A relative quantitative detection method for gastric tissue tRNA-derived fragments and its application

Abstract

The present invention relates to an application of primers for detecting tRF-28 expression in tissues in the preparation of a gastric cancer auxiliary diagnosis kit, characterized in that: the nucleotide sequence of the tRF-28 is as shown in SEQ ID NO: 1, and the expression of the tRF-28 is specifically downregulated in gastric cancer patient tissues: the primers are: F1: 5'-CTCCCGGTTGGCTTCCTAAG-3'; R1: 5'-GGTACCTCCTCTCTTCTCTACT-3'. Compared with the prior art, the advantage of the present invention is that the specifically downregulated tRF-28 in gastric cancer tissues can be used as a new molecular marker for gastric cancer diagnosis.

Description

Technical Field

[0001] The present invention relates to a method for detecting tRNA-derived fragments in gastric cancer tissue, and in particular to a relative quantitative detection method for tRF-28 in gastric tissue and an application thereof. Background Art

[0002] Gastric cancer is one of the most common malignant tumors in my country. The incidence and mortality rates of gastric cancer in China are increasing year by year. Despite significant progress in gastric cancer treatment, early diagnosis remains difficult because its etiology remains unclear.

[0003] Early diagnosis is crucial for improving the prognosis of gastric cancer patients. However, patients with early-stage gastric cancer are often asymptomatic or present with atypical symptoms. Consequently, most patients are already in the advanced stage when initially diagnosed, resulting in a poor prognosis and a 5-year survival rate of less than 30%. However, with early diagnosis and treatment, the 5-year survival rate can reach 90%. Therefore, the discovery of new gastric cancer diagnostic markers is of great value for early diagnosis, assessment of treatment efficacy, and prediction of recurrence.

[0004] Recent studies have shown that tRNA-derived fragments (tRFs) are small noncoding RNA molecules with regulatory functions produced by the specific cleavage of tRNAs. They are involved in various physiological and pathological processes. Due to their stable structure and tissue-specific expression, tRFs have great potential as novel biomarkers for tumor diagnosis. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a primer for detecting tRF-28 expression in tissues and its application in preparing a gastric cancer auxiliary diagnosis kit in response to the above-mentioned existing technical status.

[0006] The technical solution adopted by the present invention to solve the above technical problems is: the use of the primer for detecting tRF-28 expression in tissue in the preparation of a gastric cancer auxiliary diagnosis kit, characterized in that the nucleotide sequence of tRF-28 is as shown in SEQ ID NO: 1, and the specific expression of tRF-28 in gastric cancer patient tissue is downregulated:

[0007] The primers are:

[0008] F1: 5'-CTCCCGGTTGGCTCTCCTAAG-3';

[0009] R1: 5'-GGTACCTCCTCTTCTCTACT-3'.

[0010] Furthermore, the kit also includes specific upstream and downstream primers for amplification of the internal reference small nuclear RNU6:

[0011] F2: 5'-CGGCAGCACATATACTAAAATTGGAA-3'

[0012] R2: 5'-CGAATTTGGCGTGTCATCCTTGCG-3'.

[0013] Furthermore, the kit also includes a reverse transcription primer sequence of the internal reference small nuclear RNU6:

[0014] 5'-GCAGACGAGGGTACCTCCTCTCTTCTACTCGTGTCCTACCCTCGTCTGCAAAATA-3'.

[0015] The reverse transcription primer sequence of tRF-28 is:

[0016] 5'-GCAGACGAGGGTACCTCCTCTCTTCTACTCGTGTCCTACCCTCGTCTGCACCCAC-3'.

