Avian egg drop syndrome virus subunit nanoparticle antigen and its application

By fusing the Knob region of the Fiber protein of the avian egg drop syndrome virus with the N-terminus of Helicobacter pylori Ferritin to form a Knob-HPF fusion protein, which self-assembles into a 24-mer nanoparticle antigen, the problems of insufficient immunogenicity and protective efficacy of existing vaccines are solved, and an immune effect with high titer and low side effects is achieved.

CN115403673BActive Publication Date: 2025-10-14PULIKE BIOLOGICAL ENG INC
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202110592016.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-05-28
Publication Date
2025-10-14
Estimated Expiration
2041-05-28

AI Technical Summary

Technical Problem

The existing inactivated vaccines for avian egg drop syndrome virus have many side effects, and the subunit vaccines cannot achieve the same protective efficacy as the inactivated vaccines. In addition, the hemagglutination activity of the Knob protein expressed alone is significantly reduced, making it difficult to prepare subunit vaccines with good immunogenicity.

Method used

The Knob region of the fiber protein of the egg drop syndrome virus was fused with the N-terminus of Helicobacter pylori ferritin to form a Knob-HPF fusion protein. The antigen protein was polymerized through the folding of HPF and self-assembled into a spherical nanoparticle antigen with a twenty-tetrameric structure to prepare the egg drop syndrome virus subunit nanoparticle antigen.

Benefits of technology

The antigen titer and immune effect are improved, higher antibody levels are produced after immunization, and side effects are reduced. The prepared subunit nanoparticle vaccine can be quickly applied to clinical trials.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115403673B_ABST
    Figure CN115403673B_ABST
Patent Text Reader

Abstract

The present application relates to avian egg drop syndrome virus subunit nanoparticle antigen, the subunit nanoparticle antigen is assembled by avian egg drop syndrome virus Knob-HPF fusion protein; the protein sequence of the Knob-HPF fusion protein is sequentially composed of the Knob region of avian egg drop syndrome virus Fiber protein, linker and the N-terminal fragment of Helicobacter pylori Ferritin (HPF) from N-terminal to C-terminal; the Knob region of the avian egg drop syndrome virus Fiber protein is encoded by SEQ ID NO:1 or its degenerate sequence.The subunit nanoparticle antigen is spheroidal nanoparticle of 24-mer, antigen titer is high, and the prepared vaccine has good immunoprotective effect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to avian egg drop syndrome virus subunit nanoparticle antigens, the prepared vaccine composition, the preparation method and the application, and belongs to the field of biopharmaceuticals. Background Art

[0002] At present, the egg drop syndrome virus is widely spread in many countries around the world, causing huge economic losses to the poultry industry. The immune prevention and control of the egg drop syndrome virus (EDS-76) mainly relies on inactivated vaccines. Inactivated vaccines are prone to side effects of varying degrees during the immunization process, and some existing subunit vaccines cannot achieve the same protective efficacy as inactivated vaccines.

[0003] Avian egg drop syndrome virus (EDS-76) is the only member of the Adenovirus group III. Its virions are approximately 76-80 nm in size, exhibit icosahedral symmetry, and consist of a linear double-stranded DNA genome. The late RNA transcripts of EDS-76 are divided into three sub-segments, L1, L2, L3, L4, and L5, based on their splicing patterns and termination sites. L5 primarily encodes the fiber protein, located at the penton base. This approximately 25 nm long protein is primarily responsible for recognizing specific receptors on host cells, enabling viral entry and internalization. The fiber protein can be further divided into a fibrous tail region, a rod-shaped stem region, and a globular head region (knob). The knob region contains multiple hemagglutination sites and binding sites for virus-neutralizing antibodies, making it a key immunogenic region of the virus. Studies have shown that the hemagglutination activity of the fiber protein is positively correlated with its immunogenicity and protective efficacy. However, the hemagglutination activity of the Knob protein expressed alone is significantly reduced. Therefore, whether the Knob protein can successfully prepare a subunit vaccine with good immunogenicity by improving the hemagglutination activity has not been reported in the prior art.

[0004] Ferritin is a ferritin protein encoded by Helicobacter pylori that forms 24-mers, which then assemble into octahedral spherical particles. Ferritin's N-terminus can accommodate large fragments of exogenous DNA sequences, allowing it to fully display foreign proteins while maintaining its proper structural formation, achieving antigen multimerization and inducing a stronger immune response, making it an excellent nanoparticle carrier.

[0005] Therefore, researching and developing an avian egg drop syndrome virus subunit vaccine with high antigen titer and good immune effect is a task with important clinical significance. Summary of the Invention

[0006] The main purpose of the present invention is to provide an avian egg drop syndrome virus subunit nanoparticle antigen, wherein the avian egg drop syndrome virus subunit nanoparticle antigen is self-assembled by the avian egg drop syndrome virus Knob-HPF fusion protein; the protein sequence of the avian egg drop syndrome virus Knob-HPF fusion protein is composed of the Knob region, linker and N-terminal fragment of Helicobacter pylori Ferritin (HPF) of the avian egg drop syndrome virus fiber protein from the N-terminus to the C-terminus; the Knob region of the avian egg drop syndrome virus fiber protein is encoded by SEQ ID NO: 1 or its degenerate sequence.

[0007] The present invention provides an avian egg drop syndrome virus subunit nanoparticle antigen with high antigen titer and good immune effect, effectively preventing infection with the avian egg drop syndrome virus. The invention fuses the Knob region of the Fiber protein encoded by the avian egg drop syndrome virus (EDS-76) with the N-terminus of Ferritin (hereinafter referred to as HPF) encoded by Helicobacter pylori, and then folds HPF to polymerize and express the antigen protein, forming a spherical nanoparticle antigen with a 24-mer structure. The Knob-HPF recombinant nanoparticles have higher hemagglutination activity than the Knob protein. The expressed subunit nanoparticle antigen verifies that the Knob protein can be used to prepare a subunit vaccine with good immunogenicity by enhancing hemagglutination activity.

[0008] The present invention also relates to an avian egg drop syndrome virus subunit vaccine, wherein the avian egg drop syndrome virus subunit vaccine comprises the avian egg drop syndrome virus subunit nanoparticle antigen and a pharmaceutically acceptable carrier; the amount of the avian egg drop syndrome virus subunit nanoparticle antigen is an immunogenic amount.

