Tuberculosis vaccine based on bovine beta defensin 5 and its use in the prevention of tuberculosis
By designing the fusion protein vaccine AHB-P and the fusion DNA vaccine pVAX1-AHB, which contain tuberculosis antigen AH and bovine β-defensin 5, the problems of existing vaccines being ineffective in adults and high costs in controlling bovine tuberculosis have been solved, achieving effective tuberculosis prevention.
Patent Information
- Application Number
- CN202210510029.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-05-11
- Publication Date
- 2026-03-27
- Estimated Expiration
- 2042-05-11
AI Technical Summary
Existing tuberculosis vaccines are ineffective in adults, and control measures for bovine tuberculosis are costly and difficult to implement in developing countries. Currently, there is a lack of research on the application of bovine β-defensin 5 in tuberculosis vaccines.
The fusion protein vaccine AHB-P and the fusion DNA vaccine pVAX1-AHB were designed, containing tuberculosis antigen AH and bovine β-defensin 5. They prevent tuberculosis infection through respiratory mucosal immunization, reduce vaccine preparation costs, and optimize vaccine expression and administration.
The two fusion vaccines, administered intranasally, can significantly enhance the body's immune response to bovine tuberculosis, reduce the inflammatory area and bacterial load in the lungs, and provide effective protection.
Smart Images

Figure CN115300618B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of animal disease immunity and vaccine, and specifically, the present application provides a tuberculosis vaccine based on bovine beta defensin 5 and its application in preventing tuberculosis. BACKGROUND
[0002] Tuberculosis (TB) is caused by Mycobacterium tuberculosis complex (MTBC), of which the two main pathogens are Mycobacterium tuberculosis (Mtb) and Mycobacterium bovis (M.bovis). TB mainly caused by Mtb causes great harm to global human health, with more than 1 million people dying of Mtb every year. Bovine tuberculosis (bTB) caused by M.bovis is a zoonosis that has a significant impact on global human health and the development of the livestock industry, not only causing serious economic losses to the livestock industry, but also posing a threat to human health. In some countries or regions, 3.1%-30.2% of TB patients are caused by M.bovis infection. bTB is listed as a class B animal disease by the World Organization for Animal Health (OIE) and as a class II animal disease by the agricultural department of China. The current control measure for human TB is to vaccinate Bacille Calmette-Guerin (BCG) in infancy, but BCG is only effective for children and ineffective for adults. The control of bTB is carried out by the "diagnosis-killing" method for purification and eradication, however, this measure is costly and difficult to implement in developing countries. Despite efforts to control TB for more than a hundred years, the situation of tuberculosis is still severe, seriously affecting human health and the development of the livestock industry.
[0003] There have been reports of designing host immune regulatory molecules into tuberculosis vaccines, such as murine beta defensin 2, cytokine IL-12 and macrophage colony factor, which are mainly used in DNA vaccine design. However, there is no report on the application of bovine beta defensin 5 to tuberculosis vaccine research. Our previous study found that respiratory mucosal bovine beta defensin 5 (B5) can promote vaccine-induced specific immune response and enhance the immune regulation of the body against M.bovis infection (Patent No. CN202110285747.6). However, the expression of B5 in Pichia pastoris and Escherichia coli is low, and the vaccine we designed will be used for target animals, cattle, which are large animals, and the use amount is large. The low expression of B5 is not conducive to the subsequent clinical application. SUMMARY
[0004] To solve the above problems, the applicant further designed two vaccines by fusing and expressing the AH and B5 antigens of Mycobacterium bovi, i.e. a fusion protein vaccine AHB-P and a fusion DNA vaccine pVAX1-AHB. The pVAX1-AHB vaccine does not need additional adjuvant, greatly reducing the cost of vaccine preparation, and the actual research has confirmed that AHB-P and pVAX1-AHB can prevent tuberculosis infection through respiratory mucosal immunity.
[0005] In one aspect, the present application provides a tuberculosis vaccine comprising a fusion protein AHB of AH antigen of Mycobacterium bovi and bovine beta defensin 5.
