reagent kit provided by this invention includes:
[0034] 1) Primers: badh2-7-LF1 and badh2-7-LR1; and
[0035] 2) Probes: non-fragrant rice specific probe badh2-7-22MGB-P, fragrant rice specific probe badh2-7-VIC-P4, and endogenous reference probe badh2-7-CY5-P5;
[0036] The primer badh2-7-LF1 sequence is shown in SEQ ID NO:1; the primer badh2-7-LR1 sequence is shown in SEQ ID NO:2; the badh2-7-22MGB-P sequence is shown in SEQ ID NO:3; the badh2-7-VIC-P4 sequence is shown in SEQ ID NO:5; and the badh2-7-CY5-P5 sequence is shown in SEQ ID NO:4.
[0037] Advantages of this invention for gene mutation detection and its applications:
[0038] This invention utilizes molecular biology methods to quantitatively detect adulteration in fragrant rice. DNA is rapidly extracted from paddy rice (rice samples), and quantitative real-time PCR amplification is performed using a developed, highly efficient, and sensitive aroma gene-specific fluorescent probe and primers. By setting an endogenous reference gene and a reference sample, the amplification data is quantitatively analyzed, thereby quantitatively determining the purity of the fragrant rice. The results are intuitive and objective, avoiding human judgment. The operation is convenient and quick, greatly reducing the probability of misjudgment, and is unaffected by variety, region, or environment, making the detection more sensitive and efficient.
[0039] The invention features a unique design for detecting endogenous reference genes. Both rice-specific and non-fragrant rice-specific detections are located on the same gene sequence and use the same primers. This ensures that the total amount of endogenous reference sequences is exactly the sum of the fragrant rice and non-fragrant rice sequences, which is superior to other rice endogenous reference genes with unknown copy numbers. It also avoids the influence of different DNA amplification efficiencies at different sites of different genes.
[0040] Based on the established quantitative detection method for fragrant rice, this invention develops a "Fragrant Rice Purity Detection Kit" (Code No.: BWD-001). This kit is a product capable of rapidly and effectively detecting the purity of fragrant rice. It can be detected using rapidly extracted crude DNA. The PCR system is a three-fluorescence detection system, containing non-fragrant rice-specific probe I, fragrant rice-specific probe II, and rice endogenous reference probe III. The fluorescence of non-fragrant rice-specific probe I, fragrant rice-specific probe II, and rice endogenous reference probe III are one of FAM fluorescence, VIC fluorescence, and CY5 fluorescence, respectively. They are mixed in a certain proportion, vacuum dried into a dry powder preparation, which is not only convenient to use and increases the stability of detection, but also makes the detection kit easy to transport at room temperature. Attached Figure Description
[0041] Figure 1 : Primer and probe positions for detection using fluorescent probes in fragrant rice and non-fragrant rice.
[0042] Figure 2 : Quantitative data chart of different contents of non-fragrant rice and fragrant rice. From left to right: pure fragrant rice standard sample, 5% non-fragrant rice standard sample, 10% non-fragrant rice standard sample, 50% non-fragrant rice standard sample, 90% non-fragrant rice standard sample, 95% non-fragrant rice standard sample, pure non-fragrant rice standard sample.
[0043] Figure 3 : Quantitative data of different internal reference genes. From left to right: pure fragrant rice standard sample, from left to right: 0% non-fragrant rice standard sample, 0% non-fragrant rice standard sample 10-fold dilution, 0% non-fragrant rice standard sample 100-fold dilution, 5% non-fragrant rice standard sample, 5% non-fragrant rice standard sample 10-fold dilution, 5% non-fragrant rice standard sample 100-fold dilution, 50% non-fragrant rice standard sample, 50% non-fragrant rice standard sample 10-fold dilution, 50% non-fragrant rice standard sample 10-fold dilution, 95% non-fragrant rice standard sample, 95% non-fragrant rice standard sample 10-fold dilution, 95% non-fragrant rice standard sample 100-fold dilution, 100% non-fragrant rice standard sample, 100% non-fragrant rice standard sample 10-fold dilution, 100% non-fragrant rice standard sample 100-fold dilution.
[0044] Figure 4 Blind sample purity test of fragrant rice. From left to right: 0% non-fragrant rice standard, 5% non-fragrant rice standard, 50% non-fragrant rice standard, 95% non-fragrant rice standard, 100% non-fragrant rice standard, test sample 1, test sample 2, test sample 3. Detailed Implementation
[0045] The inventors designed highly efficient and sensitive non-fragrant rice-specific primers and probes for real-time fluorescent PCR amplification of key genes containing aroma substances in rice to determine whether non-fragrant rice is mixed in with fragrant rice. By setting an endogenous reference probe to detect the same site, comparing it with a reference sample, and then performing quantitative analysis on the amplification data, the content of fragrant rice can be quantitatively determined.