[0009] The vaccine prepared from the purified protein of the present invention can produce higher antibody levels after immunization in animals than commercial inactivated vaccines. This overcomes the insufficient immunogenicity of single Knob antigen proteins. The prepared subunit nanoparticle vaccine has high antigen titers, high antibody levels after immunization, and minimal immune side effects, allowing for rapid application in clinical trials.

[0010] Another object of the present invention is to provide a method for preparing the avian egg drop syndrome virus subunit vaccine, wherein the method comprises: step (1) cloning and expressing the avian egg drop syndrome virus Knob-HPF fusion protein, adding Triton and PEI to the expressed avian egg drop syndrome virus Knob-HPF fusion protein at low temperature, mixing evenly, removing the oil phase by activated carbon adsorption after heating, and self-assembling the avian egg drop syndrome virus Knob-HPF fusion protein in the supernatant after centrifugation to form the avian egg drop syndrome virus subunit nanoparticle antigen; step (2) purifying the avian egg drop syndrome virus subunit nanoparticle antigen of step (1) by ammonium sulfate precipitation; and step (3) adding the purified avian egg drop syndrome virus subunit nanoparticle antigen of step (2) to an adjuvant, mixing evenly, to obtain the avian egg drop syndrome virus subunit vaccine.

[0011] Specifically, the Knob region of the fiber protein encoded by the avian egg drop syndrome virus (EDS-76) was used as an antigenic fragment and fused to the N-terminus of HPF to construct a Knob-HPF fusion fragment. This fusion fragment was cloned into the pET28a vector and transformed into the Escherichia coli BL21(DE3) strain for expression. Under the action of HPF, the Knob-HPF recombinant protein self-assembled into uniform and stable 24-mer spherical nanoparticles.

[0012] The present invention also relates to the use of the avian egg drop syndrome virus subunit vaccine in the preparation of medicines for preventing avian egg drop syndrome. Detailed Description of the Invention

[0014] The purpose of the present invention is achieved through the following technical solutions.

[0015] The present invention first provides an avian egg drop syndrome virus subunit nanoparticle antigen, wherein the avian egg drop syndrome virus subunit nanoparticle antigen is self-assembled by the avian egg drop syndrome virus Knob-HPF fusion protein; the protein sequence of the avian egg drop syndrome virus Knob-HPF fusion protein is composed of the Knob region of the avian egg drop syndrome virus fiber protein, a linker and the N-terminal fragment of Helicobacter pylori Ferritin (HPF) from the N-terminus to the C-terminus; the Knob region of the avian egg drop syndrome virus fiber protein is encoded by SEQ ID NO: 1 or a degenerate sequence thereof.

[0016] In the present invention, the resulting Knob-HPF fusion antigen protein has a hemagglutination activity 512 times that of a single Knob antigen protein. The Knob-HPF fusion nanoparticle antigen protein has a size of approximately 44Kd in the presence of a reducing agent such as mercaptoethanol. After purification, the antigen protein has a hemagglutination activity of no less than 1:4096 (12log2), which is 512 times that of a single Knob antigen protein. The Knob-HPF fusion nanoparticle antigen protein exhibits a uniformly sized nanoparticle structure under an electron microscope.

[0017] The present invention fuses the Knob region of the Fiber protein encoded by the avian egg drop syndrome virus (EDS-76) with HPF, and the resulting fusion sequence is expressed using Escherichia coli BL21 (DE3) to obtain spherical nanoparticles with uniform particle size and a twenty-tetrameric structure, thereby realizing the multimeric display expression of the antigen protein.

[0018] The avian egg drop syndrome virus Knob fusion protein of the present invention can be a recombinantly expressed Knob fusion protein, and its expression system can be a prokaryotic expression system, a eukaryotic expression system, or an artificially synthesized synthetic peptide.

[0019] As an embodiment of the present invention, the N-terminal fragment of Helicobacter pylori Ferritin is encoded by SEQ ID NO: 2 or a degenerate sequence thereof.

[0020] As an embodiment of the present invention, the Knob-HPF fusion protein of avian egg drop syndrome virus is encoded by SEQ ID NO: 3 or a degenerate sequence thereof.

[0021] The amino acid sequence of the hinge region linker connecting the Knob and HPF may be GGGGSGGGGSGGGGS. When the hinge region linker has the above amino acid sequence, the Knob-HPF fusion protein can form a more uniform and stable nanoparticle structure.

[0022] The present invention also relates to the gene of the Knob-HPF fusion protein of avian egg drop syndrome virus, which is shown as SEQ ID NO: 3 or its degenerate sequence.

[0023] In addition to expressing fusion protein, the avian egg drop syndrome virus Knob fusion protein gene of the present invention can also be used in the development of expression vectors, nucleic acid vaccines, diagnostic reagents and other drugs related to the prevention and / or treatment of avian egg drop syndrome virus.

[0024] The present invention also relates to a recombinant vector, which contains the avian egg drop syndrome virus Knob fusion protein gene, can express the avian egg drop syndrome virus Knob fusion protein of the present invention, and can maintain the immunogenicity of the avian egg drop syndrome virus Knob fusion protein.

[0025] The present invention also relates to a transformant, into which a recombinant vector containing the Knob fusion protein gene of the avian egg drop syndrome virus is introduced.

[0026] The present invention also relates to an avian egg drop syndrome virus subunit vaccine, wherein the avian egg drop syndrome virus subunit vaccine comprises the avian egg drop syndrome virus subunit nanoparticle antigen and a pharmaceutically acceptable carrier; the amount of the avian egg drop syndrome virus subunit nanoparticle antigen is an immunogenic amount.

[0027] The nanoparticle antigen protein prepared by the present invention overcomes the disadvantage of insufficient immunogenicity of single antigen protein and has a high antigen titer level; the subunit nanoparticle vaccine prepared using the antigen can produce a high antibody level after immunizing animals without immune side effects.

[0028] As an embodiment of the present invention, the avian egg drop syndrome virus subunit antigen content of the nanoparticles is HA titer ≥ 1:512.

[0029] As a preferred embodiment of the present invention, the avian egg drop syndrome virus subunit antigen content of the nanoparticles is HA titer 1:512 to 1:2048.

