Transcription factor srmyb1 for regulating synthesis of steviol glycosides, and expression protein and application thereof
By providing the stevia SrMYB1 gene and its expressed protein, and inhibiting the expression of SrUGT76G1, the problem of low content of high-quality stevia glycosides in existing technologies is solved, thereby achieving regulation of stevia glycoside synthesis and quality improvement.
Patent Information
- Application Number
- CN202210513381.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-05-12
- Publication Date
- 2026-05-08
- Estimated Expiration
- 2042-05-12
AI Technical Summary
Existing technologies are insufficient to effectively increase the content of high-quality glycosides such as RM glycosides in stevia, and there are no reports on the role of MYB transcription factors in regulating the biosynthesis of stevia glycosides.
The stevia SrMYB1 gene and its expressed protein are provided. The synthesis of stevia RA and RM glycosides is regulated by inhibiting SrUGT76G1 transcription. The SrMYB1 gene is used to inhibit the expression of SrUGT76G1 to promote the synthesis of high-quality glycosides.
It significantly inhibited the expression of SrUGT76G1, increased the content of high-quality glycosides in stevia, and laid the foundation for the genetic improvement of stevia.
Smart Images

Figure CN115612692B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, and more specifically, relates to a transcription factor SrMYB1 that regulates the synthesis of steviol glycosides, its expression protein, and its applications. Background Technology
[0002] Stevia is a perennial herbaceous plant of the Asteraceae family. Its leaves are rich in steviol glycosides, which have high sweetness (about 300-400 times that of sucrose), low calories (about 1 / 300 of sucrose), and the effects of preventing and assisting in the treatment of diseases such as hypertension, diabetes and tumors. It is widely used in the fields of food, beverage and medicine. Stevia is also known as the most promising sugar crop after sugarcane and sugar beets.
[0003] As one of the most important secondary metabolites in stevia, the biosynthetic pathways and regulatory genes of steviol glycosides have been a research hotspot in this field. After decades of research, it is now known that steviol, the precursor of steviol glycosides, is generated via the MEP pathway, and then various steviol glycosides are generated by adding different types and amounts of glycosyl groups at C-13 and C-19 positions through a series of glycosyltransferase genes. Currently, more than 30 types of steviol glycosides have been discovered, with ST and RA glycosides having the highest content, accounting for 75-90% of the total glycoside content. Compared to ST glycosides, RA glycosides have a better taste and are currently the main type of glycosides used in the market. With the continuous deepening of glycoside research, in recent years, a glycoside RM with a taste closest to sucrose has been discovered; however, its content in stevia leaves is very low (approximately 0.4-0.5% of the total glycosides). Therefore, how to increase the content of high-quality glycosides in stevia has become an urgent problem to be solved. Through research on glycosyltransferase genes in the glycoside pathway, it has been found that... SrUGT76G1 Genes can promote not only the conversion of ST glycosides to RA glycosides, but also the conversion of RD glycosides to RM glycosides, therefore SrUGT76G1 Genes have become a crucial element in improving the quality of glycosides. Identifying their upstream regulators will also influence the content of high-quality glycosides in stevia leaves.
[0004] MYB transcription factors are one of the most numerous and functionally diverse transcription factor families in plants. Proteins in this family all contain one or more conserved MYB domains, each consisting of 50-53 conserved amino acids. Based on the number of MYB domains, the MYB transcription factor family can be divided into four types: 1R (R1 / 2, R3 MYB), 2R (R2R3 MYB), 3R (R1R2R3 MYB), and 4R (4 R1 / R2 like). 2R type MYB proteins constitute the vast majority of plant MYB proteins. MYB transcription factors can activate or inhibit the expression of downstream genes and participate in various life processes in plants, including growth and development, stress response, and secondary metabolism; however, their role in regulating steviol glycoside biosynthesis has not been reported. Summary of the Invention
[0005] The purpose of this invention is to provide a transcription factor gene that regulates steviol glycoside biosynthesis. SrMYB1 This invention provides a candidate gene for regulating steviol glycoside synthesis. In the future, inhibiting the expression of this gene in stevia can promote the synthesis of high-quality glycosides, demonstrating promising application prospects.