[0046] Specifically, the present invention relates to primers and kits for detecting said gene mutations, the use of said primers and kits in the detection of fragrant rice purity, and a method for detecting the purity of fragrant rice.
[0047] The gene mutation related to rice aroma in this article is: TATAT or AAAAGATTATGGC at position 102 of the nucleotide sequence shown in SEQ ID NO:11.
[0048] In this article, gene mutation refers to a change in the composition or sequence of base pairs in a gene. Examples include transitions, transversions, insertions, and deletions.
[0049] In this article, rice varieties refer to rice lines that have been bred to exhibit different traits. The gene mutation sequence for fragrant rice is TATAT, while the gene mutation sequence for non-fragrant rice is AAAAGATTATGGC. Therefore, by detecting the above gene mutation locations in the samples, it is possible to effectively determine whether a rice variety is fragrant or non-fragrant.
[0050] The term "sample" as used herein refers to any type of polynucleotide-containing sample derived from the object. Preferably, the sample described herein is derived from or contains rice plant organs, tissues, cells, nucleic acids, or products containing rice plant organs, tissues, cells, nucleic acids, including but not limited to rice leaves, roots, stems, flowers, fruits, seeds, cells, DNA, RNA, rice, broken rice, rice bran, rice husks, and processed or unprocessed rice foods such as rice noodles or rice vermicelli. The DNA may be genomic DNA.
[0051] The term "nucleic acid" or "polynucleotide" refers to deoxyribonucleotides (DNA) or ribonucleotide polymers (RNA) in single-stranded or double-stranded form, and their complements. Nucleic acids contain synthetic, non-natural, or modified nucleotide bases. Nucleotides can be ribonucleotides, deoxyribonucleotides, or modified forms thereof. Examples of polynucleotides considered herein include single-stranded and double-stranded DNA, single-stranded and double-stranded RNA, and hybrid molecules having mixtures of single-stranded and double-stranded DNA and RNA. DNA can be a coding strand or a non-coding strand. In one or more embodiments, the sample comprises fragmented genomic DNA. Methods for obtaining and fragmenting genomic DNA are well known in the art.
[0052] The basic building blocks of DNA are deoxyribonucleotides, which are chain-like molecules formed by phosphodiester condensation. Each deoxyribonucleotide consists of a phosphate group, a deoxyribose sugar, and a base. The main bases (bp) of DNA are adenine (A), guanine (G), cytosine (C), and thymine (T). In the double helix structure of double-stranded DNA, A and T are paired by hydrogen bonds, and G and C are paired by hydrogen bonds. DNA can take the form of cDNA, genomic DNA, fragmented DNA, or artificially synthesized DNA. DNA can be single-stranded or double-stranded. DNA can be of any length, for example, 50-500 bp, 100-400 bp, 150-300 bp, or 200-250 bp.
[0053] The term "primer" as used herein refers to a nucleic acid molecule with a specific nucleotide sequence that guides the synthesis of nucleotides at the initiation of nucleotide polymerization. Primer compositions contain one or more primers. Primers are typically two artificially synthesized oligonucleotide sequences; one primer is complementary to one DNA template strand at one end of the target region, and the other primer is complementary to another DNA template strand at the other end of the target region. Their function is to serve as the initiation point for nucleotide polymerization. Artificially designed primers are widely used in polymerase chain reaction (PCR), qPCR, sequencing, and probe synthesis. Primers can be of any length, such as 5-200 bp, 10-100 bp, 20-800 bp, or 25-50 bp.
[0054] The primers of this invention are used to detect gene mutations. In some embodiments, the primers have a nucleotide sequence shown in any one of SEQ ID NO:1-2 or a mutant having 70% sequence identity with it, or a complementary sequence to (2) (1). In one or more embodiments, the primers are primer pairs, each primer pair having a sequence shown in SEQ ID NO:1-2.
