Non-natural amino acid-regulated gene translation systems and their applications

By using a gene translation system regulated by non-natural amino acids, the problem of excessively long response time in existing gene regulation systems has been solved, enabling rapid regulation at the gene translation level. This system has been applied to diabetes treatment and biocomputing, demonstrating a rapid blood sugar-lowering effect in mammalian cells.

CN115704046BActive Publication Date: 2026-06-30PEKING UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202110929244.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-08-13
Publication Date
2026-06-30
Estimated Expiration
2041-08-13

AI Technical Summary

Technical Problem

Existing gene regulation systems have excessively long response times at the transcriptional level, which cannot meet the needs for rapid and timely disease treatment, especially in scenarios such as diabetes where rapid blood sugar control is required.

Method used

A gene translation system regulated by non-natural amino acids is used to achieve rapid gene translation level regulation by combining aminoacyl-tRNA synthetase and tRNA orthogonal molecular pairs with the target protein gene sequence containing the stop codon in the reading frame. Non-natural amino acids such as oxy-methyltyrosine or Nε-(tert-butoxycarbonyl)-L-lysine are used for regulation.

Benefits of technology

It achieves rapid expression of the target protein and can significantly reduce blood glucose levels within 90 minutes, providing a rapid and precise method for gene expression regulation, which is applicable to diabetes treatment and biocomputation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003210645480000081
    Figure BDA0003210645480000081
  • Figure BDA0003210645480000091
    Figure BDA0003210645480000091
  • Figure HDA0003210645490000011
    Figure HDA0003210645490000011
Patent Text Reader

Abstract

This invention relates to synthetic biology, gene and cell therapy, and particularly to a gene translation system regulated by non-natural amino acids and its applications. This gene translation system precisely regulates gene expression initiation using non-natural amino acids. The invention also provides eukaryotic expression vectors, mammalian cell lines, microcapsules, vacuum fiber tubes, and non-natural amino acid cookies containing the aforementioned gene translation system. Furthermore, this invention discloses that the multifunctional platform can precisely regulate insulin expression and release for diabetes treatment; this gene expression regulation platform can be used to construct complex biological computer-controlled systems. This invention provides a powerful new gene expression regulation tool for gene therapy and cell therapy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to synthetic biology, gene and cell therapy, and particularly to gene translation systems regulated by non-natural amino acids and their applications. Background Technology

[0002] Diabetes is a common chronic disease, affecting over 400 million people worldwide. Type 1 diabetes patients typically need to monitor their blood glucose daily and calculate their insulin dosage, injecting insulin before meals to control blood sugar. This leads to poor treatment adherence. Furthermore, risks such as dosage errors can cause serious adverse reactions. Therefore, there is an urgent need to develop new diabetes treatment strategies to achieve timely blood glucose control and convenient drug administration for patients. Engineered cell methods based on synthetic biology design have been a significant advancement in cell therapy research in recent years, showing great promise for applications in diseases such as diabetes and cancer.

[0003] Synthetic biology utilizes basic biological components found in nature, such as nucleic acids, proteins, and metabolites, to artificially modify or assemble biological modules with specific functions, thereby enabling the functional design of cells, tissues, or organisms. Based on synthetic biology design, various gene regulation systems capable of responding to exogenous stimuli have been developed. By regulating gene expression through the application of stimuli, safer, more precise, and predictable regulatory methods can be used to control cellular function, with important applications in gene and cell therapy.

[0004] Currently, most gene regulatory systems regulated by stimulus signals operate at the transcriptional level within cells. The stimulus signal first activates transcription factors, which then bind to the target gene's DNA, transcribing it into mRNA, which is then translated into the target protein. The drawback of transcriptional-level gene regulation systems is their complexity and slow expression rate. It can take several hours or even a day after exposure to the stimulus signal for the system to express the target protein. This long response time cannot meet the requirements of many diseases that demand rapid and timely treatment.

[0005] Therefore, providing a multifunctional gene expression platform regulated by non-natural amino acids has significant practical implications for the treatment of diabetes. Summary of the Invention

[0006] In view of this, this invention utilizes gene codon expansion technology combined with mammalian synthetic biology techniques to provide a novel method for treating diabetes. Specifically, it uses insulin regulated by the gene translation system to control blood glucose homeostasis, thereby achieving the goal of treating diabetes. This invention develops a set of two-input logic gates in mammalian cells that combine a gene translation system and a transcriptional level regulatory system.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0008] This invention provides a gene translation system regulated by non-natural amino acids, which consists of three parts: aminoacyl-tRNA synthetase, orthogonal tRNA molecular pairs, and the gene sequence of the target protein containing a stop codon in the reading frame;

[0009] The aminoacyl-tRNA synthetase includes tyrosine aminoacyl-tRNA synthetase or pyrrolidone-lysine aminoacyl-tRNA synthetase;

[0010] The non-natural amino acids include oxy-methyltyrosine or Nε-(tert-butoxycarbonyl)-L-lysine.