[0030] As one embodiment of the present invention, the pharmaceutically acceptable carrier is an adjuvant, and the adjuvant includes: (1) mineral oil, aluminum gel adjuvant, saponin, avridine, DDA; (2) water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion; or (3) polymers of acrylic acid or methacrylic acid, copolymers of maleic anhydride and alkenyl derivatives; and one or more of the following: RIBI adjuvant system, Block co-polymer, SAF-M, monophosphoryl lipid A, Avridine lipid-amine adjuvant, Escherichia coli heat-labile enterotoxin, cholera toxin, IMS 1314, muramyl dipeptide, ISA 206, Gel adjuvant; preferably, the saponin is Quil A, QS-21, GPI-0100; the adjuvant content is 5%-70% V / V, preferably 30% to 70%, more preferably 66% V / V.

[0031] As one embodiment of the present invention, the pharmaceutically acceptable carrier includes an adjuvant, and the adjuvant includes: (1) aluminum gel adjuvant, saponin, avridine, DDA; (2) water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion; or (3) polymers of acrylic acid or methacrylic acid, copolymers of maleic anhydride and alkenyl derivatives; and one or more of RIBI adjuvant system, Block co-polymer, SAF-M, monophosphoryl lipid A, Avridine lipid-amine adjuvant, Escherichia coli heat-labile enterotoxin, cholera toxin, IMS 1314, muramyl dipeptide, and Gel adjuvant;

[0032] Preferably, the saponin is Quil A, QS-21, or GPI-0100;

[0033] Preferably, the emulsion is an SPT emulsion, an MF59 emulsion, or an emulsion formed by combining an oil with an emulsifier. The emulsion can be based on light liquid paraffin oil, isoprenoid oils produced by olefin oligomerization (such as squalane or squalene oil, olefins, especially oils produced by oligomerization of isobutylene or decene), esters of acids or alcohols containing linear alkyl groups (more especially vegetable oils, ethyl oleate, propylene glycol di-(octanoate / caprylate), glycerol tri-(octanoate / caprylate) or propylene glycol dioleate), esters of branched fatty acids or alcohols (especially isostearates); the emulsifier is a nonionic surfactant (especially esters of polyoxyethylated fatty acids (such as oleic acid), esters of sorbitan, esters of mannide (such as anhydrous mannitol oleate), esters of aliphatic diols, esters of glycerol, esters of polyglycerols, Esters of propylene glycol and esters of oleic acid, isostearic acid, ricinoleic acid or hydroxystearic acid, which esters may be ethoxylated, ethers of fatty alcohols and polyols (e.g. oleyl alcohol), polyoxypropylene-polyoxyethylene block copolymers (especially Especially L121);

[0034] Preferably, the polymer of acrylic acid or methacrylic acid is a cross-linked acrylic acid or methacrylic acid polymer, in particular a compound cross-linked with a polyalkenyl ether of a sugar or a polyol, carbomer, preferably carbopol 974P, 934P and 971P;

[0035] Preferably, the copolymer of maleic anhydride and an alkenyl derivative is a copolymer of maleic anhydride and ethylene EMA;

[0036] Preferably, the adjuvant is a mineral oil adjuvant, which is used to prepare a water-in-oil emulsion;

[0037] The concentration of the adjuvant ranges from 5% to 70% V / V, preferably from 30% to 70%, more preferably 66% V / V.

[0038] The vaccine composition of the present invention may further include other agents added to the composition of the present invention.

[0039] As an embodiment of the present invention, the pharmaceutically acceptable carrier includes drugs, immunostimulants, antioxidants, surfactants, colorants, volatile oils, buffers, dispersants, propellants and preservatives; the immunostimulants include α-interferon, β-interferon, γ-interferon, granulocyte macrophage colony-stimulating factor (GM-CSF), macrophage colony-stimulating factor (M-CSF) and interleukin 2 (IL2).

[0040] Preferably, the immunostimulant includes α-interferon, β-interferon, γ-interferon, granulocyte macrophage colony stimulating factor (GM-CSF), macrophage colony stimulating factor (M-CSF) and interleukin 2 (IL2).

[0041] To prepare such a composition, methods known in the art can be used.

[0042] The present invention also relates to a method for preparing the avian egg drop syndrome virus subunit vaccine, wherein the method comprises: step (1) cloning and expressing the avian egg drop syndrome virus Knob-HPF fusion protein, adding Triton and PEI to the expressed avian egg drop syndrome virus Knob-HPF fusion protein at low temperature, mixing evenly, removing the oil phase by activated carbon adsorption after heating, and self-assembling the avian egg drop syndrome virus Knob-HPF fusion protein in the supernatant after centrifugation to form the avian egg drop syndrome virus subunit nanoparticle antigen; step (2) purifying the avian egg drop syndrome virus subunit nanoparticle antigen in step (1) by ammonium sulfate precipitation; and step (3) adding the purified avian egg drop syndrome virus subunit nanoparticle antigen in step (2) to an adjuvant, mixing evenly, to obtain the avian egg drop syndrome virus subunit vaccine.

[0043] The subunit nanoparticle vaccine prepared by the present invention has a simple preparation process, low cost for expression and purification of effective antigen components, good immune effect, and high biosafety, and the vaccine can be quickly applied to clinical trials.

[0044] The present invention also relates to the use of the avian egg drop syndrome virus subunit vaccine in the preparation of medicines for preventing avian egg drop syndrome.

[0045] The avian egg drop syndrome virus subunit vaccine of the present invention can produce a good immune effect when the immunization dose is only 1:512 of the HA titer.

[0046] As one embodiment of the present invention, the animals to be administered are chickens and ducks.

[0047] The present invention also provides a method for preparing and evaluating an avian egg drop syndrome virus (EDS-76) subunit nanoparticle vaccine. The method comprises emulsifying the purified Knob-HPF fusion protein with an oil adjuvant at a ratio of 1:2 to prepare the vaccine. Vaccination is performed by intramuscular injection into the leg, using a commercial inactivated vaccine as a control. Blood is collected 28 days after immunization, and serum is isolated. The HI antibody titer of avian egg drop syndrome virus (EDS-76) in chickens in the immunized and control groups is measured using a hemagglutination inhibition test.

[0048] Specifically, a method for preparing and evaluating an avian egg drop syndrome virus (EDS-76) subunit nanoparticle vaccine comprises the following steps:

[0049] Step (1) Preparation of Knob-HPF recombinant subunit nanoparticle vaccine;

[0050] Step (2) Knob-HPF fusion nanoparticle vaccine immunization;

[0051] And step (3) antibody level detection.