[0055] The term "variant" or "mutant" in this document refers to a polynucleotide whose nucleic acid sequence is altered compared to a reference sequence by the insertion, deletion, or substitution of one or more nucleotides while retaining its ability to hybridize with other nucleic acids. Mutants described in any embodiment of this document include nucleotide sequences having at least 70%, preferably at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, and preferably at least 97% sequence identity with a reference sequence (such as SEQ ID NO: 1-11 described herein) and retaining the biological activity of the reference sequence. Sequence identity between two aligned sequences can be calculated using, for example, NCBI's BLASTn. Mutants also include nucleotide sequences having one or more mutations (insertions, deletions, or substitutions) in the reference sequence and nucleotide sequences while still retaining the biological activity of the reference sequence. The multiple mutations typically refer to 1-10, for example, 1-8, 1-5, or 1-3. Substitutions can be substitutions between purine nucleotides and pyrimidine nucleotides, or substitutions between purine nucleotides or between pyrimidine nucleotides. Substitutions are preferably conserved substitutions. For example, in the art, conservative substitution with nucleotides of similar or identical properties generally does not alter the stability and function of polynucleotides. Conservative substitutions include, for example, the interchange of purine nucleotides (A and G) or pyrimidine nucleotides (T or U and C). Therefore, replacing one or more sites with residues from the same source in the polynucleotides of this invention will not substantially affect their activity.
[0056] The term "probe" as used herein refers to a nucleic acid sequence (DNA or RNA) that recognizes a target sequence (complementary to the target sequence). The probe binds to the target gene through molecular hybridization, generating a hybridization signal that reveals the target gene. The probe may include the entire target sequence or a fragment of the target sequence. The probe may be DNA or RNA transcribed from it. Typically, the probe carries a detection label, such as a fluorescent label. Such fluorescent labels include, but are not limited to, FAM, CY5, and VIC. Fluorescent labels suitable for the probes described herein and methods for ligating them to the probes are known in the art.
[0057] In this document, the probe recognizes the fragment of SEQ ID NO:11, which contains the 102nd base from the 5' end of SEQ ID NO:11. In one or more embodiments, the probe is selected from one or more of the following: (1) a probe that recognizes the fragment of SEQ ID NO:6, which contains the 102nd-106th base from the 5' end of SEQ ID NO:6, wherein the base is TATAT; (2) a probe that recognizes the fragment of SEQ ID NO:7, which contains the 102nd-114th base from the 5' end of SEQ ID NO:7, wherein the base is AAAAGATTATGGC; (3) a complementary sequence of (1) or (2). Preferably, the probe has the nucleotide sequence shown in (1) SEQ ID NO:3 or 5 or a mutant having 70% sequence identity with it, or the complementary sequence of (2) or (1).
[0058] Another aspect of the present invention provides a method for detecting rice varieties in a sample, comprising determining or quantifying the fragrant rice content by detecting the gene mutations described herein in the sample to be tested. The method further comprises: (1) extracting DNA from the sample to be tested; (2) determining or quantifying the genotype of the gene mutations described herein in the DNA using primers and / or probes described herein; and (3) determining or quantifying the fragrant rice content based on the result of (2).
[0059] In this paper, the method for extracting DNA from samples is not particularly limited, and DNA extraction methods known in the art and applicable to this paper are applicable.
[0060] The gene mutation detection methods known in the art and applicable to this paper include, but are not limited to: sequencing, single-strand conformation polymorphism polymerase chain reaction (PCR-SSCP), real-time quantitative PCR with high-resolution melting curve analysis (HRM), fluorescent probe-based quantitative PCR, restriction fragment length polymorphism polymerase chain reaction (PCR-RFLP), and time-of-flight mass spectrometry. Other reagents required for SNP marker detection methods, besides primers and / or probes, are also known in the art.
[0061] According to other specific examples of the present invention, a method for determining or quantifying rice varieties by detecting the SNP markers described herein in a sample to be tested further includes: extracting DNA from the sample; performing quantitative real-time PCR on the DNA using primers SEQ ID NO:1 and 2, probes SEQ ID NO:3 and 5, and a reference probe SEQ ID NO:4; obtaining the genotype of the gene mutation described herein in the DNA; and determining or quantifying the fragrant rice content based on the genotype of the gene mutation.
[0062] This invention utilizes the specific sequences that distinguish fragrant rice from non-fragrant rice to design highly efficient and sensitive fragrant rice-specific primers and probes for real-time fluorescent PCR amplification of sample DNA. By setting an endogenous reference gene and a reference sample, the amplification data are then quantitatively analyzed to quantitatively determine the purity of the fragrant rice. This molecular biology-based quantitative detection of fragrant rice purity effectively solves the problem of quantitatively identifying the adulteration of fragrant rice with non-fragrant rice.
[0063] The present invention will be described below by way of specific embodiments. It should be understood that these embodiments are merely illustrative and are not intended to limit the scope of the invention. Materials, reagents, and methods not specifically described in the embodiments are not conventional materials, reagents, and methods in the art.