[0006] Further, the fusion protein AHB is encoded by the nucleotide sequence shown in SEQ ID NO. 1; preferably, the tuberculosis vaccine further comprises poly I:C.
[0007] In one aspect, the present application provides a tuberculosis vaccine comprising a pVAX1-AHB construct comprising a nucleic acid encoding AH antigen of Mycobacterium bovi and bovine beta defensin 5.
[0008] Further, the construct comprises a nucleic acid with the sequence of SEQ ID NO. 2 and a vector pVAX1.
[0009] Further, the vaccine further comprises an adjuvant and / or an auxiliary material.
[0010] Further, the tuberculosis vaccine comprising the pVAX1-AHB construct does not comprise an adjuvant.
[0011] Further, the vaccine is a mucosal vaccine.
[0012] Further, the vaccine is a respiratory mucosal vaccine.
[0013] Further, the vaccine is a nasal mucosal vaccine.
[0014] Further, the present application provides the use of the above vaccine in the preparation of a vaccine for preventing or treating diseases caused by Mycobacterium bovi.
[0015] Further, the disease caused by Mycobacterium bovi is bovine tuberculosis.
[0016] The bovine beta defensin 5 described in the present application is also called beta-defensin-5, B5 or simply B; the bovine beta defensin 5 sequence described in the present application is not limited to the sequence used in actual preparation in the examples, and other known and unknown natural and artificial variants can also be used. The AH antigen described in the present application is an antigen formed by connecting Ag85A and HspX in various ways, and the Ag85A and HspX sequences described in the present application are not limited to the sequences used in actual preparation in the examples, and other known and unknown natural and artificial variants can also be used.
[0017] The mucosal vaccine in the present application can be a vaccine administered through oral, nasal, gastric, upper respiratory tract mucosa, etc., preferably a vaccine administered through nasal mucosa.
[0018] The adjuvant of the present application comprises various adjuvants known in the art and under research for enhancing immune effect, including but not limited to mineral adjuvants, oil emulsion adjuvants, and microbial adjuvants. BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1 : Purification and identification of AHB: (A) Purification of AHB; (B) Western blot identification of AHB; (C) pVAX1-AHB expression identification;