[0052] The subunit nanoparticle vaccine for avian egg drop syndrome virus (EDS-76) prepared in this invention contains a Knob-HPF antigen protein with a hemagglutination activity of 1:512 (9 log2), while the hemagglutination activity of the effective antigen component in the commercial inactivated vaccine is 1:8192 (13 log2). Under the same vaccine immunization dose conditions, the subunit nanoparticle vaccine prepared in this invention produces HI antibody levels that are twice that of the commercial inactivated vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 This is an electron micrograph of the avian egg drop syndrome virus subunit nanoparticle antigen prepared in Example 1 of the present invention. DETAILED DESCRIPTION

[0054] Hereinafter, embodiments of the present invention will be described.

[0055] definition

[0056] The term "Egg Drop Syndrome Virus" (EDSV) refers to a group III avian adenovirus with a double-stranded DNA genome. Clinical symptoms include soft-shelled, thin-shelled, or shell-less eggs in laying hens, leading to a severe decrease in egg production. Pathological changes are characterized by ovarian quiescence and oviduct atrophy.

[0057] The term "nanoparticle antigen" refers to the process of assembling Helicobacter pylori Ferritin protein carrying antigen genes into octahedral nano-spherical particles, while fully displaying the antigen protein to achieve antigen polymerization, thereby inducing a stronger immune response, that is, nanoparticle antigen.

[0058] The term "knob protein" refers to the globular head region (knob) of the fiber protein of avian egg drop syndrome virus.

[0059] The term "Knob-HPF fusion protein" refers to a protein expressed by fusion of the globular head region (Knob) of the fiber protein of avian egg drop syndrome virus with the N-terminus of Ferritin encoded by Helicobacter pylori.

[0060] The term "linker" refers to a flexible peptide segment used to connect adjacent different protein fragments in a fusion protein.

[0061] The term "degenerate sequence" refers to the phenomenon that the same amino acid has two or more codons, which is called codon degeneracy. Such a sequence is called a degenerate sequence.

[0062] The term "vaccine composition" used in the present invention refers to a pharmaceutical composition containing the immunogenicity of avian egg drop syndrome virus, which can induce, stimulate or enhance the immune response of chickens and ducks against avian egg drop syndrome virus.

[0063] The term "immunizing amount" should be understood as an "immunologically effective amount", also known as an immunoprotective amount or an effective amount to produce an immune response, which is the amount of antigen that can effectively induce an immune response in the recipient, and this amount is sufficient to prevent or improve the signs or symptoms of the disease, including adverse health effects or its complications. The immune response may be sufficient for diagnostic purposes or other tests, or may be suitable for preventing signs or symptoms of the disease, including adverse health consequences or complications caused by infection caused by pathogens. Humoral immunity or cell-mediated immunity or both can be induced. The immune response of an animal to an immunogenic composition can be indirectly assessed by, for example, measuring antibody titers, lymphocyte proliferation assays, or directly assessed by monitoring signs or symptoms after challenge with a wild-type strain, and the protective immunity provided by the vaccine can be assessed by measuring, for example, clinical signs of the subject such as mortality, reduction in morbidity, temperature values, overall physiological condition of the subject, and overall health and performance. The immune response may include, but is not limited to, inducing cellular and / or humoral immunity.

[0064] The term "avian egg drop syndrome virus antigen" refers to any composition containing at least one form of avian egg drop syndrome virus antigen that can induce, stimulate or resist an immune response to avian egg drop syndrome virus infection, including but not limited to inactivated, attenuated or subunit antigens.

[0065] Subunit antigens are antigens produced by cloning the protective antigen gene of a pathogen into a prokaryotic or eukaryotic expression system using genetic engineering methods, allowing for efficient expression. They are less likely to cause side effects than whole virus antigens.

[0066] "Synthetic peptide antigen" refers to a small peptide containing only immune determinant components, that is, an antigen made by artificially synthesizing a protective short peptide according to the amino acid sequence of a natural protein, connecting it to a carrier and adding an adjuvant.

[0067] "Live vector" refers to a non-pathogenic microorganism that is genetically engineered to carry and express a gene for a certain antigen or antigenic determinant to produce immunogenicity. Non-pathogenic microorganisms can be bacteria and viruses. Virus live vectors commonly used as carriers include vaccinia virus, fowlpox virus, turkey herpes virus, adenovirus, pseudorabies virus, retrovirus, and lentivirus; bacterial live vectors can include attenuated Salmonella, Bacillus Calmette-Guérin, attenuated Listeria monocytogenes, attenuated Vibrio cholerae, attenuated Shigella, Lactococcus, Lactobacillus embryonicus, and Streptococcus gadolinium.

[0068] The term "pharmaceutically acceptable carrier" refers to all other ingredients in the vaccine composition of the present invention except the avian egg drop syndrome virus antigen, a carrier or diluent that does not stimulate the body and does not hinder the biological activity and properties of the compound used, preferably an adjuvant.

[0069] The term "HA titer" refers to the hemagglutinin titer. The test sample is diluted to different multiples, added to a 1% chicken red blood cell suspension, and incubated at room temperature for 20-40 minutes or at 2-8°C for 40-60 minutes. The highest dilution at which the red blood cells completely agglutinate is used as the determination endpoint. This is usually used to detect the titer of antigens that agglutinate red blood cells.