[0064] Example
[0065] Example 1: Materials and Methods
[0066] 1. Materials
[0067] The seeds and rice samples of different fragrant rice and non-fragrant rice varieties were all purchased from the market.
[0068] 2. Enzymes and reagents
[0069] Enzymes were purchased from Kangwei Century Co., Ltd. and Bio-Rad Co., Ltd., reagents were purchased from Sinopharm Chemical Reagent Co., Ltd., and a Bio-Rad CFX96 real-time PCR instrument was used. Primers and probes used in the experiment were synthesized by Shanghai Sangon Biotech Co., Ltd.
[0070] 3. Experimental Methods
[0071] 3.1 DNA extraction from rice seeds (rice samples)
[0072] Take 20g of rice seeds (rice sample) and grind them using a grinder. Weigh 50mg of the powder into a 2mL sample lysis tube, add 500μL of Buffer 1, vortex and mix for 30s, incubate at 52℃ for 30min at 1200rpm; add 500μL of Buffer 2, vortex and mix for 30s, centrifuge the mixture for 5min (12000rpm), and collect 500μL of the supernatant for later use. Dilute the obtained DNA solution 10 times with sterile pure water to obtain template DNA, and place the DNA templates of different rice seeds in sample dilution tubes for later use. Store at 4℃ for short-term storage and at -20℃ for long-term storage.
[0073] 3.2 Design of Badh2 gene-specific primers and probes
[0074] Primer5 was designed with specific primers targeting specific fragment sequences of fragrant rice and non-fragrant rice.
[0075] Primers for probe detection:
[0076] badh2-7-LF1: 5'-CCTGTAATCATGTATACCCCATC-3' (SEQ ID NO: 1);
[0077] badh2-7-LR1: 5'-GAGAGTTAGTAGAAAGAGAAC-3' (SEQ ID NO: 2);
[0078] Design probes:
[0079] badh2-7-22MGB-P: 5'-FAM-AACTGGTAAAAAGATTATGGCT-MGB-3'; (SEQ ID NO: 3);
[0080] badh2-7-CY5-P5: 5'-CY5-AACCTTAACCATAGGAGCAGCTG-BHQ1-3'. (SEQ ID NO:4);
[0081] badh2-7-VIC-P4: 5'-VIC-TATGAAACTGGTATATATTTCAGC-MGB-3'; (SEQ ID NO: 5).
[0082] Fragrant rice nucleic acid sequence (180bp):
[0083] CCTGTAATCATGTATACCCCATCAATGGAAATGATATTCCTCTCAATACATGGTTTATGTTTTCTGTTAGGTTGCATTTACTGGGAGTTATGAAACTGGTA TATAT TTCAGCTGCTCCTATGGTTAAGGTTTGTTTCCAAATTTCTGTGGATATTTTTTGTTCTCTTTCTACTAACTCTC (SEQ ID NO: 6, Figure 1 ).
[0084] Non-fragrant rice nucleic acid sequence (188bp):
[0085] CCTGTAATCATGTATACCCCATCAATGGAAATGATATTCCTCTCAATACATGGTTTATGTTTTCTGTTAGGTTGCATTTACTGGGAGTTATGAAACTGGTA AAAAGATTATGGC TTCAGCTGCTCCTATGGTTAAGGTTTGTTTCCAAATTTCTGTGGATATTTTTTGTTCTCTTTCTACTAACTCTC (SEQ ID NO: 7, Figure 1 ).
[0086] Endogenous gene SPS primers:
[0087] SPS-F: 5'-TTGCGCCTGAACGGATAT-3'; (SEQ ID NO: 8);
[0088] SPS-R: 5'-CGGTTGATCTTTTCGGGATG-3'; (SEQ ID NO: 9).
[0089] Endogenous gene SPS probes:
[0090] SPS-CY5-P6: 5'-CY5-TCCGAGCCGTCCGTGCGTC-BHQ1-3' (SEQ ID NO: 10).
[0091] Example 2: Real-time quantitative PCR detection of non-fragrant rice and fragrant rice
[0092] Using extracted DNA as templates, real-time fluorescent PCR was performed using primers badh2-7-LF1 and badh2-7-LR1, the non-jasmine rice-specific probe badh2-7-22MGB-P, the jasmine rice-specific probe badh2-7-VIC-P4, and the endogenous reference probe badh2-7-CY5-P5. The PCR reaction volume was 20 μL, containing 10 μL of 2×GoldStar Best MasterMix, 1.5 μL each of the badh2-7-LF1 and badh2-7-LR1 primers (10 μM), 0.25 μL each of the badh2-7-22MGB-P, badh2-7-VIC-P4, and badh2-7-CY5-P5 probes (10 μM), 2 μL of template DNA, and sterile water to a final volume of 20 μL. The blank control was performed using sterile water instead of template DNA. Each reaction was performed in triplicate. The PCR amplification program used a two-step method: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s; 52℃ annealing extension for 45 s, for a total of 45 cycles.