[0006] The present invention achieves the above objectives through the following technical solutions:
[0007] A type of stevia SrMYB1 The gene, whose nucleotide sequence is shown in SEQ ID NO.1.
[0008] The stevia mentioned SrMYB1 The expressed protein of the gene has the amino acid sequence shown in SEQ ID NO.2.
[0009] Used for cloning. SrMYB1 The primer pair for the gene, and the primer sequences of the primer pair are as follows:
[0010] SrMYB1-F: CTTAGCTTTCCAGTCTGCCCC;
[0011] SrMYB1-R:CCCTCTAGAAGGTTCACACCAG.
[0012] Contains the stevia SrMYB1 The vector or host bacterium of the gene.
[0013] This invention also provides the application of transcription factor SrMYB1 in regulating steviol glycoside biosynthesis.
[0014] A further improvement lies in that the regulation of steviol glycoside biosynthesis refers to the regulation of key components in the synthesis of steviol RA and RM glycosides. SrUGT76G1 Gene expression.
[0015] A further improvement is that the transcription factor SrMYB1 inhibits... SrUGT76G1 Reduction of transcription SrUGT76G1 The expression.
[0016] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0017] This invention provides a new SrUGT76G1 Regulatory genes SrMYB1 The gene is 1074 bp in length and encodes 357 amino acid residues. Subcellular localization studies show that the protein is mainly located in the cell nucleus; yeast activation experiments show that the protein has transcriptional activation activity; yeast one-hybrid experiments show that SrMYB1 can bind to... SrUGT76G1 Gene promoter sequence; promoter activity and transgenic experiments showed that SrMYB1 significantly inhibits... SrUGT76G1 The expression of SrMYB1 indicates that it can inhibit key genes involved in the synthesis of stevia RA and RM glycosides. SrUGT76G1 Transcription. Therefore, stevia... SrMYB1 Genes and their encoded proteins can be used for the genetic improvement of steviol glycoside content and quality. Attached Figure Description
[0018] Figure 1 Amino acid sequence analysis of SrMYB1 protein (A) and phylogenetic tree (B);
[0019] Figure 2 This is a map showing the localization of SrMYB1 protein in tobacco epidermal cells.
[0020] Figure 3 This is a graph showing the transcriptional activity analysis of SrMYB1.
[0021] Figure 4 For SrMYB1 binding SrUGT76G1 Analysis diagram of promoters;
[0022] Figure 5 SrMYB1 regulation SrUGT76G1 An analytical diagram illustrating the expression. Detailed Implementation
[0023] The present invention will be further described below with reference to specific embodiments. In the following embodiments, operations not described in detail are routine biological experimental procedures and can be performed with reference to molecular biology experimental manuals and existing publicly available journal literature.
[0024] Plant materials:
[0025] The material used for gene cloning was leaves of the stevia variety 'Zhongshan No. 6', which was independently bred in our laboratory and collected from the Stevia Germplasm Resource Nursery of the Institute of Botany, Chinese Academy of Sciences, Jiangsu Province. The tobacco used for subcellular localization and promoter LUC experiments was Nicotiana benthamiana, and the culture conditions were a 16-hour light / 8-hour dark photoperiod and a day / night temperature of 23℃ / 18℃.
[0026] Strains and vectors:
[0027] E. coli DH5α Agrobacterium EHA105 All competent yeast strains were purchased from Vidi (Shanghai) Co., Ltd. AH109 and EGY48 The bacterial strains and the pGBKT7 and pGADT7 vectors were purchased from TaKaRa Biotechnology (Beijing) Co., Ltd. (Dalian). The subcellular localization vector pCAMBIA1305-GFP, the yeast one-hybrid vectors pB42AD and pLacZi, and the promoter activity verification vector pGreenII 0800-LUC were all stored in the laboratory.