[0070] The term "adjuvant" may include compounds selected from alum adjuvants; saponins, such as Quil A, QS-21 (Cambridge Biotech Incorporation, Cambridge MA), GPI-0100 (Galenica Pharmaceuticals Incorporation, Birmingham AL); water-in-oil emulsions; oil-in-water emulsions; water-in-oil-in-water emulsions; polymers of acrylic acid or methacrylic acid; and copolymers of maleic anhydride and alkenyl derivatives. The term "emulsion" may be based in particular on light liquid paraffin oil (European Pharmacopea type); isoprenoid oils resulting from olefin oligomerization, such as squalane or squalene oil, in particular isobutene or deuterene; linear alkyl-containing esters of acids or alcohols, more particularly vegetable oils, ethyl oleate, propylene glycol di-(caprylate / deuterate), glycerol tri-(caprylate / deuterate) or propylene glycol dioleate; esters of branched fatty acids or alcohols, in particular isostearates. The oil is used in combination with an emulsifier to form an emulsion. Emulsifiers are preferably nonionic surfactants, in particular esters of sorbitan, esters of mannide (e.g. anhydrous mannitol oleate), esters of fatty glycols, esters of polyglycerols, esters of propylene glycol, and esters of oleic acid, isostearic acid, ricinoleic acid or hydroxystearic acid, which may be ethoxylated, and polyoxypropylene-polyoxyethylene block copolymers, in particular Pluronic products, in particular L 121. See Hunter et al., The theory and practical application of adjuvants (Ed. by DES Stewart-Tull, John Wiley and Sons, New York, 1995: 51-94) and Todd et al., Vaccine (1997, 15: 564-570). For example, the SPT emulsion described on page 147 and the MF59 emulsion described on page 183 of "Vaccine design, the Subunit and adiuvant approach" edited by Powell M and Newman M (Plenum Press, 1995) can be used.The term "polymers of acrylic or methacrylic acid" preferably refers to cross-linked polymers of acrylic or methacrylic acid, in particular cross-linked with a polyalkenyl ether of a sugar or a polyol, which compounds are known as Carbomers (trade name Carbopol) (Pharm. Europa, 1996, 8(2)). The skilled person can also refer to US patent 2 909 462, which describes such acrylic acid polymers cross-linked with polyhydroxylated compounds having at least 3 hydroxyl groups, preferably not more than 8, in which at least 3 of the hydroxyl groups have been replaced by an unsaturated aliphatic radical having at least 2 carbon atoms. Preferred radicals are those containing 2 to 4 carbon atoms, such as vinyl, allyl and other ethylenically unsaturated groups. The products are sold under the name Carbopol (BF Goodrich, Ohio, USA) and are particularly suitable. They are cross-linked with allyl sucrose or with allyl pentaerythritol. Among these, Carbopol 974P, 934P and 971P can be mentioned, the most preferred being Carbopol 971P. The term "copolymer of maleic anhydride and an alkenyl derivative" can also consider the copolymer of maleic anhydride and ethylene, EMA (Monsanto), which polymer dissolves in water to produce an acidic solution, which is neutralized, preferably to physiological pH, in order to produce an adjuvant solution into which the immunogenic, immunizing or vaccine composition itself can be incorporated. The term "adjuvant" also includes, but is not limited to, RIBI adjuvant system (Ribi Incorporation), Block co-polymer (CytRx, Atlanta GA), SAF-M (Chiron, Emeryville CA), monophosphoryl lipid A, Avridine lipid-amine adjuvant, E. coli heat-labile enterotoxin (recombinant or otherwise), cholera toxin, IMS 1314, muramyl dipeptide, Gel adjuvant, etc. Preferably, the adjuvant comprises one or several of an aluminium gel adjuvant, a saponin, a water-in-oil emulsion, an oil-in-water emulsion, a water-in-oil-in-water emulsion, a polymer of acrylic or methacrylic acid, a copolymer of maleic anhydride and an alkenyl derivative, RIBI adjuvant system, Block co-polymer, SAF-M, monophosphoryl lipid A, Avridine lipid-amine adjuvant, E. coli heat-labile enterotoxin, cholera toxin, IMS 1314, muramyl dipeptide or Gel adjuvant.

[0071] White oil, also known as paraffin oil, white oil, and mineral oil, is a widely used adjuvant in inactivated vaccines. It has the function of delaying the retention time of immunogens in the body, allowing them to be released continuously and slowly, and enhancing the phagocytic and bactericidal ability of macrophages.

[0072] The term "low temperature" refers to the temperature at which Triton and water are miscible and no phase separation occurs, for example, 4°C.

[0073] The term "prevention" when referring to egg drop syndrome virus infection means inhibiting the replication of egg drop syndrome virus, inhibiting the spread of egg drop syndrome virus or preventing egg drop syndrome virus from taking root in its host, and alleviating the symptoms of diseases or conditions caused by egg drop syndrome virus infection.

[0074] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not limit the scope of the present invention in any way. It should be understood by those skilled in the art that the details and forms of the technical solutions of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, and such modifications and replacements fall within the scope of protection of the present invention.

[0075] The chemical reagents used in the present invention were all analytically pure and purchased from Sinopharm Group. The experimental methods described in the present invention, unless otherwise specified, are all conventional methods; the biological materials described, unless otherwise specified, can all be obtained from commercial channels.

[0076] Example 1 Preparation of Egg Drop Syndrome Virus (EDS-76) Subunit Nanoparticle Antigen

[0077] 1.1 Construction of recombinant expression vector of knob-HPF fusion fragment

[0078] 1.1.1 Design of synthetic primers

[0079] The sequences of SEQ ID NO: 1 and SEQ ID NO: 2 were synthesized into the pUC57 vector and named pUC57::Knob and pUC57::HPF, respectively. Primers were designed using Primer 5.0 for cloning and constructing the gene sequences of SEQ ID NO: 1 and SEQ ID NO: 2. Gene and primer synthesis were performed by Suzhou Jinweizhi Biotechnology Co., Ltd.

[0080] Knob-F-Nde I:

[0081] GGGAATTCCATATGACCCCGCTGACCCGTATCAT

[0082] Knob-R-BamH I:

[0083] CGCGGATCCCTGAGCACCAACGTAGGTGA

[0084] HF-RF-BamH I:

[0085] CGCGGATCCGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGT GGTGGTGGTTCTATGCTGAAACCAGAAATGAT

[0086] HF-RR-Xho I:

[0087] CCGCTCGAGTTAGTTTTGTGTGTCGAGGG

[0088] 1.1.2 Cloning into pET28a vector

[0089] Using the synthetic pUC57::knob and pUC57::HPF vectors as templates, the Knob and HPF fragments were amplified using the primer sets Knob-F-NdeI / Knob-R-BamH I and HF-RF-BamH I / HF-RR-Xho I, respectively. The two fragments were cloned into the pET28a vector (see attached). Figure 1 First, the pET28a vector and the Knob fragment were double-digested with Nde I and BamH I restriction endonucleases. The digested products were recovered and ligated with T4 DNA ligase. The ligated products were then transformed into competent E. coli Trans1-T1 cells. The transformant plasmids were extracted and double-digested with Nde I and BamH I restriction endonucleases to yield fragments of approximately 5300 bp and 630 bp, respectively. The recombinant plasmid was then verified to be correct and named pET28a-Knob.

[0090] The pET28a-Knob vector and HPF fragment were digested simultaneously with BamH I and Xho I restriction endonucleases. The resulting products were recovered, ligated, and transformed using the same methods. The transformant plasmids were extracted and digested with BamH I and Xho I restriction endonucleases, yielding fragments of approximately 6000 bp and 550 bp, respectively. The verified recombinant plasmid was named pET28a-Knob-HPF.