[0093] First, specificity analysis was performed on the probe method. The non-fragrant rice specific probe badh2-7-22MGB-P only showed amplification signals in non-fragrant rice, and no amplification signals in fragrant rice. The fragrant rice specific probe badh2-7-VIC-P4 only showed amplification signals in fragrant rice, and no amplification signals in non-fragrant rice. Analysis of the quantitative real-time PCR data allowed for the quantification of the content of non-fragrant rice and fragrant rice in the samples. The specific method is as follows: using 2... -ΔΔCT The method involves using the badh2 gene badh2-7-CY5-P5 probe as an endogenous reference gene. The CT value of the badh2 gene badh2-7-22MGB-P probe in the sample is subtracted from the CT value of the badh2-7-CY5-P5 probe. This result, ΔCT, is then subtracted from the ΔCT of a reference sample containing 100% non-fragrant rice. The negative number of ΔCT is then squared to obtain a relative content value, used for quantitative determination of the non-fragrant rice content in the sample. Similarly, using the badh2-7-CY5-P5 probe as an endogenous reference gene, the CT value of the badh2-7-VIC-P4 probe in the sample is subtracted from the CT value of the badh2-7-CY5-P5 probe. This result, ΔCT, is then subtracted from the ΔCT of a reference sample containing 100% fragrant rice. The negative number of ΔCT is then squared to obtain a relative content value, used for quantitative determination of the fragrant rice content in the sample.
[0094] Using DNA extracted from standard samples with different concentrations as templates, real-time fluorescence PCR was performed using primers badh2-7-LF1 and badh2-7-LR1, the non-fragrant rice-specific probe badh2-7-22MGB-P, the fragrant rice-specific probe badh2-7-VIC-P4, and the endogenous reference probe badh2-7-CY5-P5. The quantitative PCR data were analyzed, and the results showed ( Figure 2 The seven standards—pure fragrant rice, 5% non-fragrant rice, 10% non-fragrant rice, 50% non-fragrant rice, 90% non-fragrant rice, 95% non-fragrant rice, and pure non-fragrant rice—showed an increasing relationship between the relative gene expression levels and the non-fragrant rice content. These standards can be used to quantify the non-fragrant rice content in unknown samples. Figure 2 A). A standard sample consisting of pure fragrant rice, 5% non-fragrant rice, 10% non-fragrant rice, 50% non-fragrant rice, 90% non-fragrant rice, 95% non-fragrant rice, and pure non-fragrant rice was used. These seven standards, decreasing in fragrant rice content, also showed a decreasing relationship in relative gene expression levels. This allows for the quantitative determination of the fragrant rice content in unknown samples using these standards. Figure 2 B). When using a non-fragrant rice probe for quantitative detection, the detection results for pure fragrant rice standard, 5% non-fragrant rice standard, 10% non-fragrant rice standard, 50% non-fragrant rice standard, 90% non-fragrant rice standard, 95% non-fragrant rice standard, and pure non-fragrant rice standard were 0% non-fragrant rice, 5% non-fragrant rice, 11% non-fragrant rice, 50% non-fragrant rice, 87% non-fragrant rice, 92% non-fragrant rice, and 100% non-fragrant rice, respectively. When using a fragrant rice probe for quantitative detection, the detection results for pure fragrant rice standard, 5% non-fragrant rice standard, 10% non-fragrant rice standard, 50% non-fragrant rice standard, 90% non-fragrant rice standard, 95% non-fragrant rice standard, and pure non-fragrant rice standard were 0% non-fragrant rice, 8% non-fragrant rice, 14% non-fragrant rice, 50% non-fragrant rice, 89% non-fragrant rice, 95% non-fragrant rice, and 100% non-fragrant rice, respectively. It can be seen that when the non-fragrant rice content is below 50%, the non-fragrant rice probe is more accurate in determining the result; when the non-fragrant rice content is above 50%, the fragrant rice probe is more accurate in determining the result.