[0011] In some specific embodiments of the present invention, the gene sequence of the target protein includes a reporter gene, or a gene sequence that simultaneously expresses a reporter gene and a functional protein; the target protein includes a transcription factor or a drug protein.

[0012] In some specific embodiments of the present invention, the target protein includes a secretory alkaline phosphatase, wherein the stop codon introduction site in its reading frame includes one or more of SEAP(V2TAG), SEAP(L22TAG), SEAP(V27TAG), or SEAP(Q50TAG); or

[0013] The gene sequence that simultaneously expresses the reporter gene and the functional protein includes SEAP(V27TAG)-P2A-INS(F7TAG);

[0014] The transcription factor includes tTA, and the stop codon introduction site in its reading frame includes one or more of tTA(L4TAG), tTA(S7TAG), tTA(K46TAG), tTA(E71TAG), tTA(Y110TAG), or tTA(E159TAG); or

[0015] The drug protein includes insulin, and the stop codon introduction site in its reading frame can be one or more of INS(L4TAG), INS(F7TAG), INS(Q23TAG), INS(E64TAG), or INS(L66TAG).

[0016] In some specific embodiments of the present invention, the tRNA includes a tyrosine tRNA orthogonal to the tyrosine aminoacyl tRNA synthetase in a eukaryotic system, and its antisense codon is one of UAG, UAA, and UGA, preferably UAG or UAA; or

[0017] The tRNA includes a pyrrolidone aminoacyl tRNA orthogonal to the pyrrolidone aminoacyl tRNA synthetase in a eukaryotic system, and its antisense codon is one of UAG, UAA, and UGA, with UAG or UAA being preferred.

[0018] In some specific embodiments of the present invention, the stop codon includes one or any combination of two of TAG, TAA, or TGA; wherein TAG and / or TAA are preferred.

[0019] Based on the above research, the present invention also provides a eukaryotic expression vector, including the aforementioned non-natural amino acid-regulated gene translation system.

[0020] The present invention also provides engineered cells, including the aforementioned non-natural amino acid-regulated gene translation system or the aforementioned eukaryotic expression vector.

[0021] In some specific embodiments of the present invention, the engineered cells include one or more of HEK293 series cells, human stem cells, or animal stem cells.

[0022] In addition, the present invention also provides microcapsules comprising the aforementioned non-natural amino acid-regulated gene translation system, the aforementioned eukaryotic expression vector, or one or more of the aforementioned engineered cells.

[0023] The present invention also provides a hollow fiber tube comprising the aforementioned non-natural amino acid-regulated gene translation system, the aforementioned eukaryotic expression vector, or one or more of the aforementioned engineered cells.

[0024] The present invention also provides compositions comprising one or more of the following: the non-natural amino acid-regulated gene translation system, the eukaryotic expression vector, the engineered cell, the microcapsule, or the hollow fiber tube, in combination with non-natural amino acids.

[0025] More importantly, the present invention also provides the application of the aforementioned non-natural amino acid-regulated gene translation system, the aforementioned eukaryotic expression vector, the aforementioned engineered cells, the aforementioned microcapsules, the aforementioned hollow fiber tubes, or the aforementioned compositions in the preparation of drugs for the prevention and / or treatment of diseases, protein translation regulation, transcription-translation binding regulation, or in biological computing.

[0026] In some specific embodiments of the present invention, the disease includes diabetes. The disease may be a human disease or an animal disease.

[0027] Furthermore, the present invention also provides medicaments for the prevention and / or treatment of diabetes, comprising the eukaryotic expression vector of the non-natural amino acid-regulated gene translation system, the engineered cells, the microcapsules, the hollow fiber tubes, or the compositions thereof, and pharmaceutically acceptable excipients.

[0028] The present invention also provides a method for preventing and / or treating diabetes by administering the said composition or the said drug.