[0091] 1.2 Expression of Knob-HPF fusion protein

[0092] The recombinant plasmid pET28a-Knob-HPF was transformed into competent E. coli BL21 (DE3) cells. The transformants were inoculated into LB liquid medium (supplemented with kanamycin at a final concentration of 50 μg / mL) and cultured at 37°C and 220 rpm for approximately 10 h. The cells were then inoculated into LB shake flask fermentation medium (200 mL for a 500 mL shake flask) at a 1% inoculation ratio. The cells were cultured at 37°C and 220 rpm until the OD 600 When the HgO2 / KgO2 was about 0.6, the temperature was lowered to 28°C, and isopropyl-β-D-thiogalactopyranoside (IPTG) was added at a final concentration of 0.5 mmol / L, and the culture was continued with shaking for 12 hours to culture and ferment.

[0093] Bacterial cells were harvested by centrifugation at 8000 rpm for 10 minutes and resuspended in PBS (8 g sodium chloride, 0.2 g potassium chloride, 1.44 g sodium hydrogen phosphate, 0.24 g potassium dihydrogen phosphate, adjusted to pH 7.4, to a volume of 1 L). The cells were then disrupted by a high-pressure homogenizer at 800 bar for 3–5 cycles. The supernatant and precipitate were separated by centrifugation at 13000 rpm for 30 minutes. The precipitate was thoroughly resuspended in an equal proportion of the aforementioned PBS buffer and analyzed by SDS-PAGE. The results showed that a target protein band of approximately 44 kDa was detected in the supernatant, with a protein expression level of approximately 0.4 mg / mL.

[0094] 1.3 Purification of Knob-HPF fusion protein

[0095] Cool the supernatant containing the target protein to below 10°C and slowly add Triton 114 to a final concentration of 0.5% (stirring constantly). Stir at low temperature for approximately 10 minutes. Add PEI to a final concentration of 0.1% while still cold and continue stirring for approximately 10 minutes. Raise the mixture to 22°C and add 1% activated carbon (w / v). Stir thoroughly and centrifuge at 13,000 rpm for 20 minutes (inspect the supernatant for oily material; if present, repeat the activated carbon adsorption step). Slowly add ammonium sulfate (v / v) to the supernatant and stir at 4°C for approximately 30 minutes. Centrifuge the mixture at 8,000 rpm for 10 minutes, collect the precipitate, and resuspend in PBS buffer. SDS-PAGE results indicate minimal loss of the purified target protein, with a purity of approximately 80%.

[0096] 1.4 Detection of Knob-HPF Fusion Protein

[0097] 1.4.1 Hemagglutination activity (HA) assay

[0098] Hemagglutination activity of the target protein before and after purification was assessed using a 96-well V-shaped reaction plate (90°). The specific method is as follows: First, add 25 μL of PBS buffer to the 96-well plate, then add 25 μL of the antigen protein. Mix the sample by gently pipetting 8–10 times. Aspirate 25 μL of the mixed sample and dilute it in a 2-fold dilution series. After dilution is complete, add 25 μL of fresh, SPF chicken-derived sensitized red blood cells to the 96-well plate and gently shake to mix. After incubating at room temperature for approximately 30 minutes, place the plate vertically for analysis. The titer of the antigen was determined by the last dilution at which no red blood cell sedimentation line appeared. For the control group, PBS buffer was added instead of the test sample.

[0099] The results showed that the HA titer of the purified Knob-HPF fusion protein was no less than 1:4096 (12 log2), with a loss of no more than one titer compared to the HA titer of the antigen protein before purification. In addition, the HA titer of the purified Knob-HPF fusion protein was 512 times that of the single Knob antigen protein.

[0100] 1.4.2 Transmission electron microscopy (TEM) detection

[0101] A 10 μL sample of purified protein was added to a Fanghua membrane carbon-coated copper grid and allowed to adsorb for 10 minutes at 35°C. The grid was then negatively stained with 2% phosphotungstic acid for 10 seconds. Excess liquid was removed along the edge of the grid using filter paper, and the grid was dried at 35°C for 10 minutes before observation under a transmission electron microscope at 300,000x magnification. The results showed that the Knob protein was fully displayed on the surface of the HPF nanoparticles, and the Knob-HPF fusion protein formed uniformly sized spherical nanoparticles.

[0102] Example 2 Preparation and Immunological Evaluation of Avian Egg Drop Syndrome Virus (EDS-76) Subunit Nanoparticle Vaccine

[0103] 2.1 Preparation of Knob-HPF recombinant subunit nanoparticle vaccine

[0104] The Knob-HPF fusion protein obtained in Example 1 was slowly added to the mineral oil adjuvant while stirring at 17,500 rpm for 5 minutes. Before stopping stirring, 1% thimerosal solution (v / v) was added to a final concentration of 0.01%. Specific ratios are shown in Table 1.

[0105] Table 1 Ratio of avian egg drop syndrome virus subunit nanoparticle vaccine

[0106] Components Vaccine 1 Vaccine 2 Vaccine 3 Knob-HPF protein (HA titer) 1:512 1:1024 1:2048 Mineral oil adjuvant (V / V %) 66% 66% 66%

[0107] 2.2knob-HPF fusion nanoparticle vaccine immunization

[0108] Forty Hy-Line Brown laying hens at peak egg production were divided into four groups of 10 each. Groups 1, 2, and 3 were immunized with avian egg drop syndrome virus (EDS-76) subunit nanoparticle vaccines 1, 2, and 3, respectively, prepared using the aforementioned experimental procedures. Group 4 was immunized with 0.5 ml of PBS as a control. Immunization was by intramuscular injection into the leg, with a dose of 0.5 mL per bird.

[0109] 2.3 Antibody level detection

[0110] Before and 21 days after vaccination, blood was collected from each group of test animals, and serum was separated. The titer of HI antibody to avian egg drop syndrome virus in immunized and control chickens was measured by hemagglutination inhibition test. When the egg production rate reached about 90% (6 weeks after vaccination), all four groups of test chickens were challenged with HX strain virulent virus. Each chicken was orally administered 1 ml of 10-fold diluted virus with a virus content of 10 6.5 EID 50 The chickens were observed for 6 weeks after challenge, including feeding, mental status, and feces. Egg production was recorded and egg production rate was calculated. The results are shown in Table 2.