[0095] Example 3: Analysis of Quantitative Detection Data of Different Internal Reference Genes
[0096] Using extracted DNA as a template, real-time fluorescent PCR was performed using primers badh2-7-LF1 and badh2-7-LR1, the non-jasmine rice-specific probe badh2-7-22MGB-P, the jasmine rice-specific probe badh2-7-VIC-P4, and the endogenous reference probe badh2-7-CY5-P5. The PCR reaction volume was 20 μL, containing 10 μL of 2×GoldStar Best MasterMix, 1.5 μL each of the badh2-7-LF1 primer (10 μM), and badh2-7-LR1 primer (10 μM), 0.25 μL each of the badh2-7-22MGB-P, badh2-7-VIC-P4, and badh2-7-CY5-P5 probes (10 μM), 2 μL of template DNA, and sterile water to a final volume of 20 μL. The blank control was performed using sterile water instead of template DNA. Each reaction was performed in triplicate. The PCR amplification program used a two-step method: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s; 52℃ annealing extension for 45 s, for a total of 45 cycles.
[0097] Using the extracted DNA as a template, real-time fluorescent PCR was performed with primers badh2-7-LF1 and badh2-7-LR1, rice endogenous gene primers SPS-F and SPS-R, non-fragrant rice specific probe badh2-7-22MGB-P, fragrant rice specific probe badh2-7-VIC-P4, and endogenous reference probe SPS-CY5-P6. The PCR reaction volume was 20 μL, containing 10 μL of 2×GoldStar BestMasterMix, 1 μL each of badh2-7-LF1 and badh2-7-LR1 primers (10 μM), 0.25 μL each of badh2-7-22MGB-P and badh2-7-VIC-P4 probes (10 μM), 0.4 μL each of SPS-F and SPS-R primers (10 μM), 0.2 μL of SPS-CY5-P6 probe, 2 μL of template DNA, and sterile water to a final volume of 20 μL. The blank control was performed using sterile water instead of template DNA. Each reaction was performed in triplicate. The PCR amplification program used a two-step method: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s; and 52℃ annealing extension for 45 s, for a total of 45 cycles.
[0098] DNA extracted from standard samples with different concentrations was diluted 10-fold and 100-fold as templates. Real-time fluorescence PCR was performed using primers badh2-7-LF1, badh2-7-LR1, SPS-F, and SPS-R, the non-fragrant rice-specific probe badh2-7-22MGB-P, the fragrant rice-specific probe badh2-7-VIC-P4, and the endogenous reference probes badh2-7-CY5-P5 and SPS-CY5-P6. Analysis of the quantitative PCR data showed... Figure 3 When using the endogenous reference probes badh2-7-CY5-P5 or SPS-CY5-P6 as internal control genes, the relative gene expression levels of seven standards—pure fragrant rice standard, 5% non-fragrant rice standard, 10% non-fragrant rice standard, 50% non-fragrant rice standard, 90% non-fragrant rice standard, 95% non-fragrant rice standard, and pure non-fragrant rice standard—increased with the non-fragrant rice content, also showed an increasing relationship. This allows for the quantitative determination of the non-fragrant rice content in unknown samples using these standards. However, when using SPS-CY5-P6 as the internal control gene, the DNA content detected at different concentrations of sample dilutions showed some differences. Designing an internal control probe on the same fragment at the fragrant rice-specific detection site resulted in stable detection results compared to the universal SPS gene internal control, unaffected by DNA concentration.
[0099] Example 4: Purity Detection of Fragrant Rice (Blind Sample)
[0100] Blind samples of the prepared 3 fragrant rice products were tested. DNA extraction, quantitative real-time PCR amplification, and data analysis were performed according to the method in Example 2. The results showed that ( Figure 4 The purity of the rice in sample 1 was 95%, that in sample 2 was 58%, and that in sample 3 was 77%. The test results and proportions of the three blind samples were basically consistent. The proportions were as follows: sample 1 contained 95% rice, sample 2 contained 60% rice, and sample 3 contained 80% rice.