[0029] The beneficial effects of the present invention include, but are not limited to:

[0030] (1) This invention is the first to artificially design and synthesize a gene translation system regulated by non-natural amino acids. The system can be uploaded into mammalian cells and execute corresponding instructions, and achieve spatiotemporally controllable transgenic expression by regulating non-natural amino acids.

[0031] (2) The non-natural amino acid-regulated gene translation system designed in this invention is a translation-level regulation system, which has a faster target protein expression rate compared to existing transcription-level gene switches.

[0032] (3) The stimulant of the gene translation system used in this invention is a non-natural amino acid, which is a chemically synthesized substance that cannot be synthesized in the natural environment or in the body. Compared with the existing gene switch system, it has better orthogonality. Moreover, non-natural amino acids have similar structures to natural amino acids and have similar pharmacokinetic properties. Therefore, gene expression in the body can be regulated by making non-natural amino acid "biscuits".

[0033] (4) This invention synthesizes a multifunctional gene expression platform regulated by non-natural amino acids, which can be used for disease treatment and biocomputers; a new method for treating diabetes by stimulating insulin expression through gavage with non-natural amino acids or by consuming non-natural amino acid "biscuits"; using microencapsulation technology, engineered cells containing an insulin expression system stimulated by non-natural amino acids are transplanted into diabetic model mice. When mice are directly gavaged with non-natural amino acids or stimulated by consuming non-natural amino acid "biscuits", the gene translation system can be activated to express insulin, thereby achieving the purpose of lowering blood sugar and treating diabetes.

[0034] (5) The multifunctional expression platform of the present invention is applied to the treatment of diabetes. It has a significant hypoglycemic effect within 90 minutes after treatment. Therefore, it can be determined that the hypoglycemic effect of the non-natural amino acid regulation system is not caused by simply administering non-natural amino acids by gavage. Attached Figure Description

[0035] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0036] Figure 1 A schematic diagram illustrating the principle of gene translation systems and regulatory methods regulated by non-natural amino acids;

[0037] Figure 2 This study demonstrates the optimization of a gene translation system regulated by non-natural amino acids, specifically the experimental results of combining expression vectors of tyrosine tRNA synthetase / tRNA molecules with target gene elements at four different ectopic amber codon insertion sites.

[0038] Figure 3 This study demonstrates the optimization of a gene translation system regulated by non-natural amino acids, specifically the experimental results of combining expression vectors of pyrrolidone tRNA synthetase / tRNA molecules with target gene elements at four different ectopic amber codon insertion sites.

[0039] Figure 4 This study investigates the expression rate characteristics of gene translation systems regulated by non-natural amino acids, specifically comparing the expression rates of target proteins in the translation regulatory system composed of tyrosine tRNA synthetase / tRNA and SEAP (V27TAG) with those in the transcription regulatory system TetOne.

[0040] Figure 5 This study investigates the stimulation signal contact time characteristics of gene translation systems regulated by non-natural amino acids, specifically comparing the stimulation signal contact time required for the translation regulatory system composed of tyrosine tRNA synthetase / tRNA and V27TAG with the transcription regulatory system TetOne to activate and express the target protein.

[0041] Figure 6 Experimental results demonstrating the reversible expression characteristics of gene translation systems regulated by non-natural amino acids;

[0042] Figure 7 This study demonstrates the compatibility of gene translation systems regulated by non-natural amino acids with transcriptional regulatory systems. Specifically, it presents the results of experiments that optimized the combination of expression vectors containing tyrosine tRNA synthetase / tRNA molecules with transcription factor tTA elements at six different ectopic amber codon insertion sites.

[0043] Figure 8 Experimental results show the workings of the transcription-translation binding regulatory system and logical operations using non-natural amino acids and doxycycline as dual input signals;

[0044] Figure 9This study presents the optimization of a non-natural amino acid-regulated gene translation system in HEK293T cells, specifically the results of optimizing the combination of tyrosine tRNA synthetase / tRNA expression vectors with insulin gene elements at six different ectopic amber codon insertion sites.

[0045] Figure 10 The results of the SEAP expression assay were shown for stable cell lines containing gene translation systems regulated by non-natural amino acids.

[0046] Figure 11 The results of screening and measuring insulin expression in stable cell lines containing gene translation systems regulated by non-natural amino acids are presented.

[0047] Figure 12 This study presents the experimental results of regulating the expression of the reporter gene SEAP in wild-type mice using a non-natural amino acid-regulated gene translation system via microcapsule-encapsulated cell transplantation.