[0028] Example 1:
[0029] (1) Stevia SrMYB1 Gene cloning
[0030] Total RNA was extracted from stevia leaves using TaKaRa's Trizol reagent according to the manufacturer's instructions, and then processed using the company's PrimeScript 1. st The cDNA was reverse transcribed using the Strand cDNA Synthesis Kit. The cDNA was then compared and screened against stevia transcriptome and genome databases to obtain... SrMYB1 The full-length gene sequence was obtained, and PCR amplification was performed using full-length primers to clone the gene. SrMYB1 The primers used are as follows:
[0031] SrMYB1-F: CTTAGCTTTCCAGTCTGCCCC;
[0032] SrMYB1-R:CCCTCTAGAAGGTTCACACCAG.
[0033] The amplification products were recovered and purified using a gel extraction kit from TaKaRa, and then the recovered fragments were amplified using primers with added adapters. The amplification primers are as follows (lowercase letters indicate vector homologous arms):
[0034] SrMYB1-GFP-F: cggagctagctctagaATGGGAAGACACTCTTGT;
[0035] SrMYB1-GFP-R: tcgagacgtctctagaTGAATATTGCCCATAGCT.
[0036] The amplified product was subjected to agarose gel electrophoresis and then purified using a TaKaRa gel extraction kit. Additionally, TaKaRa's... XbaI The pCAMBIA1305 empty vector was digested with a rapid digestion enzyme. The digestion products were purified by agarose gel electrophoresis and then recovered using a TaKaRa gel extraction kit. The purified fragments and vectors were then subjected to recombinant reactions using recombinase from Novizan Biotechnology Co., Ltd. (Nanjing). The recombinant products were transformed into *E. coli*. DH5α The bacterial strain was selected and then sequenced by a sequencing company (General). Sequencing yielded... SrMYB1 The gene's open reading frame is 1074 bp, encoding 357 amino acid residues. Simultaneously, the constructed SrMYB1 subcellular localization vector pCAMBIA1305- was obtained. SrMYB1 - GFP .
[0037] The SrMYB1 protein sequence was submitted to NCBI for domain prediction, and multiple sequence alignment using DNAMAN software revealed that it has two MYB domains and belongs to the R2R3 type of MYB transcription factor. Figure 1 A). Phylogenetic trees of its homologous genes with other species were constructed using MEGA 5.0 software (NJ neighbor-joining method). The results showed that it was closely related to MYB61 of lettuce, sunflower, and MYB1 of Artemisia annua in the Asteraceae family. Figure 1 B).
[0038] (2) Subcellular localization analysis of SrMYB1 protein
[0039] The constructed pCAMBIA1305- SrMYB1 - GFP Vector transformation of Agrobacterium competent cells EHA105 Cells were injected into *Tobacco Monomerica* epidermal cells, and after normal culture for 2-3 days, the injection site was excised and fluorescence was observed under a laser confocal microscope (Leica TCSSP5). The results showed that the empty GFP vector was localized in both the nucleus and cytoplasm, while the fluorescence signal emitted by SrMYB1-GFP was mainly concentrated in the nucleus. Figure 2 This indicates that the SrMYB1 protein is mainly located in the cell nucleus, which is consistent with its function as a transcription factor.
[0040] (3) SrMYB1 transcriptional activation activity analysis
[0041] The full-length sequence of SrMYB1 was cloned using adapter-added primers. Additionally, data from TaKaRa was used. EorRI and PSTI The pGBKT7 empty vector was double-digested with a rapid digestion enzyme. Both the gene amplification product and the digestion product were subjected to agarose gel electrophoresis and then purified using a TaKaRa gel extraction kit. The recovered fragments and vector were then used for recombination using Novizan's recombinase. The recombinant product was transformed into *E. coli*. DH5α After selecting the bacterial strain, the sequencing was performed by a sequencing company (general) to obtain the correct structure.