[0101] The results show that setting an internal control probe on the same gene sequence for both rice-specific and non-fragrant rice-specific detection is superior to other universal rice endogenous reference genes, avoiding the influence of DNA concentration. The developed highly efficient and sensitive fragrant rice and non-fragrant rice-specific fluorescent probes and primers were used for simultaneous quantitative real-time PCR amplification, with a reference sample set up. The amplification data were then analyzed using a 2... -ΔΔCT The method is used to analyze and calculate the value, which is the purity content of the fragrant rice. The result is intuitive and reliable. sequence list <110> Wilmar (Shanghai) Biotechnology R&D Center Co., Ltd. <120> A molecular biology-based method for quantitative determination of the purity of fragrant rice and its detection kit <130> 135 <160> 11 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty three <212> DNA <213> Artificial sequence() <400> 1 cctgtaatca tgtatacccc atc 23 <210> 2 <211> twenty one <212> DNA <213> Artificial sequence() <400> 2 gagagttagt agaaagagaa c 21 <210> 3 <211> twenty two <212> DNA <213> Artificial sequence() <400> 3 aactggtaaa aagattatgg ct 22 <210> 4 <211> twenty three <212> DNA <213> Artificial sequence() <400> 4 aaccttaacc ataggagcag ctg 23 <210> 5 <211> twenty four <212> DNA <213> Artificial sequence() <400> 5 tatgaaactg gtatatattt cagc 24 <210> 6 <211> 180 <212> DNA <213> Fragrant rice <400> 6 cctgtaatca tgtatacccc atcaatggaa atgatattcc tctcaataca tggtttatgt 60 tttctgttag gttgcattta ctgggagtta tgaaactggt atatatttca gctgctccta 120 tggttaaggt ttgtttccaa atttctgtgg atattttttg ttctctttct actaactctc 180 <210> 7 <211> 188 <212> DNA <213> Non - fragrant rice() <400> 7 cctgtaatca tgtatacccc atcaatggaa atgatattcc tctcaataca tggtttatgt 60 tttctgttag gttgcattta ctgggagtta tgaaactggt aaaaagatta tggcttcagc 120 tgctcctatg gttaaggttt gtttccaaat ttctgtggat attttttgtt ctctttctac 180 taactctc 188 <210> 8 <211> 18 <212> DNA <213> Artificial sequence() <400> 8 ttgcgcctga acggatat 18 <210> 9 <211> 20 <212> DNA <213> Artificial sequence() <400> 9 cggttgatct tttcgggatg 20 <211> 176 <212> DNA <213> Artificial Sequence() <400> 11 cctgtaatca tgtatacccc atcaatggaa atgatattcc tctcaataca tggtttatgt 60 tttctgttag gttgcattta ctgggagtta tgaaactggt amttcagctg ctcctatggt 120 taaggtttgt ttccaaattt ctgtggatat tttttgttct ctttctacta actctc 176
Claims
1. A method for quantitative detection of the purity of fragrant rice, characterized in that, The method includes: 1) Extract DNA from rice samples; 2) PCR amplification was performed using primers for amplifying differential fragment sequences of fragrant rice and non-fragrant rice; the primers for amplifying differential fragment sequences of fragrant rice and non-fragrant rice were primer 1 and primer 2, the sequence of primer 1 is shown in SEQ ID NO:1, and the sequence of primer 2 is shown in SEQ ID NO:2; The PCR amplification also includes a non-fragrant rice-specific probe, a fragrant rice-specific probe, and an endogenous reference probe. The non-fragrant rice-specific probe is badh2-7-22MGB-P, and the sequence of badh2-7-22MGB-P is shown in SEQ ID NO:
3. The fragrant rice-specific probe is badh2-7-VIC-P4, and the sequence of badh2-7-VIC-P4 is shown in SEQ ID NO:
5. The endogenous reference probe is badh2-7-CY5-P5, and the sequence of badh2-7-CY5-P5 is shown in SEQ ID NO:
4. 3) Set up endogenous reference genes for quantitative analysis to determine the purity of the rice sample. The analysis involves subtracting the CT value of the non-fragrant rice-specific probe from the CT value of the endogenous reference probe, then subtracting the CT value of the reference sample with 0% fragrant rice content from the CT value of the endogenous reference probe. The negative number of the resulting ΔCT is then raised to the square to obtain a relative content value, which is used to quantitatively determine the non-fragrant rice content in the sample. Conversely, the analysis involves subtracting the CT value of the fragrant rice-specific probe from the CT value of the endogenous reference probe, then subtracting the CT value of the reference sample with 100% fragrant rice content from the CT value of the endogenous reference probe. The negative number of the resulting ΔCT is then raised to the square to obtain a relative content value, which is also used to quantitatively determine the fragrant rice content in the sample.
2. The method as described in claim 1, characterized in that, The quantitative analysis is fluorescence quantitative analysis.
3. The method as described in any one of claims 1 or 2, characterized in that, The extraction of rice sample DNA includes extracting the DNA from the rice sample to be tested.
4. The method as described in claim 3, characterized in that, The method further includes extracting DNA from standard rice samples, wherein the standard rice samples are rice samples containing fragrant rice and / or non-fragrant rice.
5. The method as described in claim 4, characterized in that, The standard sample rice sample is one or more rice samples containing the following proportions. 100% fragrant rice, 95% fragrant rice, 90% fragrant rice, 85% fragrant rice, 80% fragrant rice, 75% fragrant rice, 70% fragrant rice, 65% fragrant rice, 60% fragrant rice, 55% fragrant rice, 50% fragrant rice, 45% fragrant rice, 40% fragrant rice, 35% fragrant rice, 30% fragrant rice, 25% fragrant rice, 20% fragrant rice, 15% fragrant rice, 10% fragrant rice, 5% fragrant rice, and 0% fragrant rice.