[0048] Figure 13 This study demonstrates the experimental results of regulating the expression of the reporter gene SEAP in wild-type mice using a non-natural amino acid-regulated gene translation system via hollow fiber tube-embedded cell transplantation.

[0049] Figure 14 This study demonstrates the experimental results of how non-natural amino acids induce the insulin expression system to regulate insulin expression during the treatment of type 1 diabetes.

[0050] Figure 15 This study demonstrates experimental results showing how non-natural amino acids induce the insulin expression system to lower blood glucose levels during the treatment of type 1 diabetes.

[0051] Figure 16 Experimental results demonstrating the effect of non-natural amino acid-induced insulin expression systems on glucose tolerance during the treatment of type 1 diabetes;

[0052] Figure 17 The experimental results show that a non-natural amino acid-induced insulin expression system rapidly reduces blood glucose in type 1 diabetic mice;

[0053] Figure 18 This study presents the results of a long-term study on the regulation of insulin expression by the non-natural amino acid-induced insulin expression system during the treatment of type 1 diabetes.

[0054] Figure 19 This study demonstrates the hypoglycemic effects of a long-term research on the regulation of insulin expression by the non-natural amino acid-induced insulin expression system during the treatment of type 1 diabetes.

[0055] Figure 20This study presents experimental results on glucose tolerance in the long-term treatment of type 1 diabetes using a non-natural amino acid-induced insulin expression system. Detailed Implementation

[0056] This invention discloses a gene translation system regulated by non-natural amino acids and its applications. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0057] This invention provides a multifunctional gene expression platform regulated by a gene translation system controlled by non-natural amino acids. The platform is based on a gene translation system regulated by non-natural amino acids, which precisely regulates protein translation by non-natural amino acids. This platform is applied to diabetes treatment and biocomputing.

[0058] The non-natural amino acid-regulated gene translation system described in this invention consists of three parts: aminoacyl-tRNA synthetase (aaRS), orthogonal tRNA molecules, and the target gene sequence containing a stop codon in the reading frame.

[0059] In this gene translation system, the aminoacyl-tRNA synthetase and the orthogonal tRNA molecular pair can be tyrosine aminoacyl-tRNA synthetase and the orthogonal tRNA molecular pair. The non-natural amino acid used in the tyrosine aminoacyl-tRNA synthetase and the orthogonal tRNA molecular pair can be O-methyl-tyrosine (OmeY).

[0060] In this gene translation system, the aminoacyl-tRNA synthetase and the orthogonal tRNA molecular pair can be a pyrrolyl-lysine aminoacyl-tRNA synthetase and the orthogonal tRNA molecular pair. The non-natural amino acid used in the pyrrolyl-lysine aminoacyl-tRNA synthetase and the orthogonal tRNA molecular pair can be Nε-(tert-butoxycarbonyl)-L-lysine (N-ε-((tert-butoxy)carbonyl)-l-lysine, BocK).

[0061] The target protein in the gene translation system can be a single protein reporter gene such as secretory alkaline phosphatase; preferably, the stop codon introduction site in the reading frame of the secretory alkaline phosphatase can be SEAP(V2TAG), SEAP(L22TAG), SEAP(V27TAG), or SEAP(Q50TAG).

[0062] The target protein in the gene translation system can be a single protein transcription factor tTA; preferably, the stop codon introduction site in the reading frame of the transcription factor tTA can be tTA(L4TAG), tTA(S7TAG), tTA(K46TAG), tTA(E71TAG), tTA(Y110TAG), or tTA(E159TAG).

[0063] The target protein in the gene translation system can be a single drug protein, insulin (INS); preferably, the stop codon introduction site in the reading frame of the insulin can be INS(L4TAG), INS(F7TAG), INS(Q23TAG), INS(E64TAG), or INS(L66TAG).

[0064] The target protein in the gene translation system can also be a gene sequence that encodes both a reporter gene and a functional protein, such as SEAP(V27TAG)-P2A-INS(F7TAG).

[0065] The non-natural amino acid-regulated gene translation system is loaded with an artificially designed and synthesized dual plasmid system, and the sequences involved in the dual plasmid system are detailed in Appendix Table 1.

[0066] In this invention, the regulation of the gene translation system regulated by non-natural amino acids in vivo can be achieved by oral ingestion of non-natural amino acids, mainly including: a) gavage administration of non-natural amino acids; b) feeding non-natural amino acid "biscuits".

[0067] The present invention also provides an application of the non-natural amino acid-regulated gene translation system in the induction of gene expression.