[0017] The present invention also provides a method for detecting tRF molecular markers, characterized in that the method comprises the following steps:

[0018] (1) Collect gastric cancer tissue, weigh the tissue, and extract total RNA from the tissue;

[0019] (2) specific reverse transcription of total RNA into cDNA;

[0020] (3) The cDNA was detected by real-time fluorescence quantitative PCR. After the reaction, the Cq values ​​of tRF-28 and the internal reference small nuclear RNU6 in the sample were detected;

[0021] (4) Based on the Cq value, the tRF level was normalized by the expression level of the internal reference gene RNU6, and the PCR relative quantitative value of tRF-28 was calculated using the -ΔCq formula, where -ΔCq = Cq(RNU6)-Cq(tRF-28);

[0022] When the PCR relative quantitative value of the tRF-28 biomarker in the sample is less than or equal to -4.435, it is considered to be an early gastric cancer sample; when it is greater than -4.435, it is considered to be a non-early gastric cancer sample;

[0023] When the PCR relative quantitative value of the tRF-28 biomarker in the sample is less than or equal to -4.778, it is considered to be a gastric advanced cancer sample; when it is greater than -4.778, it is considered to be a non-gastric advanced cancer sample;

[0024] The process of extracting total RNA from gastric cancer tissue in step (1) is as follows:

[0025] Step a: Collect gastric cancer tissue samples: Take 10-20 mg of gastric cancer tissue and immerse it in a nuclease-free centrifuge tube containing 1-2 mL of RNA preservation solution; if not used immediately, store it in a -80°C ultra-low temperature freezer;

[0026] Step b, tissue lysis: Remove the tissue from step a from the -80°C freezer and thaw at room temperature. After blotting the RNA preservation solution with filter paper, excise approximately 15 mg of tissue at multiple locations and place it in a 2 mL nuclease-free centrifuge tube pre-filled with 1 mL of Trizol reagent. Grind the gastric cancer tissue thoroughly into a homogenate using an electric homogenizer and incubate at 3-5°C for 10 minutes to completely dissociate the nucleic acid-protein complex.

[0027] Step c, chloroform extraction: Add 200 μL of chloroform, shake on a vortex shaker for 15 seconds, incubate at 3-5°C for 5 minutes; centrifuge at 12000 rpm, 4°C for 15 minutes. After centrifugation, the mixture will separate into a lower red phenol-chloroform phase, and RNA will be enriched in the upper aqueous phase. Carefully pipette approximately 400 μL to 650 μL of the upper aqueous phase into a nuclease-free centrifuge tube;

[0028] Step d, isopropanol precipitation: add isopropanol equal to the volume of the upper aqueous layer in step c, shake to mix, let stand at 4°C for 15 minutes, centrifuge at 12000 rpm, 4°C for 10 minutes, discard the supernatant to obtain RNA precipitate;

[0029] Step e, ethanol washing and precipitation: discard the supernatant and add 1 mL of 75% ethanol to wash the precipitate. Centrifuge at 12,000 rpm for 5 minutes at 4°C, discard the supernatant, let it stand at room temperature for 10 minutes to dry, and then add 20 μL of nuclease-free water to dissolve the precipitate. This is the total RNA extract from the tissue, which is stored at -80°C until use.

[0030] The process of specifically reverse transcribing total RNA into cDNA in step (2) above is as follows: 2 μg of the above RNA extract was mixed with 2 μL of specific reverse transcription primers for tRF-28 and internal reference small nuclear RNU6 at a concentration of 0.005 μM, 4 μL of 5× Polestar RTMasterMix (with dsDNase), and enzyme-free water was added to bring the total volume to 20 μL. The mixture was mixed and placed on ice. The reverse transcription reaction system in Table 1 was used for the machine operation. The reaction conditions were the rapid two-step method: first, 37°C for 30 minutes to synthesize cDNA, then 85°C for 5 minutes to inactivate the reverse transcriptase, and finally stored at -20°C for use.

[0031] The real-time quantitative PCR reaction conditions in step (3) are as follows: pre-denaturation at 98°C for 5 minutes; then denaturation at 98°C for 10 seconds, annealing at 51°C for 30 seconds, and extension at 68°C for 20 seconds, for 40 cycles; finally, melting curve analysis is performed and the cells are kept warm at 4°C.

[0032] The present invention also provides a use of a tRF molecular marker in preparing a gastric cancer auxiliary diagnosis kit. The kit includes enzymes and reagents commonly used in PCR reactions, such as Taq enzyme, dNTP mixture, fluorescent reagent, PCR buffer, and diethylpyrocarbonate (DEPC) water.