[0020] Figure 2A and Figure 2B : Effect of vaccine on lung to produce AH-specific IFN-γ or IL-17 CD4 + T cells; ***p<0.0001;
[0021] Figure 3 : Evaluation of protective effect of vaccine: (A) HE staining of left lung section scanning; (B) percentage of lung inflammatory area; (C and D) bacterial load of lung and spleen; *p<0.033, **p<0.0021, ***p<0.0002. DETAILED DESCRIPTION
[0022] Example 1 Preparation of fusion vaccine
[0023] Codon optimization of fusion gene sequence
[0024] (1) The AHB sequence of AHB-P fusion protein vaccine is optimized according to the preferred codons of Escherichia coli, and the optimized gene sequence is as follows:
[0025] ATGCAGTTAGTTGATCGTGTTCGTGGCGCCGTGACCGGCATGAGCCGCCGTCTGGTTGTTGGTGCGGTGGGCGCGGCGCT GGTTAGTGGCCTGGTGGGCGCGGTTGGCGGCACGGCGACCGCCGGTGCGTTTAGCCGCCCGGGTCTGCCGGTGGAATATCTGCAAGTGCCGAGCCCGAGCATGGGCCGCGATATTAAAGTGCAGTTTCAGAGCGGCGGCGCGAACAGCCCGGCGCTGTAT CTGCTGGATGGCCTGCGCGCGCAAGATGATTTTAGCGGCTGGGATATTAACACCCCGGCGTTTGAATGGTATGATCAGAGCGGCCTGAGCGTGGTGATGCCGGTGGGCGGTCAGAGCAGCTTTTATAGCGATTGGTATCAGCCGGCGTGCGGCAAAGCGG GCTGTCAGACCTATAAATGGGAAACCTTTCTGACGAGCGAGCTGCCGGGCTGGTTACAAGCGAACCGCCATGTGAAACCGACCGGCAGCGCGGTGGTGGGCCTGAGCATGGCGGCGAGCAGCGCGCTGACCCTGGCGATTTATCATCCGCAGCAGTTTGT GTATGCGGGCGCGATGAGCGGCCTGTTAGATCCGAGCCAAGCGATGGGCCCGACCCTGATTGGCCTGGCGATGGGCGATGCGGGCGGCTATAAAGCGAGCGATATGTGGGGCCCGAAAGAAGATCCGGCGTGGCAGCGCAACGATCCGCTGCTGAACGTG GGCAAACTGATTGCGAACAACACCCGCGTGTGGGTGTATTGCGGCAACGGCAAACCGAGCGATCTGGGCGGCAACAACCTGCCGGCGAAATTTCTGGAAGGCTTCGTGCGCACGAGCAACATTAAATTTCAAGATGCGTATAACGCCGGCGGTGGCCATAACGGCGTGTTTGATTTTCCGGATAGCGGCACCCATAGCTGGGAATATTGGGGCGCGCAGCTGAACGCCATGAAACCGGATCTGCAACGCGCGTTAGGCGCGACCCCGAACACCGGTCCGGCGCCGCAAGGCGCCGGCGGTGGCGGTAGCGGCGGTGGCGGTAGTATGGCGACCACCCTGCCGGTGCAGCGCCATCCGCGCAGCCTGTTTCCGGAATTTAGCGAACTGTTTGCGGCGTTTCCGAGCTTTGCGGGCCTGCGCCCGACCTTTGATACCCGCCTGATGCGCCTGGAAGATGAAATGAAAGAAGGCCGCTATGAAGTGCGCGCGGAACTGCCGGGCGTTGACCCGGATAAAGATGTGGATATTATGGTGCGCGATGGTCAGCTGACCATTAAAGCGGAACGCACCGAACAGAAAGATTTTGATGGCCGCAGCGAATTTGCGTATGGCAGTTTTGTGCGCACCGTGAGCTTACCGGTGGGCGCGGATGAAGATGATATTAAAGCGACCTATGATAAAGGCATTCTGACCGTGAGCGTGGCGGTGAGCGAAGGCAAACCGACCGAAAAACATATTCAGATTCGCAGCACCAACGGCGGTGGCGGTAGTGGCGGCGGTGGCAGCGGCGGTGGCGGCAGTATGCGTTTACATCATCTGTTACTGGTGCTGCTGTTTCTGGTGCTGAGCGCGGGCAGCGGCTTTACCCAAGTGGTGCGCAACCCGCAGAGCTGCCGCTGGAACATGGGCGTGTGCATTCCGATTAGCTGCCCGGGCAACATGCGTCAGATTGGCACCTGCTTTGGCCCGCGCGTGCCGTGCTGCCGCCGCTGGTAA (SEQ ID NO. 1)
[0026] (2) The AHB sequence of the pVAX1-AHB fusion DNA vaccine is optimized according to the preferred codons of Bos taurus, and the optimized gene sequence is as follows:
[0027] ATGCAGCTGGTCGACCGGGTGCGGGGGGCCGTCACCGGCATGAGCCGGCGGCTCGTGGTGGGCGCCGTCGGCGCTGCCCT GGTGTCCGGCCTGGTCGGCGCCGTGGGCGGCACCGCCACCGCTGGGGCTTTTAGCCGGCCCGGCCTGCCCGTGGAGTACCTGCAAGTGCCTAGCCCTAGCATGGGCCGGGACATCAAGGTGCAGTTTCAGTCCGGGGGCGCTAACAGCCCCGCCCTGTAC CTGCTGGACGGCCTGCGGGCCCAAGACGACTTCAGCGGCTGGGACATCAACACCCCCGCCTTCGAGTGGTACGATCAGAGCGGCCTGAGCGTGGTGATGCCCGTGGGGGGGCAGAGCAGCTTCTACAGCGACTGGTATCAGCCCGCCTGCGGCAAGGCCG GCTGTCAGACCTACAAGTGGGAGACCTTCCTGACAAGCGAGCTGCCCGGCTGGCTGCAAGCCAACCGGCACGTGAAGCCTACCGGCAGCGCCGTGGTGGGCCTGAGCATGGCCGCTAGCAGCGCCCTGACCCTGGCCATCTACCACCCTCAGCAGTTCGT GTACGCCGGCGCTATGTCCGGCCTGCTGGATCCTAGCCAAGCCATGGGCCCCACACTGATCGGCCTGGCCATGGGCGATGCTGGCGGCTACAAGGCTAGCGACATGTGGGGCCCCAAGGAGGACCCCGCCTGGCAGCGGAACGACCCCCTGCTGAACGTG GGCAAGCTGATCGCCAACAACACCCGGGTGTGGGTGTACTGCGGCAACGGCAAGCCTAGCGACCTGGGCGGCAACAACCTGCCCGCCAAGTTCCTGGAGGGGTTCGTGCGGACAAGCAACATCAAGTTCCAAGACGCCTACAACGCCGGCGGGGGCCATAACGGCGTGTTCGACTTCCCCGACAGCGGCACCCACAGCTGGGAGTACTGGGGCGCTCAGCTCAACGCCATGAAACCTGATCTGCAGCGGGCCCTGGGCGCCACCCCTAACACCGGGCCCGCCCCCCAAGGCGCTGGCGGGGGGGGGTCCGGCGGGGGCGGGAGCGGCGGGGGCGGGTCCATGGCCACAACACTGCCCGTGCAGAGGCACCCCCGGAGCCTGTTCCCCGAGTTCAGCGAACTGTTTGCCGCCTTCCCTAGCTTTGCCGGCCTGCGGCCTACCTTCGACACCCGGCTGATGCGGCTGGAGGACGAGATGAAGGAGGGCCGGTACGAGGTGCGGGCCGAGCTCCCCGGCGTGGACCCCGACAAGGACGTGGACATCATGGTGCGGGACGGGCAGCTGACCATCAAGGCCGAGCGGACCGAGCAGAAGGACTTCGACGGCCGGAGCGAGTTCGCCTACGGCAGCTTCGTGCGGACCGTGAGCCTCCCCGTGGGCGCCGATGAGGACGACATCAAGGCCACCTACGACAAGGGCATCCTGACCGTGAGCGTGGCCGTGAGCGAGGGCAAGCCCACCGAGAAACACATCCAAATTCGGAGCACCAATGGGGGCGGGGGCTCCGGCGGGGGGGGCAGCGGGGGCGGGGGCAGCATGAGGCTCCACCACCTGCTCCTGGTGCTGCTGTTCCTGGTGCTGAGCGCCGGCAGCGGCTTCACCCAAGTGGTGCGGAACCCTCAGAGCTGCCGGTGGAACATGGGCGTGTGCATCCCCATCAGCTGCCCCGGCAACATGCGGCAGATCGGCACCTGCTTCGGCCCCCGGGTGCCCTGCTGCCGGCGGTGGTGA (SEQ ID NO. 2)
[0028] The enzyme cutting sites 5'(Kpn I) and 3'(Bam HI) were added to both ends of the AHB gene sequence, and the sequence was connected to the prokaryotic expression vector pET-30a(+) by double enzyme cutting, and the vector was transformed into the competent cells BL21(DE3) of Escherichia coli. The bacteria were cultured in LB medium containing kanamycin (50 μg / mL) to the logarithmic growth phase (OD 600nm When the OD value was 0.6-0.8, 1 mM IPTG was added, and the expression was induced at 37°C on a shaking table at 160 rpm for 4 h. The bacteria were collected by centrifugation at 8000 rpm at 4°C for 3 min, and washed twice with pre-cooled PBS. The bacteria were frozen at -80°C for subsequent purification.