[0068] This invention also provides a method for regulating gene expression induced by non-natural amino acids, wherein the method is regulated by a gene translation system regulated by non-natural amino acids. The regulation mechanism by which the gene expression is induced by the gene translation system regulated by non-natural amino acids is as follows: Figure 1As shown. When non-natural amino acids are absent, the aminoacyl-tRNA synthetase cannot catalyze orthogonal tRNA, and the orthogonal tRNA cannot bind to the stop codon in the reading frame of the target protein gene, thus terminating the translation of the target protein gene. However, when non-natural amino acids are present, the aminoacyl-tRNA synthetase can catalyze the formation of non-natural amino acid acylated tRNA from orthogonal tRNA and non-natural amino acids. The non-natural amino acid acylated tRNA recognizes the stop codon in the reading frame of the target protein gene, initiating the translation of the target protein gene.

[0069] This invention also provides a eukaryotic expression vector containing a gene translation system regulated by non-natural amino acids.

[0070] The present invention also provides engineered cells containing a gene translation system regulated by non-natural amino acids; wherein the engineered cells are animal cell lines, such as HEK293T.

[0071] This invention also provides a hollow fiber tube, which encapsulates the non-natural amino acid-regulated gene translation system or the engineered cells containing the non-natural amino acid-regulated gene translation system. The hollow fiber tube is a semi-permeable membrane formed of polyvinylidene fluoride (PVDF), allowing free permeation of small molecules, such as nutrients and inducers of cell growth (non-natural amino acids), while blocking the free permeation of large proteins greater than 50 kDa, such as immunoglobulins and albumin. The characteristics of the hollow fiber tube ensure normal cell growth within it while cleverly avoiding attacks from the body's immune system. Furthermore, the hollow fiber tube ensures that effector molecules or proteins produced by the cells can be secreted outside the hollow fiber tube to perform their functions.

[0072] In this invention, the engineered cells containing the gene translation system regulated by non-natural amino acids can be embedded in hollow fiber tubes and then transplanted into the peritoneal cavity of mice. When non-natural amino acids are administered by gavage, the protein translation of the reporter gene can be dose-dependently regulated.

[0073] This invention also provides a microcapsule that encapsulates the non-natural amino acid-regulated gene translation system or the engineered cell, wherein the microcapsule contains the engineered cell of the non-natural amino acid-regulated gene translation system. The microcapsule is a semi-permeable membrane formed by alginate-polylysine-alginate, which allows free permeation of small molecules, such as nutrients and inducers of cell growth, while blocking the free permeation of large proteins greater than 75kD, such as immunoglobulins and albumin. The characteristics of the microcapsule ensure normal cell growth within the capsule while cleverly avoiding attacks from the body's immune system. Furthermore, the capsule also ensures that effector molecules or proteins produced by the cells can be secreted outside the capsule to perform their functions.

[0074] In this invention, the engineered cells containing the gene translation system regulated by non-natural amino acids can be encapsulated into microcapsules and then transplanted into the peritoneal cavity of mice. When non-natural amino acids are administered by gavage, the protein translation of the reporter gene can be dose-dependently regulated.

[0075] This invention also provides the application of a multifunctional gene expression platform regulated by non-natural amino acids, a gene translation system regulated by the non-natural amino acids, a eukaryotic expression vector, engineered cells, or microcapsules in the treatment of diabetes. The application in diabetes treatment is achieved by stimulating the gene translation system regulated by non-natural amino acids through gavage or by consuming non-natural amino acid "biscuits" to express insulin (by modifying the gene translation system regulated by non-natural amino acids to stimulate insulin production through gavage or consumption of non-natural amino acid "biscuits"; that is, the treatment method utilizes the gene translation system regulated by non-natural amino acids to precisely regulate insulin expression for the treatment of diabetes). The multifunctional platform can precisely regulate the expression and release of insulin for the treatment of diabetes.

[0076] The present invention also provides a method for regulating blood glucose in mice using the aforementioned non-natural amino acid-regulated multifunctional gene expression platform, the method comprising the following steps:

[0077] a) Artificially constructed mammalian cell expression vectors containing non-natural amino acid-stimulated insulin expression regulation systems;

[0078] b) Prepare engineered cells containing a non-natural amino acid-stimulated insulin expression regulation system;

[0079] c) Prepare microcapsules that encapsulate engineered cells that stimulate insulin expression regulation systems with non-natural amino acids.