[0042] The constructed pGBKT7- SrMYB1 The pGBKT7 empty vector and the pGADT7 empty vector were co-transformed into competent yeast cells using a yeast transformation kit from Clontech. AH109 Then, the cells were plated on SD / -Trp-Leu yeast-deficient medium and incubated upside down at 30°C for about 3 days. Single colonies were then picked and dissolved in 0.9% NaCl solution, and spotted at different concentration gradients onto SD / -Trp-Leu and SD / -Trp-Leu-His-Ade yeast-deficient media, and incubated upside down at 30°C. The results showed that yeast transformed with SrMYB1-BD could grow on SD / -Trp-Leu-His-Ade medium, while yeast transformed with the BD empty vector could not. Figure 3 The above results indicate that SrMYB1 has transcriptional activation activity.
[0043] The specific primer sequences for adding the adapter are as follows (lowercase letters indicate vector homologous arms):
[0044] SrMYB1-BD-F: catggaggccgaattcATGGGAAGACACTCTTGT;
[0045] SrMYB1-BD-R: tagttatgcggccgctgcagCTATGAATATTGCCCATA.
[0046] (4) SrMYB1 and SrUGT76G1 Promoter sequence binding analysis
[0047] Using primer pairs with adapters SrUGT76G1 promoter sequence and SrMYB1 The full-length fragment was amplified, and then processed using TaKaRa technology. EorRI and XhoIThe pB42AD and pLacZi empty vectors were digested with rapid digestion enzymes. Both the gene amplification products and the digestion products were subjected to agarose gel electrophoresis and then purified using a TaKaRa gel extraction kit. The recovered fragments and vectors were then used for recombination using Novizan's recombinase. The recombinant products were transformed into *E. coli*. DH5α The bacterial strain was selected and sequenced by a general sequencing company, resulting in a correctly constructed pB42AD- strain. SrMYB1 plasmids and pLacZi- proSrUGT76G1 The plasmid combination was co-transformed into competent yeast cells using the Clontech yeast transformation kit. EGY48 Then, the cells were plated on SD / -Trp-Ura-deficient medium and incubated upside down at 30°C for approximately 3 days. Afterward, they were transferred to SD / -Trp-Ura-deficient medium containing 80 mg / L X-gal until a blue color appeared. Experimental results showed that the transformation into SrMYB1 and... SrUGT76G1 The yeast promoter was able to show blue color on X-gal-deficient medium. Figure 4 This indicates that SrMYB1 is able to interact with... SrUGT76G1 Promoter binding.
[0048] The specific primer sequences for the above adapters are as follows (lowercase letters indicate vector homologous arms):
[0049] SrMYB1-42AD-F: tgcctctcccgaattcATGGGAAGACACTCTTGT;
[0050] SrMYB1-42AD-R: cgagtcggccgaattcCTATGAATATTGCCCATA;
[0051] SrUGT76G1-Laczi-F: atctgtcgacctcgagAGTCTCCTTCTGTATTGA;
[0052] SrUGT76G1-LacZi-R: gagcacatgcctcgagAATATTATTCTCCGGCGT.