[0029] The bacteria were thawed, resuspended with pre-cooled PBS (200 mL of bacterial liquid was resuspended with 20 mL of PBS), and the bacteria were broken by ultrasonic treatment in an ice bath for about 30 min until no obvious intact bacteria were observed under a microscope after staining. The precipitate (i.e., inclusion body protein) was collected by centrifugation at 11000 rpm at 4°C for 30 min, washed with inclusion body washing solution I (20 mM Tris, 100 mM NaCl, 10 mM EDTA, 0.5% Triton X-100, pH 8.4), and then washed with inclusion body washing solution II (20 mM Tris, 100 mM NaCl, 2 mM urea, pH 8.4). The washed inclusion bodies were dissolved in denaturing solution (20 mM Tris, 5 mM EDTA, 8 M urea). The inclusion bodies were renatured by dialysis at 4°C for more than 4 h in inclusion body renaturation solution (containing 20 mM Tris, 1 mM EDTA, 100 mM NaCl, 1 mM reduced glutathione, 0.1 mM oxidized glutathione, 10% glycerol, pH 8.4) containing different concentrations of urea (6 M, 4 M, 2 M, 1 M, 0.5 M, 0.1 M, 0 M). Finally, the protein solution was dialyzed against PBS at pH 8.4 and pH 7.4. 1% Triton X-114 was added to the protein solution, which was mixed gently by pipetting, and then incubated in an ice bath for 30 min, mixed every 5 min, incubated in a water bath at 37°C for 10 min, and then the visible stratification phenomenon was observed. The mixture was centrifuged at 11000 rpm at 25°C for 10 min, and the supernatant was transferred to a sterile centrifuge tube. The above steps were repeated twice to remove most of the endotoxins. The protein was filtered through a 0.22 μm filter, aliquoted, and stored at -80°C. The purified protein was identified by Coomassie brilliant blue staining and western blot (using anti-His-tag antibody as the primary antibody).
[0030] Preparation of pVAX1-AHB fusion DNA vaccine
[0031] The 5' (Kpn I) and 3' (Not I) enzyme cutting sites were added to both ends of the AHB gene sequence, which was then connected to the eukaryotic expression vector pVAX1 by double enzyme cutting, and transformed into the competent cells DH5a of Escherichia coli. The bacteria were cultured in LB medium containing kanamycin (50 μg / mL) for 12-16 h at room temperature, and the bacterial bodies were collected by centrifugation at 8000 rpm for 3 min, and the pVAX1-AHB plasmid was extracted by an endotoxin-free plasmid extraction kit. The plasmids pVAX1 and pVAX1-AHB were transfected into 293T cells, respectively, 10 5 cells were plated in a 24-well culture plate per well, and after adhering, 0.5 μg of plasmid was transfected into 293T cells using lipofectamine TM 3000 transfection reagent (according to the kit instructions) at 37°C and 5% CO2 for 24 h, and the whole cell protein was collected, and western blot was performed using mouse polyclonal serum against AH (1:500) as the primary antibody.
[0032] Example 2 Evaluation of the immune effect of the vaccine
[0033] 45 female C57BL / 6 mice of 6-8 weeks were randomly divided into 5 groups, 9 mice in each group, including a normal control group (Control), a BCG control group (BCG), a pVAX1-AHB immunization group (pVAX1-AHB), an AHB-P immunization group (AHB-P), and an M. bovis challenge model group (M. bovis). The intranasal immunization dose of pVAX1-AHB was 50 μg per mouse, and the intranasal immunization dose of AHB-P was 40 μg per mouse (AHB: 20 μg per mouse; Poly IC: 20 μg per mouse), a total of 3 times of immunization, with an interval of 3 weeks. At the second immunization, BCG was injected subcutaneously (10 5 CFU per mouse). Three mice were killed from each group 3 weeks after the last immunization, and lung tissue cells were isolated, and the lung cells were stimulated with AH antigen for 8 h before flow cytometry was performed to detect the production of IFN-γ or IL-17 CD4 + T cells. The remaining mice were infected with M. bovis in the nose (about 100 CFU per mouse), and the right lung and spleen were collected 4 weeks later for CFU counting, and the left lung was fixed in 10% neutral formalin for histopathological observation.