[0080] d) The microcapsules were implanted into diabetic model mice via intraperitoneal injection;

[0081] e) In mice, insulin is stimulated by gavage with non-natural amino acids or by feeding them non-natural amino acid "biscuits," and then released into the bloodstream to lower blood sugar.

[0082] This invention also provides a novel method for treating diabetes, which achieves blood sugar reduction by using the non-natural amino acid-regulated multifunctional gene expression platform, the non-natural amino acid-regulated gene translation system, the eukaryotic expression vector, the engineered cells, or the microcapsules, through oral administration of non-natural amino acids or by consuming non-natural amino acid "biscuits".

[0083] The non-natural amino acid-regulated multifunctional gene expression platform, the non-natural amino acid-regulated gene translation system, the eukaryotic expression vector, the engineered cells, or the microcapsules described in this invention can also be used to treat other diseases, that is, to achieve the treatment of different diseases by expressing drug proteins with different therapeutic functions.

[0084] This invention also provides a multifunctional gene expression platform regulated by non-natural amino acids, a gene translation system regulated by the non-natural amino acids, a eukaryotic expression vector, and the application of the engineered cells in biological computing, which can be used to construct complex biological computers; the application of the biological computer is achieved by synthesizing a set of logic gates with dual input signals of non-natural amino acids and doxycycline; wherein the logic operation is A excluding B (ANIMPLY B).

[0085] In the logical operation where A does not include B (ANIMPLY B), the SEAP signal is only output when signal A is not a natural amino acid input and signal B is not doxycycline input.

[0086] The gene translation systems regulated by non-natural amino acids described in this invention all possess fine-tuning and reversible expression kinetic characteristics. Fine-tuning refers to the precise regulation of downstream gene expression by non-natural amino acids, exhibiting a dose-dependent relationship; reversibility means that the entire process of non-natural amino acid-regulated gene expression is reversible, and gene expression can be turned on or off by controlling the presence or absence of non-natural amino acids.

[0087] The beneficial effects of this invention are as follows: (1) This invention is the first to artificially design and synthesize a gene translation system regulated by non-natural amino acids. All of these systems can be uploaded into mammalian cells and execute corresponding instructions, and achieve spatiotemporally controllable transgenic expression by regulating non-natural amino acids. (2) The gene translation system regulated by non-natural amino acids designed in this invention is a translation level regulation system, which has a faster target protein expression rate compared to existing transcriptional gene switches. (3) The stimulant non-natural amino acids used in this invention are chemically synthesized substances that cannot be synthesized in the natural environment or in vivo. Compared to existing gene switch systems, they have better orthogonality, and non-natural amino acids have similar structures to natural amino acids and similar pharmacokinetic properties. Therefore, gene expression in vivo can be regulated by making non-natural amino acid "biscuits". (4) This invention synthesizes a multifunctional gene expression platform regulated by non-natural amino acids. This regulatory platform can be used for disease treatment and biocomputers. It is a new method for treating diabetes by stimulating insulin expression through gavage with non-natural amino acids or by consuming non-natural amino acid "biscuits". Using microencapsulation technology, engineered cells containing an insulin expression system stimulated by non-natural amino acids are transplanted into diabetic model mice. When mice are directly gavaged with non-natural amino acids or stimulated by consuming non-natural amino acid "biscuits", the gene translation system can be activated to express insulin, thereby achieving the purpose of lowering blood sugar and treating diabetes. (5) The multifunctional expression platform of this invention is applied to the treatment of diabetes. It has a significant blood sugar lowering effect within 90 minutes after treatment. Therefore, it can be determined that the blood sugar lowering effect of the non-natural amino acid regulatory system is not caused by simply gavage with non-natural amino acids.

[0088] The raw materials and reagents used in the non-natural amino acid-regulated gene translation system and its application provided by this invention are all commercially available.

[0089] The present invention will be further illustrated below with reference to the embodiments:

[0090] Example 1: Construction of a non-natural amino acid-regulated switching system

[0091] This embodiment includes the construction method of plasmid vectors involved in non-natural amino acid-regulated switching systems, but does not cover...

[0092] The scope of protection of this invention is defined. Detailed design schemes and steps are shown in Table 1.