6. The method as described in claim 5, characterized in that, It includes more than 5 of the aforementioned rice samples.
7. The method as described in claim 1, characterized in that, The non-fragrant rice specific probe, fragrant rice specific probe, and endogenous reference probe use different fluorescent labels.
8. The method as described in claim 7, characterized in that, The fluorescent label is selected from one of FAM, VIC, and CY5.
9. A method for quantitatively detecting the purity of fragrant rice, characterized in that, The method includes: 1) Extract DNA from the rice sample to be tested and the standard rice sample, wherein the standard rice sample is a rice sample containing fragrant rice and / or non-fragrant rice. The standard sample rice sample is one or more of the following rice samples in proportion: 100% fragrant rice, 95% fragrant rice, 90% fragrant rice, 85% fragrant rice, 80% fragrant rice, 75% fragrant rice, 70% fragrant rice, 65% fragrant rice, 60% fragrant rice, 55% fragrant rice, 50% fragrant rice, 45% fragrant rice, 40% fragrant rice, 35% fragrant rice, 30% fragrant rice, 25% fragrant rice, 20% fragrant rice, 15% fragrant rice, 10% fragrant rice, 5% fragrant rice, and 0% fragrant rice; 2) Using the DNA extracted in step 1) as templates, real-time fluorescent PCR was performed with primers badh2-7-LF1 and badh2-7-LR1, non-fragrant rice-specific probe badh2-7-22MGB-P, fragrant rice-specific probe badh2-7-VIC-P4, and endogenous reference probe badh2-7-CY5-P5. The primer badh2-7-LF1 sequence is shown in SEQ ID NO:1; the primer badh2-7-LR1 sequence is shown in SEQ ID NO:2; the badh2-7-22MGB-P sequence is shown in SEQ ID NO:3; the badh2-7-VIC-P4 sequence is shown in SEQ ID NO:5; and the badh2-7-CY5-P5 sequence is shown in SEQ ID NO:
4. The non-fragrant rice-specific probe, fragrant rice-specific probe, and endogenous reference probe use different fluorescent labels; 3) Set up an endogenous reference gene to analyze the quantitative real-time PCR data to determine the purity of fragrant rice and / or non-fragrant rice in the rice sample to be tested. The analysis of the quantitative real-time PCR data is as follows: subtract the CT value of the non-fragrant rice-specific probe from the CT value of the endogenous reference probe, and then subtract the ΔCT value of the reference sample with 0% fragrant rice content. The negative number of the obtained ΔCT is raised to the square to obtain a relative content value, which is used to quantitatively determine the non-fragrant rice content in the sample. Similarly, subtract the CT value of the fragrant rice-specific probe from the CT value of the endogenous reference probe, and then subtract the ΔCT value of the reference sample with 100% fragrant rice content. The negative number of the obtained ΔCT is raised to the square to obtain a relative content value, which is used to quantitatively determine the fragrant rice content in the sample.
10. The method as described in claim 9, characterized in that, The fluorescent labels used for the non-fragrant rice specific probe, the fragrant rice specific probe, and the endogenous reference probe are selected from one of FAM, VIC, CY5, HEX, Texas Red, and ROX, respectively.
11. The method as described in claim 9, characterized in that, The fluorescent labels used for the non-fragrant rice specific probe, the fragrant rice specific probe, and the endogenous reference probe are one of FAM, VIC, and CY5, respectively.
12. A reagent kit for quantitative determination of the purity of fragrant rice, characterized in that, The kit includes: 1) Primers: badh2-7-LF1 and badh2-7-LR1; and 2) Probes: non-fragrant rice specific probe badh2-7-22MGB-P, fragrant rice specific probe badh2-7-VIC-P4, and endogenous reference probe badh2-7-CY5-P5; The primer badh2-7-LF1 sequence is shown in SEQ ID NO:1; the primer badh2-7-LR1 sequence is shown in SEQ ID NO:2; the badh2-7-22MGB-P sequence is shown in SEQ ID NO:3; the badh2-7-VIC-P4 sequence is shown in SEQ ID NO:5; and the badh2-7-CY5-P5 sequence is shown in SEQ ID NO:4.
Citation Information
Patent Citations
Specified primer for detecting specific mutation of oryza sativa L. aromatic gene, and application
CN111705151A