[0053] (5) SrMYB1 regulation SrUGT76G1 Expression Analysis
[0054] Using adapter primer pairs SrUGT76G1 Amplification was performed using the promoter sequence, and additionally using TaKaRa technology. NcoIThe pGreenII 0800-LUC empty vector was digested with a rapid digestion enzyme. Both the gene amplification product and the digestion product were subjected to agarose gel electrophoresis and then purified using a TaKaRa gel extraction kit. The recovered fragments and vector were then used for recombination using Novizan's recombinase. The recombinant product was transformed into *E. coli*. DH5α After bacterial selection, the strain was sequenced by a sequencing company (General) and correctly constructed. The constructed pGreenII 0800-proSrUGT76G1-LUC vector, along with the pCAMBIA1305-SrMYB1 and pCAMBIA1305 empty vectors for subcellular localization, were transiently transformed into *Nicotiana benthamiana* epidermal cells. After approximately 3 days of normal culture, the injected leaves were harvested, sprayed with LUC fluorescent chromogenic material, and the fluorescence was observed on a Tanon 5200 instrument. The results showed that the transformation was successful. SrUGT76G1 promoters and SrMYB1 The fluorescence intensity of the plasmid in tobacco tissue was much weaker than that after transformation. SrUGT76G1 The starter sequence and pCAMBIA1305 unloaded ( Figure 5 AB). Additionally, based on the reported stevia transgenic method (Wu et al., 2020), the constructed pCAMBIA1305- SrMYB1 - GFP and GFP Empty-label transformation of stevia calla lesions showed that, compared to the control, the transformation progress was significantly faster. SrMYB1 In gene-resistant callus SrMYB1 The expression level was significantly increased, while SrUGT76G1 The expression level was significantly reduced. Both the LUC and transgenic experimental results above indicate that SrMYB1 can significantly inhibit [the expression of SrMYB1]. SrUGT76G1 This is the expression. This lays the foundation for future construction. SrMYB1 Expression of the inhibitory vector transforms stevia, thereby promoting SrUGT76G1 This expression lays the foundation for increasing the content of high-quality stevia glycosides.
[0055] The specific primer sequences for the above adapters are as follows (lowercase letters indicate vector homologous arms):
[0056] SrUGT76G1-LUC-F: agatcgaattccatggAGTCTCCTTCCTGTATTGA;
[0057] SrUGT76G1-LUC-R: ttggcgtcttccatggAATATTATTCTCCGGCGT. sequence list <110> Jiangsu Provincial Institute of Botany, Chinese Academy of Sciences <120> SrMYB1, a transcription factor that regulates steviol glycoside synthesis, its expressed protein, and its applications. <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1074 <212> DNA <213> Stevia rebaudiana <400> 1 atgggaagac actcttgttg ttacaaacaa aagctaagaa aaggtctttg gtcccctgaa 60 gaagatgaaa aactcatcag acacatcacc aaattcgggc atggttgctg gagctccgtt 120 cctaaacttg ccggactcga aagatgcggt aaaagttgca ggctcagatg gatcaattac 180 ctccggcccg atttgaaacg aggcacattc tctcctcaag aagagaaatt aatcatcgaa 240 ttacacgcgg ttcttggaaa caagtggtct caaattgcag ctcagttgcc tggaagaact 300 gataacgaga taaaaaactt atggaattca acaatcaaga agaagttaag acaaagaggg 360 attgatccca acactcataa accgctatcc gaggtacacg atgatcataa agccccatcc 420 gggagtaacg agaaaaactc acaagactcg tataacctcg acgacaaacc taaaccgaat 480 gctgccgcat catcttactc gctcatcgac agttcaccac