[0093] Table 1

[0094]

[0095]

[0096] TyrRS sequence: as shown in SEQ ID No. 1

[0097]

[0098] TyrtRNA sequence: as shown in SEQ ID No.2

[0099] AAAAAATGGTGGGGGACGGATTCGAACCGCCGAACCCAAAGGGAGCGGATTTAGAGTCCGCCGCGTTTAGCCACTTCGCTACCCCACCGGATCCGAGTGGTCTCATACAGAACTTATAAGATTCCCAAATCCAAAGACATTTCACGTTTATGGTGATTTCCCAGAACACATAGCGACATGCAAAT

[0100] PylRS sequence: as shown in SEQ ID No.3

[0101]

[0102] PyltRNA sequence: as shown in SEQ ID No. 4

[0103] AAAAAATGGTGGGGGACGGATTCGAACCGCCGAACCCAAAGGGAGCGGATTTAGA

[0104] GTCCGCCGCGTTTAGCCACTTCGCTACCCCACCGGATCCGAGTGGTCTCATACAGAACTTATAAGATTCCCAAATCCAAAGACATTTCACGTTTATGGTGATTTCCCAGAACACATAGCGACATGCAAAT

[0105] SEAP (V2) sequence: as shown in SEQ ID No. 5

[0106]

[0107] SEAP(L22) sequence: as shown in SEQ ID No. 6

[0108]

[0109] SEAP(V27) sequence: as shown in SEQ ID No. 7

[0110]

[0111] SEAP(Q50) sequence: as shown in SEQ ID No. 8

[0112]

[0113] SEAP sequence: as shown in SEQ ID No. 9

[0114]

[0115] The tTA (L4TAG) sequence: as shown in SEQ ID No. 10

[0116] ATGTCTAGATAGGACAAGAGCAAAGTCATAAACTCTGCTCTGGAATTACTCAATGAAGTCGGTATCGAAGGCCTGACGACAAGGAAACTCGCTCAAAAGCTGGGAGTTGAGCAGCCTACCCTGTACTGGCACGTGAAGAACAAGCGGGCCCTGCTCGATGCCCTGGCAATCGAGATGCTGGACAGGCATCATACCCACTTCTGCCCCCTGGAAGGCGAGTCATGGCAAGACTTTCTGCGGAACAACGCCAAGTCATTCCGCTGTGCTCTCCTCTCACATCGCGACGGGGCTAAAGTGCATCTCGGCACCCGCCCAACAGAGAAACAGTACGAAACCCTGGAAAATCAGCTCGCGTTCCTGTGTCAGCAAGGCTTCTCCCTGGAGAACGCACTGTACGCTCTGTCCGCCGTGGGCCACTTTACACTGGGCTGCGTATTGGAGGATCAGGAGCATCAAGTAGCAAAAGAGGAAAGAGAGACACCTACCACCGATTCTATGCCCCCACTTCTGAGACAAGCAATTGAGCTGTTCGACCATCAGGGAGCCGAACCTGCCTTCCTTTTCGGCCTGGAACTAATCATATGTGGCCTGGAGAAACAGCTAAAGTGCGAAAGCGGCGGGCCGGCCGACGCCCTTGACGATTTTGACTTAGACATGCTCCCAGCCGATGCCCTTGACGACTTTGACCTTGATATGCTGCCTGCTGACGCTCTTGACGATTTTGACCTTGACATGCTCCCCGGGTAA

[0117] The tTA (S7TAG) sequence: as shown in SEQ ID No. 11

[0118] ATGTCTAGACTGGACAAGTAGAAAGTCATAAACTCTGCTCTGGAATTACTCAATGAAGTCGGTATCGAAGGCCTGACGACAAGGAAACTCGCTCAAAAGCTGGGAGTTGAGCAGCCTACCCTGTACTGGCACGTGAAGAACAAGCGGGCCCTGCTCGATGCCCTGGCAATCGAGATGCTGGACAGGCATCATACCCACTTCTGCCCCCTGGAAGGCGAGTCATGGCAAGACTTTCTGCGGAACAACGCCAAGTCATTCCGCTGTGCTCTCCTCTCACATCGCGACGGGGCTAAAGTGCATCTCGGCACCCGCCCAACAGAGAAACAGTACGAAACCCTGGAAAATCAGCTCGCGTTCCTGTGTCAGCAAGGCTTCTCCCTGGAGAACGCACTGTACGCTCTGTCCGCCGTGGGCCACTTTACACTGGGCTGCGTATTGGAGGATCAGGAGCATCAAGTAGCAAAAGAGGAAAGAGAGACACCTACCACCGATTCTATGCCCCCACTTCTGAGACAAGCAATTGAGCTGTTCGACCATCAGGGAGCCGAACCTGCCTTCCTTTTCGGCCTGGAACTAATCATATGTGGCCTGGAGAAACAGCTAAAGTGCGAAAGCGGCGGGCCGGCCGACGCCCTTGACGATTTTGACTTAGACATGCTCCCAGCCGATGCCCTTGACGACTTTGACCTTGATATGCTGCCTGCTGACGCTCTTGACGATTTTGACCTTGACATGCTCCCCGGGTAA