[0034] Fusion vaccine AHB-P and pVAX1-AHB provide anti-M. bovis effect
[0035] As Figure 1 shown, the purity of the purified AHB is greater than 90%, about 65 KDa Figure 1 (A), and Western blot was performed using an anti-His tag antibody, and the results showed that a single band appeared on the NC membrane, which was consistent with the expected size.Figure 1 B). After transfection of 293T cells with pVAX1-AHB, bands consistent with the expected size were observed, while cells transfected with pVAX1 did not express the protein of interest Figure 1 C). Since the pVAX1-AHB plasmid does not carry a His-tag, while the AHB expressed in E. coli carries a His-tag, the AHB protein expressed in E. coli (about 65 KDa) is larger than the AHB protein expressed in 293T cells (about 61 KDa).
[0036] Three weeks after the last immunization, we examined the lung tissue for antigen-specific cytokine-secreting CD4 T cells. The results showed that AHB-P significantly increased the number of IFN-γ and IL-17 producing CD4+ T cells in the lung tissue compared to the Control, BCG and pVAX1-AHB groups Figure 2A -B), suggesting that intranasal immunization with the fusion protein vaccine AHB-P induced CD4 T cell responses in the lung tissue, while intranasal immunization with the fusion DNA vaccine pVAX1-AHB failed to induce this immune response. To investigate the protective efficacy of the two fusion vaccines, M. bovis was instilled intranasally three weeks after the last immunization. Four weeks after infection, histopathological examination and bacterial load examination were performed. The results showed that the inflammatory area in the lung tissue of the three immunized groups was significantly reduced compared to the M. bovis infection control group, and the pVAX1-AHB group had the least inflammatory area in the lung tissue Figure 3 A and B). Consistently, the bacterial load in the lung tissue of each immunized group was significantly lower than that of the M. bovis infection control group, and the pVAX1-AHB group had the lowest bacterial load in the lung tissue Figure 3 C); compared with the M. bovis infection control group, the bacterial load in the spleen of the three immunized groups was significantly reduced, and AHB-P and BCG significantly reduced the bacterial load in the spleen, while the pVAX1-AHB group and the M. bovis infection control group did not show a statistically significant difference in bacterial load in the spleen Figure 3 D). These results indicate that both fusion vaccines can provide protection against M. bovis.
[0037] This embodiment is only a preferred specific implementation of the present application, but the protection scope of the present application is not limited thereto, any changes or replacements within the technical scope disclosed by the present application can be easily thought of by those skilled in the art, which should be covered within the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the protection scope of the claims. SEQUENCE LISTING <110> China Agricultural University <120> Tuberculosis vaccine