ccgcaacaca cgaattcttt 540 ctcaaccgat ttgtaacatc tcacgagaac gcgatcaaac ccgattccca ccaccaactc 600 gccggattcc ttcctttcgg ttacaaccaa caacaacaac cacaaccaga acccaatgat 660 cttttctata ataaccattc caaatcgcca tccgagctga ttccggagtt taacaattct 720 atttctaact cattactctc tgctcctccg accaaccata ataataactg ggggagtaat 780 aatagtaata ataattgcaa caacagtggc ttttattcaa caaatagtgg atatcattca 840 tgggggttga gtgatggaat aaaaactcaa aaccaaattc aaggtgttga agaacaagat 900 tacatgaaat ggaacgatca atatcttcca tttttgatgg ggaaatcaac gattgaaagt 960 aaacctgaag tcaacttcgg ggtcaaccat gaactgtatc atggacaaca aagtgtggaa 1020 acttataata agaattttca gaggattgca acaagctatg ggcaatattc atag 1074 <210> 2 <211> 357 <212> PRT <213> Stevia rebaudiana <400> 2 Met Gly Arg His Ser Cys Cys Tyr Lys Gln Lys Leu Arg Lys Gly Leu 1 5 10 15 Trp Ser Pro Glu Glu Asp Glu Lys Leu Ile Arg His Ile Thr Lys Phe 20 25 30 Gly His Gly Cys Trp Ser Ser Val Pro Lys Leu Ala Gly Leu Glu Arg 35 40 45 Cys Gly Lys Ser Cys Arg Leu Arg Trp Ile Asn Tyr Leu Arg Pro Asp 50 55 60 Leu Lys Arg Gly Thr Phe Ser Pro Gln Glu Glu Lys Leu Ile Ile Glu 65 70 75 80 Leu His Ala Val Leu Gly Asn Lys Trp Ser Gln Ile Ala Ala Gln Leu 85 90 95 Pro Gly Arg Thr Asp Asn Glu Ile Lys Asn Leu Trp Asn Ser Thr Ile 100 105 110 Lys Lys Lys Leu Arg Gln Arg Gly Ile Asp Pro Asn Thr His Lys Pro 115 120 125 Leu Ser Glu Val His Asp Asp His Lys Ala Pro Ser Gly Ser Asn Glu 130 135 140 Lys Asn Ser Gln Asp Ser Tyr Asn Leu Asp Asp Lys Pro Lys Pro Asn 145 150 155 160 Ala Ala Ala Ser Ser Tyr Ser Leu Ile Asp Ser Ser Pro Pro Ala Thr 165 170 175 His Glu Phe Phe Leu Asn Arg Phe Val Thr Ser His Glu Asn Ala Ile 180 185 190 Lys Pro Asp Ser His His Gln Leu Ala Gly Phe Leu Pro Phe Gly Tyr 195 200 205 Asn Gln Gln Gln Gln Pro Gln Pro Glu Pro Asn Asp Leu Phe Tyr Asn 210 215 220 Asn His Ser Lys Ser Pro Ser Glu Leu Ile Pro Glu Phe Asn Asn Ser 225 230 235 240 Ile Ser Asn Ser Leu Leu Ser Ala Pro Pro Thr Asn His Asn Asn Asn 245 250 255 Trp Gly Ser Asn Asn Ser Asn Asn Asn Cys Asn Asn Ser Gly Phe Tyr 260 265 270 Ser Thr Asn Ser Gly Tyr His Ser Trp Gly Leu Ser Asp Gly Ile Lys 275 280 285 Thr Gln Asn Gln Ile Gln Gly Val Glu Glu Gln Asp Tyr Met Lys Trp 290 295 300 Asn Asp Gln Tyr Leu Pro Phe Leu Met Gly Lys Ser Thr Ile Glu Ser 305 310 315 320 Lys Pro Glu Val Asn Phe Gly Val Asn His Glu Leu Tyr His Gly Gln 325 330 335 Gln Ser Val Glu Thr Tyr Asn Lys Asn Phe Gln Arg Ile Ala Thr Ser 340 345 350 Tyr Gly Gln Tyr Ser 355
Claims
1. A type of stevia SrMYB1 The gene, whose nucleotide sequence is shown in SEQ ID NO.
1.
2. The stevia according to claim 1 SrMYB1 The expressed protein of the gene has the amino acid sequence shown in SEQ ID NO.
2.
3. For cloning to obtain the stevia as described in claim 1 SrMYB1 The primer pair for the gene, the sequence of which is: SrMYB1-F:CTTAGCTTCCAGTCTGCCCC; SrMYB1-R:CCCTCTAGAAGGTTCACACCAG。 4. Containing the stevia of claim 1 SrMYB1 The vector or host bacterium of the gene.
5. A stevia as described in claim 1 SrMYB1 Genes in regulating steviol glycoside biosynthesis SrUGT76G1 Its application in gene expression is characterized by, Overexpression of stevia SrMYB1 Gene suppression SrUGT76G1 Gene transcription is inhibited, thereby suppressing its expression.
Citation Information
Patent Citations
Transcription factor SrMYC2 for delaying flowering time of stevia rebaudiana as well as expression protein and application of transcription factor SrMYC2
CN114774433A