[0111] Table 2 Results of immunogenicity test of avian egg drop syndrome virus subunit nanoparticle vaccine in laying hens

[0112]

[0113] The results showed that the HI antibody titer in the control group (Group 4) was 0 21 days after vaccination. Egg production in the control chickens began to decline after challenge, dropping from approximately 90% to approximately 45% in the third week after challenge. Eggshell color also faded, and soft-shelled, shell-less, and deformed eggs were produced. Egg production was approximately 68% in the sixth week after challenge, still not returning to normal levels. In contrast, chickens in Groups 1 through 3 immunized with the avian egg drop syndrome virus subunit nanoparticle vaccine, with an HA titer of no less than 1:512, all produced high HI antibody titers in the chickens. This indicates that the Knob-HPF fusion protein antigen of the present invention has good immunogenicity and can provide effective immune protection to chickens.

[0114] Example 3 Immunogenicity Test of Egg Drop Syndrome Virus (EDS-76) Subunit Nanoparticle Vaccine on SPF Chickens

[0115] Take 21-day-old SPF chickens 50, divided into 5 groups, 10 in each group, the 5th group to the 7th group were injected with leg muscle immunization of the vaccine 1 to vaccine 3 prepared in Example 2, respectively, the 8th group was injected with leg muscle immunization of commercial inactivated vaccine (HA titer 13 log2), the immunization dose was 0.5 ml, the 9th group was injected with 0.5 ml of normal saline in the leg muscle, as a blank control. All test chickens were isolated and fed, before immunization and 21 days after immunization, blood was collected from each chicken, serum was separated, and the HI antibody titer of avian egg drop syndrome in the serum was determined. The results are shown in Table 3.

[0116] Table 3 Results of avian egg drop syndrome virus subunit nanoparticle vaccine immunogenicity test on SPF chickens

[0117]

[0118] The results show that the HI antibody titer of the 9th control group after 21 days of immunization is 0, while the 5th to 7th immunization groups produce high HI antibody titers in immunized chickens, and the HI antibody titer produced by the 8th commercial inactivated vaccine immunization group is lower than that of the avian egg drop syndrome virus subunit nanoparticle vaccine immunization group. It shows that the avian egg drop syndrome virus subunit nanoparticle vaccine with HA titer not less than 1:512 can produce high HI antibody titer in chicken population, which can provide effective immunoprotection to chicken population, and under lower antigen content, high HI antibody titer is produced.

[0119] Example 4 Avian egg drop syndrome virus (EDS-76) subunit nanoparticle vaccine immunogenicity test on cherry valley ducks

[0120] Take 42-day-old cherry valley ducks 40, divided into 4 groups, 10 in each group, the 10th group to the 12th group were injected with leg muscle immunization of the vaccine 1 to vaccine 3 prepared in Example 4, respectively, the immunization dose was 0.5 ml, the 13th group was injected with 0.5 ml of normal saline in the leg muscle, as a blank control. All test ducks were isolated and fed, before immunization and 21 days after immunization, blood was collected from each duck, serum was separated, and the HI antibody titer of avian egg drop syndrome in the serum was determined. The determination results are shown in Table 4.

[0121] Table 4 Results of avian egg drop syndrome virus subunit nanoparticle vaccine immunogenicity test on cherry valley ducks

[0122]

[0123] The results showed that the HI antibody titer in the control group (group 12) was zero 21 days after vaccination, while the ducks in groups 10 to 12 all produced high HI antibody titers, indicating a good immune response. This suggests that immunization with an AESV subunit nanoparticle vaccine with an HA titer of at least 1:512 can produce high HI antibody titers in ducks. The Knob-HPF fusion protein antigen of the present invention has good immunogenicity and can provide effective immune protection to ducks.

[0124] The above description is merely a preferred embodiment of the present invention and does not constitute any form of limitation to the present invention. Although the present invention has been disclosed as a preferred embodiment, it is not intended to limit the present invention. Any technician familiar with the present profession can make slight changes or modifications to equivalent embodiments of the technical contents disclosed above without departing from the scope of the technical solution of the present invention. However, any simple modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention are still within the scope of the technical solution of the present invention. SEQUENCE LISTING <110> Plike Bioengineering Co., Ltd. <120> Avian egg drop syndrome virus subunit nanoparticle antigen and its application <160> 3 <170> PatentIn version 3.3 <210> 1 <211> 636 <212> DNA <213> Egg drop syndrome virus <400> 1 accccgctga cccgtatcat ctctatgggt aacaacctgt tcgactctgg ttacgaaatc 60 ttcgcttctt gcccgcagaa caaagctgct aaagttgctg gttacgttta cctgacctct 120 gttggtggtc tggttcacgg taccatccag atcaaagcta ccgctggtta ctggttcacc 180 ggtggtaact ctgttcagga atctatccgt ttcggtctgg ttctgtgccc gttctctgct 240 cgtgacccga ccgctaacct gtctggttgg ccggctccgg ttgtttggtc tggtgactct 300 aacaccccgc tgtacttcgc tgctaacgct atctcttaca ccaacaaccg tgttaacctg 360 gctgttaccg gtaacttcta caaagaagaa accgaactgc cgggttacac ccgtcactct 420 ttctgcccga ccggtaccac cggtatgaac ttcaccggtg gtaacctgta cgtttgcccg 480 tgcaccgtta acaccggtgc taccaccctg aacgctatct acatggtttt cgttatcacc 540 cagtctgctc tgggtaccaa cttcttcgct tctaacaccc cgccgaacac cttcttcctg 600 accccgccga tcccgttcac ctacgttggt gctcag 636 <210> 2 <211> 504 <212> DNA <213> 幽门螺杆菌(Helicobactor pylori) <400> 2 atgctgtcta aagacatcat caaactgctg aacgaacagg ttaacaaaga aatgaactct 60 tctaacctgt acatgtctat gtcttcttgg tgctacaccc actctctgga cggtgctggt 120 ctgttcctgt tcgaccacgc tgctgaagaa tacgaacacg ctaaaaaact gatcatcttc 180 ctgaacgaaa acaacgttcc ggttcagctg acctctatct ctgctccgga acacaaattc 240 gaaggtctga cccagatctt ccagaaagct tacgaacacg aacagcacat ctctgaatct 300 atcaacaaca tcgttgacca cgctatcaaa tctaaagacc acgctacctt caacttcctg 360 cagtggtacg ttgctgaaca gcacgaagaa gaagttctgt tcaaagacat cctggacaaa 420 atcgaactga tcggtaacga aaaccacggt ctgtacatcg ctgaccagta cgttaaaggt 480 atcgctaaat ctcgtaaatc ttaa 504 <210> 3 <211> 1191 <212> DNA <213> artificial sequence <400> 3 accccgctga cccgtatcat ctctatgggt aaacctgt tcgactctgg ttacgaaatc 60 ttcgcttctt gcccgcagaa caaagctgct aaagttgctg gttacgttta cctgacctct 120 gttggtggtc tggttcacgg taccatccag atcaaagcta ccgctggtta ctggttcacc 180 ggtggtaact ctgttcagga atctatccgt ttcggtctgg ttctgtgccc gttctctgct 240 cgtgacccga ccgctaacct gtctggttgg ccggctccgg ttgtttggtc tggtgactct 300 aacaccccgc tgtacttcgc tgctaacgct atctcttaca ccaacaaccg tgttaacctg 360 gctgttaccg gtaacttcta caaagaagaa accgaactgc cgggttacac ccgtcactct 420 ttctgcccga ccggtaccac cggtatgaac ttcaccggtg gtaacctgta cgtttgcccg 480 tgcaccgtta acaccggtgc taccaccctg aacgctatct acatggtttt cgttatcacc 540 cagtctgctc tgggtaccaa cttcttcgct tctaacaccc cgccgaacac cttcttcctg 600 accccgccga tcccgttcac ctacgttggt gctcagggat ccggtggtgg tggttctggt 660 ggtggtggtt ctggtggtgg tggttctatg ctgtctaaag acatcatcaa actgctgaac 720 gaacaggtta acaaagaaat gaactcttct aacctgtaca tgtctatgtc ttcttggtgc 780 tacacccact ctctggacgg tgctggtctg ttcctgttcg accacgctgc tgaagaatac 840 gaacacgcta aaaaactgat catcttcctg aacgaaaaca acgttccggt tcagctgacc 900 tctatctctg ctccggaaca caaattcgaa ggtctgaccc agatcttcca gaaagcttac 960 gaacacgaac agcacatctc tgaatctatc aacaacatcg ttgaccacgc tatcaaatct 1020 aaagaccacg ctaccttcaa cttcctgcag tggtacgttg ctgaacagca cgaagaagaa 1080 gttctgttca aagacatcct ggacaaaatc gaactgatcg gtaacgaaaa ccacggtctg 1140 tacatcgctg accagtacgt taaaggtatc gctaaatctc gtaaatctta a 1191