based on bovine beta defensin 5 and its application in preventing tuberculosis <160> 2 <170> PatentIn version 3.5 <210> 1 <211> 1731 <212> DNA <213> artificial <400> 1 atgcagttag ttgatcgtgt tcgtggcgcc gtgaccggca tgagccgccg tctggttgtt 60 ggtgcggtgg gcgcggcgct ggttagtggc ctggtgggcg cggttggcgg cacggcgacc 120 gccggtgcgt ttagccgccc gggtctgccg gtggaatatc tgcaagtgcc gagcccgagc 180 atgggccgcg atattaaagt gcagtttcag agcggcggcg cgaacagccc ggcgctgtat 240 ctgctggatg gcctgcgcgc gcaagatgat tttagcggct gggatattaa caccccggcg 300 tttgaatggt atgatcagag cggcctgagc gtggtgatgc cggtgggcgg tcagagcagc 360 ttttatagcg attggtatca gccggcgtgc ggcaaagcgg gctgtcagac ctataaatgg 420 gaaacctttc tgacgagcga gctgccgggc tggttacaag cgaaccgcca tgtgaaaccg 480 accggcagcg cggtggtggg cctgagcatg gcggcgagca gcgcgctgac cctggcgatt 540 tatcatccgc agcagtttgt gtatgcgggc gcgatgagcg gcctgttaga tccgagccaa 600 GCGATGGGCC CGACCCTGAT TGGCCTGGCG ATGGGCgATG C GGC GGCCTA TAAAGCGAGC 660 GATATGTGGG CCCGAAAGAA GATCCGGCGT GGCAGCGCAA CGATCCGCTG CTGAACGTG 720 GGCAAACCGA TTGC GAACAA CACCCGC GTG TGGGTGTATT GC GGC AACGGCAAACCGAGC 780 GATCTGGGCG GCAACAACCT GCCGGCGAAA TTTCTGGAAG GCTTCGTGCG CACGAGCAAC 840 ATTA AATTTC AAGATGC GTA TAACGCCGGC GGTGGCCATA ACGGCGTTTT GATT TTCG 900 GATAGCGGCA CCCATAGCTG GGAATATTGG GGC GC GC AGTGAACGCC ATGAAACCGGAT 960 CTGCAACGCG C GTTAGGC GCGACCCC GAAC ACCG GTCCGGCGCC GCAAGGC CGCGGCGGT 1020 GGCGGTAGCG GCGGTGGCGG TAGC GGC GGTGGCGGT AGTAGCGACC ACCCCTGCCGGTG 1080 CAGCGCCATC C GC GC AGCCT GTTTCCGGAA TT TAGC GAAC TGT TTGC GGC GTTTCCGAGC 1140 TTTGC GGCCT GC GCCCGACCTT TGATACC GCCTGATGC GCCTGGAAGAT GAAATGAAAT 1200 GAAGGCCGCT ATGAAGTGC GC GC GGAAC TGC CGGGCGTTGACCCGGATAA AGATGTGGAT 1260 ATTATGGTGC GCGATGGTCA GCTGACCATTA AAGCGGAAC GCACCGAACAG AAAGATTTTT 1320 GATGGCCGCA GC GAATTTC GTATGGCAGTTTTGTGC GCACC GTGAGCTT ACCGGTGGGC 1380 GCGGATGAAG ATGATATTA AAGCGACCTAT GATAAAGGCA TTCTGACC GTGAGCGTGGCG 1440 GTGAGCGAAG GCAAACC GACCGAAAAACAT ATTCA GATTC GCAGCACCAACGGCGGTGGC 1500 GGTAGTGGCG GCGGTGGCAGC GGC GGTGGCGGCAGTATGC GTTTACATCATCTGTTACTG 1560 GTGCTGCTGTTTCTGGTGCTGAGCGCGGGCAGC GGCTTTACCCAAGTGGTGC GCAACCG 1620 CAGAGCTGCC GCTGGAACAT GGGCGTGTC ATTC CGAT TAGCTGCCCGGGCAACATGC GT 1680 CAGATTGGCACCTGCTTTGGCCCGC GCGTGCCTGCTGCCGCCGCTGGTA 1731 <210> 2 <211> 1731 <212> DNA <213> artificial <400> 2 ATGCAGCTGGTCGACC GGGT GC GGGGGCC GTC ACCGGCATGAGCCGGCGGCTCGTG GTG 60 GGCGCCGTCGGCGCTGCCCTG GTGTCCGGCCTG GTCGGCGCCGTGGGC GGC ACCGCACC 120 GCTGGGGCTTTTAGCCGGCCCCGGCCTGCCCGTGGAGTACCTGCAAGTGCC TAGCCCTAGC 180 ATGGGCCGGGACATCAAGGTGCAGTTTCAGTCCGGGGGCGCTAACAGCCC CGCCCTGTAC 240 ctgctggacg gcctgcgggc ccaagacgac ttcagcggct gggacatcaa cacccccgcc 300 ttcgagtggt acgatcagag cggcctgagc gtggtgatgc ccgtgggggg gcagagcagc 360 ttctacagcg actggtatca gcccgcctgc ggcaaggccg gctgtcagac ctacaagtgg 420 gagaccttcc tgacaagcga gctgcccggc tggctgcaag ccaaccggca cgtgaagcct 480 accggcagcg ccgtggtggg cctgagcatg gccgctagca gcgccctgac cctggccatc 540 taccaccctc agcagttcgt gtacgccggc gctatgtccg gcctgctgga tcctagccaa 600 gccatgggcc ccacactgat cggcctggcc atgggcgatg ctggcggcta caaggctagc 660 gacatgtggg gccccaagga ggaccccgcc tggcagcgga acgaccccct