[0033] Compared with the existing technology, the present invention has the advantages that tRF-28, whose expression is specifically downregulated in gastric cancer patient tissue, can be used as a new molecular marker for gastric cancer diagnosis. This molecular marker can be used to diagnose gastric cancer simply and quickly. By using reagents such as TRIzol and isopropanol and adopting methods such as mixing and centrifugation, RNA with good concentration and purity can be extracted. Only about 2 μg of gastric cancer tissue is required for tRF detection, making it an effective tool for gastric cancer diagnosis, pathological grading, clinical staging, and treatment efficacy assessment, with good clinical application prospects. The real-time quantitative PCR instrument used is a common instrument, and the SYBR Green fluorescent dye method does not require the design of separate probes to simultaneously detect the target tRF and the internal reference gene, making it economical and convenient. The method provided by the present invention is of great significance for further research on the biological functions of gastric cancer-related tRFs. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 This is a diagram showing the results of tRF next-generation sequencing of gastric cancer tissue in Example 1 of the present invention;

[0035] Figure 2 Graph showing the amplification curves of tRF-28 and RNU6-2 in normal tissues and early gastric cancer tissues in Example 2 of the present invention;

[0036] Figure 3 Graph showing the amplification curves of tRF-28 and RNU6-2 in normal tissues and advanced gastric cancer tissues in Example 2 of the present invention;

[0037] Figure 4 This is a graph showing the expression levels of tRF-28 in healthy human tissues and early gastric cancer patient tissues in Example 3 of the present invention;

[0038] Figure 5 This is the ROC curve diagram for the detection of tRF-28 in early gastric cancer tissue in Example 3 of the present invention;

[0039] Figure 6 This is a graph showing the expression levels of tRF-28 in healthy human tissues and advanced gastric cancer patient tissues in Example 4 of the present invention;

[0040] Figure 7 : This is the ROC curve diagram of the detection of tRF-28 in gastric advanced cancer tissue in Example 4 of the present invention;

[0041] Figure 8 This is a graph showing the results of using tRF-28 as a biomarker for prognostic evaluation in Example 5 of the present invention. DETAILED DESCRIPTION

[0042] The present invention will be described in further detail below with reference to the accompanying drawings and embodiments.

[0043] Example 1

[0044] Detection of tRF-28 expression in gastric cancer tissues and normal gastric tissues:

[0045] Sequencing detection: The tRF sequencing reagent of Arraystar Company of the United States was used to detect the level of tRF in gastric cancer tissues and normal tissues using the next generation sequencing method.

[0046] Result analysis: The results are as follows Figure 1 As shown in Figure 2, by analyzing gastric cancer tissues and adjacent tissues, molecular markers of tRNA-derived fragments with significantly downregulated expression were obtained. The difference in tRF-28 between gastric cancer tissues and normal tissues was 6.25 times. Figure 1 The arrow indicates that tRF-28 may function as a tumor suppressor gene in gastric cancer. tRF-28 is a newly discovered noncoding RNA consisting of 28 bases that originates from the internal region of mature tRNA-Arg-CCT-4-1.

[0047] Example 2

[0048] Normal gastric tissue was collected as a normal control group, and tRF was detected according to the following steps, including the following steps:

[0049] (1) Collect gastric cancer tissue, weigh the tissue, and extract total RNA from the tissue;

[0050] (2) specific reverse transcription of total RNA into cDNA;

[0051] (3) The cDNA was detected by real-time fluorescence quantitative PCR. After the reaction, the Cq values ​​of tRF-28 and the internal reference small nuclear RNU6 in the sample were detected;

[0052] (4) Based on the Cq value, the tRF level was normalized by the expression level of the internal reference micronuclear RNU6, and the PCR relative quantitative value of tRF-28 was calculated using the -ΔCq formula, where -ΔCq = Cq(RNU6)-Cq(tRF-28);

[0053] When the PCR relative quantitative value of the tRF-28 biomarker in the sample is less than or equal to -4.435, it is considered to be an early gastric cancer sample; when it is greater than -4.435, it is considered to be a non-early gastric cancer sample;

[0054] When the PCR relative quantitative value of the tRF-28 biomarker in the sample is less than or equal to -4.778, it is considered to be a gastric advanced cancer sample; when it is greater than -4.778, it is considered to be a non-gastric advanced cancer sample;

[0055] The process of extracting total RNA from gastric cancer tissue in step (1) is as follows:

[0056] Step a: Collect gastric cancer tissue samples: Take 10-20 mg of gastric cancer tissue and immerse it in a nuclease-free centrifuge tube containing 1-2 mL of RNA preservation solution; if not used immediately, store it in a -80°C ultra-low temperature freezer;

[0057] Step b, tissue lysis: Remove the tissue from step a from the -80°C freezer and thaw at room temperature. After blotting the RNA preservation solution with filter paper, excise approximately 15 mg of tissue at multiple locations and place it in a 2 mL nuclease-free centrifuge tube pre-filled with 1 mL of Trizol reagent. Grind the gastric cancer tissue thoroughly into a homogenate using an electric homogenizer and incubate at 3-5°C for 10 minutes to completely dissociate the nucleic acid-protein complex.

[0058] Step c, chloroform extraction: Add 200 μL of chloroform, shake on a vortex shaker for 15 seconds, incubate at 3-5°C for 5 minutes; centrifuge at 12000 rpm, 4°C for 15 minutes. After centrifugation, the mixture will separate into a lower red phenol-chloroform phase, and RNA will be enriched in the upper aqueous phase. Carefully pipette approximately 400 μL to 650 μL of the upper aqueous phase into a nuclease-free centrifuge tube;

[0059] Step d, isopropanol precipitation: add isopropanol equal to the volume of the upper aqueous layer in step c, shake to mix, let stand at 4°C for 15 minutes, centrifuge at 12000 rpm, 4°C for 10 minutes, discard the supernatant to obtain RNA precipitate;

[0060] Step e, ethanol washing and precipitation: discard the supernatant and add 1 mL of 75% ethanol to wash the precipitate. Centrifuge at 12,000 rpm for 5 minutes at 4°C, discard the supernatant, let it stand at room temperature for 10 minutes to dry, and then add 20 μL of nuclease-free water to dissolve the precipitate. This is the total RNA extract from the tissue, which is stored at -80°C until use.

[0061] The process of specifically reverse transcribing total RNA into cDNA in step (2) above is as follows: 2 μg of the above RNA extract was mixed with 2 μL of specific reverse transcription primers for tRF-28 and internal reference small nuclear RNU6 at a concentration of 0.005 μM, 4 μL of 5× Polestar RTMasterMix (with dsDNase), and enzyme-free water was added to bring the total volume to 20 μL. The mixture was mixed and placed on ice. The reverse transcription reaction system in Table 1 was used for the machine operation. The reaction conditions were the rapid two-step method: first, 37°C for 30 minutes to synthesize cDNA, then 85°C for 5 minutes to inactivate the reverse transcriptase, and finally stored at -20°C for use.

[0062] The real-time quantitative PCR reaction conditions in step (3) are as follows: pre-denaturation at 98°C for 5 minutes; then denaturation at 98°C for 10 seconds, annealing at 51°C for 30 seconds, and extension at 68°C for 20 seconds, for 40 cycles; finally, melting curve analysis is performed and the cells are kept warm at 4°C.

[0063] The specific upstream and downstream primers for tRF-28 amplification used are:

[0064] F1: 5'-CTCCCGGTTGGCTCTCCTAAG-3';

[0065] R1: 5'-GGTACCTCCTCTTCTCTACT-3'

[0066] The specific upstream and downstream primers for amplification of the internal reference small nuclear RNU6 used are:

[0067] F2: 5'-CGGCAGCACATATACTAAAATTGGAA-3'

[0068] R2: 5'-CGAATTTGGCGTGTCATCCTTGCG-3'

[0069] Table 1. Specific reverse transcription reaction system

[0070]

[0071] Table 2. Fluorescent dye quantitative PCR reaction system

[0072]

[0073] Table 3. PCR parameters

[0074]

[0075] from Figure 2It can be seen that tRF-28 and RNU6 are effectively amplified in both normal tissue and early gastric cancer tissue, and amplification curves of the RNU6 and tRF-28 expression levels in the tissue samples can be obtained. From the amplification curve of RNU6, the Cq values ​​of the detected early gastric cancer tissue and normal gastric tissue specimens are 19.804 and 22.799, respectively. A comparison of tRF-28 expression levels in normal tissue and early gastric cancer tissue can be obtained, which is consistent with the results of gene sequencing in Example 1.