Claims

1. A nanoparticle antigen of avian egg drop syndrome virus subunit, wherein: The avian egg drop syndrome virus subunit nanoparticle antigen is self-assembled by the avian egg drop syndrome virus Knob-HPF fusion protein; the protein sequence of the avian egg drop syndrome virus Knob-HPF fusion protein is composed of the Knob region, linker and N-terminal fragment of Helicobacter pylori Ferritin (HPF) of the avian egg drop syndrome virus fiber protein from the N-terminus to the C-terminus; the avian egg drop syndrome virus Knob-HPF fusion protein is encoded by SEQ ID NO: 3 or its degenerate sequence.

2. A subunit vaccine for avian egg drop syndrome virus, wherein: The avian egg drop syndrome virus subunit vaccine comprises the avian egg drop syndrome virus subunit nanoparticle antigen according to claim 1 and a pharmaceutically acceptable carrier; the amount of the avian egg drop syndrome virus subunit nanoparticle antigen is an immune effective amount.

3. The avian egg drop syndrome virus subunit vaccine according to claim 2, wherein The avian egg drop syndrome virus subunit nanoparticle antigen content is HA titer ≥ 1:

512.

4. The avian egg drop syndrome virus subunit vaccine according to claim 3, wherein The avian egg drop syndrome virus subunit nanoparticle antigen content is HA titer 1:512 to 1:2048.

5. The avian egg drop syndrome virus subunit vaccine according to claim 2, wherein The pharmaceutically acceptable carrier is an adjuvant, and the adjuvant includes: (1) mineral oil, aluminum gel adjuvant, saponin, avridine, DDA; (2) water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion; or (3) polymers of acrylic acid or methacrylic acid, copolymers of maleic anhydride and alkenyl derivatives; and one or more of RIBI adjuvant system, Block co-polymer, SAF-M, monophosphoryl lipid A, Avridine lipid-amine adjuvant, Escherichia coli heat-labile enterotoxin, cholera toxin, IMS1314, muramyl dipeptide, ISA 206, and Gel adjuvant; The adjuvant content is 5% V / V-70% V / V.

6. The avian egg drop syndrome virus subunit vaccine according to claim 5, wherein The saponins are QuilA, QS-21, and GPI-0100.

7. The avian egg drop syndrome virus subunit vaccine according to claim 5, wherein The adjuvant content is 30% V / V to 70% V / V.

8. The avian egg drop syndrome virus subunit vaccine according to claim 7, wherein The adjuvant content was 66% V / V.

9. A method for preparing the avian egg drop syndrome virus subunit vaccine according to claim 2, wherein: The method comprises: Step (1) cloning and expressing the avian egg drop syndrome virus Knob-HPF fusion protein described in claim 1, adding Triton and PEI to the expressed avian egg drop syndrome virus Knob-HPF fusion protein at low temperature, mixing them evenly, heating them and removing the oil phase by adsorption with activated carbon, and centrifuging the avian egg drop syndrome virus Knob-HPF fusion protein in the supernatant to self-assemble and form the avian egg drop syndrome virus subunit nanoparticle antigen; Step (2) purifying the avian egg drop syndrome virus subunit nanoparticle antigen of step (1) by ammonium sulfate precipitation; and Step (3) adds the purified avian egg drop syndrome virus subunit nanoparticle antigen of step (2) to the adjuvant, mixes them evenly, and obtains the avian egg drop syndrome virus subunit vaccine.

10. Use of the avian egg drop syndrome virus subunit vaccine according to any one of claims 2 to 8 in the preparation of a medicament for preventing avian egg drop syndrome.

11. The use according to claim 10, wherein: The application animals are chickens and ducks.

Citation Information

Patent Citations

  • Acrylic acid polymer laxative compositions

    US2909462A

  • Vaccine composition for preventing egg drop syndrome, and preparation method and application of vaccine composition

    CN108653724A

  • Helicobacter pylori ferritin-based novel coronavirus S protein polymer nano vaccine

    CN112010984A