gctgaacgtg 720 ggcaagctga tcgccaacaa cacccgggtg tgggtgtact gcggcaacgg caagcctagc 780 gacctgggcg gcaacaacct gcccgccaag ttcctggagg ggttcgtgcg gacaagcaac 840 atcaagttcc aagacgccta caacgccggc gggggccata acggcgtgtt cgacttcccc 900 gacagcggca cccacagctg ggagtactgg ggcgctcagc tcaacgccat gaaacctgat 960 GAGAAGGAGA AGGAGAAGGA AGGAGAAGGA AGGAGAAGGA AGGAG 1018 GGGGGACCGG GGGGGGCGGG GGGGGGCGGG GGGGGGCGGG GGGGGGCGGG 1020 GGGGGACCGG GGGGGGCGGG GGGGGGCGGG GGGGGGCGGG GGGGGGCGGG 1080 GGGGGACCGG GGGGGGCGGG GGGGGGCGGG GGGGGGCGGG GGGGGGCGGG 1140 GGGGGACCGG GGGGGGCGGG GGGGGGCGGG GGGGGGCGGG GGGGGGCGGG 1200 GGGGGACCGG GGGGGGCGGG GGGGGGCGGG GGGGGGCGGG GGGGGGCGGG 1260 GGGGGACCGG GGGGGGCGGG GGGGGGCGGG GGGGGGCGGG GGGGGGCGGG 1320 GGGGGACCGG GGGGGGCGGG GGGGGGCGGG GGGGGGCGGG GGGGGGCGGG 1380 GGGGGACCGG GGGGGGCGGG GGGGGGCGGG GGGGGGCGGG GGGGGGCGGG 1440 GGGGGACCGG GGGGGGCGGG GGGGGGCGGG GGGGGGCGGG GGGGGGCGGG 1500 GGGGGACCGG GGGGGGCGGG GGGGGGCGGG GGGGGGCGGG GGGGGGCGGG 1560 GGGGGACCGG GGGGGGCGGG GGGGGGCGGG GGGGGGCGGG GGGGGGCGGG 1620 GGAAGAAGCC ATGGATGATG GATGATGATG GCTTTATGCT GCTCTGCCTG GCTCTGCCTG 3000
Claims
1. A vaccine against tuberculosis, characterized in that, The tuberculosis vaccine comprises a fusion protein AHB of the AH antigen of Mycobacterium tuberculosis and bovine beta defensin 5, which is encoded by the nucleotide sequence shown in SEQ ID NO.
1.
2. The tuberculosis vaccine according to claim 1, further comprising poly I:C.
3. The tuberculosis vaccine according to claim 1 or 2, further comprising an adjuvant and / or an excipient.
4. The tuberculosis vaccine according to claim 1 or 2, wherein the tuberculosis vaccine is a vaccine for use via mucosa.
5. The tuberculosis vaccine according to claim 4, wherein the tuberculosis vaccine is a vaccine for use via respiratory mucosa.
6. The tuberculosis vaccine according to claim 5, wherein the tuberculosis vaccine is a vaccine for use via nasal mucosa.
7. Use of the tuberculosis vaccine according to any one of claims 1-6 in the preparation of a medicament for preventing or treating bovine tuberculosis.
8. A vaccine against tuberculosis, characterized in that, The tuberculosis vaccine comprises a pVAX1-AHB construct, which consists of a nucleic acid with the sequence of SEQ ID NO. 2 and a vector pVAX1.
9. The tuberculosis vaccine according to claim 8, which does not comprise an adjuvant.
10. The tuberculosis vaccine according to claim 8, wherein the tuberculosis vaccine is a vaccine for use via mucosa.
11. The tuberculosis vaccine according to claim 10, wherein the tuberculosis vaccine is a vaccine for use via respiratory mucosa.
12. The tuberculosis vaccine according to claim 11, wherein the tuberculosis vaccine is a vaccine for use via nasal mucosa.
13. Use of the tuberculosis vaccine according to any one of claims 8-12 in the preparation of a medicament for preventing or treating bovine tuberculosis.
Citation Information
Patent Citations
Application of bovine β-defensin 5 as a novel mucosal immune adjuvant
CN112891529B
Application of bovine beta defensin 5 as novel mucosal immunologic adjuvant
CN112891529A