[0076] from Figure 3 It can be seen that tRF-28 and RNU6 are effectively amplified in normal tissues and advanced gastric cancer tissues, and amplification curves of the expression levels of RNU6 and tRF-28 in tissue samples can be obtained. Among them, from the amplification curve of RNU6, the Cq values ​​of the detected advanced gastric cancer tissue and normal gastric tissue specimens are 22.917 and 23.912, respectively. A comparison of the tRF-28 expression levels in normal tissues and advanced gastric cancer tissues can be obtained, which is consistent with the results of gene sequencing in Example 1.

[0077] The Cq values ​​of RNU6 and tRF-28 in the same specimen were simultaneously used to calculate the -ΔCq value of tRF-28 according to the calculation formula -ΔCq = Cq(RNU6) - Cq(tRF-28). The relative expression level of tRF-28 can be determined based on the -ΔCq value; the smaller the -ΔCq value, the lower the corresponding tRF-28 expression level, and the larger the -ΔCq value, the higher the corresponding tRF-28 expression level;

[0078] from Figure 2 It can be obtained that -ΔCq of normal tissue is -5.474; -ΔCq of gastric cancer tissue is -7.860, which is significantly lower than the -ΔCq value of normal tissue, indicating that tRF-28 is lowly expressed in early gastric cancer tissue.

[0079] from Figure 3 It can be concluded that -ΔCq of normal tissue is -5.051; -ΔCq of gastric cancer tissue is -6.452, which are significantly lower than the -ΔCq value of normal tissue, indicating that tRF-28 is lowly expressed in advanced gastric cancer tissue.

[0080] Example 3 Application of tRF-28 biomarker for diagnosis of early gastric cancer

[0081] Methods for gastric cancer detection

[0082] The steps include:

[0083] 1. Collect tissue samples;

[0084] 2. Extraction of RNA from gastric cancer tissue (extraction method is the same as in Example 2);

[0085] 3. Specific reverse transcription and fluorescent dye qRT-PCR detection were performed in the same manner as in Example 2 “Specific reverse transcription and fluorescent dye qRT-PCR detection”;

[0086] 4. Using tRF-28 as a biomarker for early gastric cancer detection, the expression levels of tRF-28 in 60 early gastric cancer tissues and 48 healthy subjects' gastric tissues were analyzed, and ROC curves were constructed. Figure 5 As shown, the AUC value was 0.8503, P<0.0001, and the -ΔCq of tRF-28 in the tissues of patients with early gastric cancer was significantly lower than that in the healthy group, proving that the expression level of tRF-28 in the patients was significantly lower than that in the healthy group. Figure 4 Table 4 shows the results of tRF-28 as a biomarker for early gastric cancer diagnosis. The cutoff value of tRF-28 as an early gastric cancer marker is -4.435. When the PCR relative quantitative value -ΔCq of the tRF-28 biomarker in the sample is less than or equal to -4.435, it is considered to be an early gastric cancer sample; when it is greater than -4.435, it is considered to be a non-gastric cancer sample. Figure 5 It can be concluded that the sensitivity of tRF-28 as a marker for early gastric cancer is 0.8333 and the specificity is 0.75.

[0087] Table 4. Results of tRF-28 as a biomarker for early gastric cancer diagnosis

[0088]

[0089] Example 4 Application of tRF-28 biomarker for diagnosis of advanced gastric cancer

[0090] Using tRF-28 as a biomarker for the detection of advanced gastric cancer, the expression levels of tRF-28 in cancer tissues of 126 patients with advanced gastric cancer and 48 healthy subjects were analyzed, and the ROC curve was constructed. Figure 7 As shown in Figure 3, the AUC value was 0.8985, P < 0.0001, and the -ΔCq of tRF-28 in gastric advanced cancer tissues was significantly lower than that in the healthy group, proving that the expression level of tRF-28 in gastric advanced cancer tissues was significantly lower than that in the healthy group. Figure 6 Table 5 shows the results of tRF-28 as a biomarker for the diagnosis of advanced gastric cancer. The cutoff value of tRF-28 as a biomarker for advanced gastric cancer is -4.778. When the PCR relative quantitative value -ΔCq of the tRF-28 biomarker in the sample is less than or equal to -4.778, it is considered to be an advanced gastric cancer sample; when it is greater than -4.778, it is considered to be a non-gastric cancer sample. Figure 7 It can be concluded that the sensitivity of tRF-28 as a gastric cancer marker is 0.8492 and the specificity is 0.8125.

[0091] Table 5. Results of tRF-28 as a diagnostic biomarker in advanced gastric cancer.

[0092]

[0093] Example 5 Application of tRF-28 as a biomarker for prognostic assessment

[0094] The relative quantitative results showed that the relative expression level of tRF-28 in the tissues of patients with early gastric cancer was significantly lower than that in the healthy population (P<0.0001); the relative expression level of tRF-28 in the tissues of patients with advanced gastric cancer was significantly lower than that in the healthy population (P<0.0001), among which the relative expression level of tRF-28 in the tissues of patients with advanced gastric cancer was the lowest.

[0095] The area under the ROC curve of tRF-28 in tissues of patients with early gastric cancer was 0.8503. When the cutoff value -ΔCq was -4.435, its sensitivity was 0.8333, specificity was 0.75, positive predictive value was 80.60%, and negative predictive value was 78.30%. The area under the ROC curve of tRF-28 in tissues of patients with advanced gastric cancer was 0.8985. When the cutoff value -ΔCq was -4.778, its sensitivity was 0.8492, specificity was 0.8125, positive predictive value was 92.20%, and negative predictive value was 67.20%. Figure 8 As shown, the survival curve was used to evaluate the prognosis of patients with advanced gastric cancer. The cutoff value -ΔCq obtained by distinguishing healthy people from advanced gastric cancer tissues was -4.778 for analysis. Patients with values ​​greater than -4.778 were considered negative, and patients with values ​​less than or equal to -4.778 were considered positive. It was found that the prognosis of the tRF-28 low expression group was poor.

[0096] Example 6 Detection kit and its application

[0097] The tRF-28 biomarker detection kit for gastric cancer detection in this embodiment contains, in addition to conventional real-time quantitative PCR reagents, an internal reference detection primer and a tRF-28 detection primer. Conventional real-time quantitative PCR reagents include Taq enzyme, dNTP reagents, a fluorescent reagent, PCR buffer, and DEPC (diethylpyrocarbonate)-treated water (RNase-free water). When using this detection kit for detection, the specific operating procedures can refer to the operating procedures in Example 2 for sample detection and gastric cancer diagnosis.

[0098] The detection kit in this example can be used to simply, quickly and conveniently detect the tRF-28 biomarker to determine the status of gastric cancer and facilitate treatment. Sequence Listing <110> Ningbo First Hospital <120> A relative quantitative detection method for gastric tissue tRNA-derived fragments and its application <160> 1 <170> SIPOSequenceListing 1.0 <210> 1 <211> 28 <212> RNA <400> 1 uuggcuuccu aagccaggga uugggggu 28

Claims

1. Use of a primer for detecting tRF-28 expression in tissue in the preparation of a gastric cancer auxiliary diagnosis kit, wherein the primer is The characteristics are: the nucleotide sequence of the tRF-28 is shown in SEQ ID NO: 1, the tRF-28 is expressed in gastric cancer tissues Specific downregulation of expression: The primers are: F1: 5'-CTCCCGGTTGGCTCTCCTAAG- 3'; R1: 5'-GGTACCTCCTCTTCTCTACT-3'.

2. The use according to claim 1, characterized in that: The kit also includes an internal reference small nuclear RNU6 Specific amplification upstream and downstream primers: F2: 5'-CGGCAGCACATATACTAAAATTGGAA-3'; R2: 5'-CGAATTTGGCGTGTCATCCTTGCG-3'.

3. The use according to claim 2, characterized in that: The kit also includes an internal reference small nuclear RNU6 The reverse transcription primer sequences are: 5'-GCAGACGAGGGTACCTCCTCTCTTCTACTCGTGTCCTACCCTCGTCTGCA AAATA -3'; The reverse transcription primer sequence of tRF-28 is: 5'-GCAGACGAGGGTACCTCCTCTCTTCTACTCGTGTCCTACCCTCGTCTGCA CCCAC-3'.

Images