[0119] tTA (K46TAG) sequence: as shown in SEQ ID No. 12

[0120] ATGTCTAGACTGGACAAGAGCAAAGTCATAAACTCTGCTCTGGAATTACTCAATGAAGTCGGTATCGAAGGCCTGACGACAAGGAAACTCGCTCAAAAGCTGGGAGTTGAGCAGCCTACCCTGTACTGGCACGTGTAGAACAAGCGGGCCCTGCTCGATGCCCTGGCAATCGAGATGCTGGACAGGCATCATACCCACTTCTGCCCCCTGGAAGGCGAGTCATGGCAAGACTTTCTGCGGAACAACGCCAAGTCATTCCGCTGTGCTCTCCTCTCACATCGCGACGGGGCTAAAGTGCATCTCGGCACCCGCCCAACAGAGAAACAGTACGAAACCCTGGAAAATCAGCTCGCGTTCCTGTGTCAGCAAGGCTTCTCCCTGGAGAACGCACTGTACGCTCTGTCCGCCGTGGGCCACTTTACACTGGGCTGCGTATTGGAGGATCAGGAGCATCAAGTAGCAAAAGAGGAAAGAGAGACACCTACCACCGATTCTATGCCCCCACTTCTGAGACAAGCAATTGAGCTGTTCGACCATCAGGGAGCCGAACCTGCCTTCCTTTTCGGCCTGGAACTAATCATATGTGGCCTGGAGAAACAGCTAAAGTGCGAAAGCGGCGGGCCGGCCGACGCCCTTGACGATTTTGACTTAGACATGCTCCCAGCCGATGCCCTTGACGACTTTGACCTTGATATGCTGCCTGCTGACGCTCTTGACGATTTTGACCTTGACATGCTCCCCGGGTAA

[0121] The tTA (E71TAG) sequence: as shown in SEQ ID No. 13

[0122] ATGTCTAGACTGGACAAGAGCAAAGTCATAAACTCTGCTCTGGAATTACTCAATGAAGTCGGTATCGAAGGCCTGACGACAAGGAAACTCGCTCAAAAGCTGGGAGTTGAGCAGCCTACCCTGTACTGGCACGTGAAGAACAAGCGGGCCCTGCTCGATGCCCTGGCAATCGAGATGCTGGACAGGCATCATACCCACTTCTGCCCCCTGTAGGGCGAGTCATGGCAAGACTTTCTGCGGAACAACGCCAAGTCATTCCGCTGTGCTCTCCTCTCACATCGCGACGGGGCTAAAGTGCATCTCGGCACCCGCCCAACAGAGAAACAGTACGAAACCCTGGAAAATCAGCTCGCGTTCCTGTGTCAGCAAGGCTTCTCCCTGGAGAACGCACTGTACGCTCTGTCCGCCGTGGGCCACTTTACACTGGGCTGCGTATTGGAGGATCAGGAGCATCAAGTAGCAAAAGAGGAAAGAGAGACACCTACCACCGATTCTATGCCCCCACTTCTGAGACAAGCAATTGAGCTGTTCGACCATCAGGGAGCCGAACCTGCCTTCCTTTTCGGCCTGGAACTAATCATATGTGGCCTGGAGAAACAGCTAAAGTGCGAAAGCGGCGGGCCGGCCGACGCCCTTGACGATTTTGACTTAGACATGCTCCCAGCCGATGCCCTTGACGACTTTGACCTTGATATGCTGCCTGCTGACGCTCTTGACGATTTTGACCTTGACATGCTCCCCGGGTAA

[0123] tTA (Y110TAG) sequence: as shown in SEQ ID No. 14

[0124] ATGTCTAGACTGGACAAGAGCAAAGTCATAAACTCTGCTCTGGAATTACTCAATGAAGTCGGTATCGAAGGCCTGACGACAAGGAAACTCGCTCAAAAGCTGGGAGTTGAGCAGCCTACCCTGTACTGGCACGTGAAGAACAAGCGGGCCCTGCTCGATGCCCTGGCAATCGAGATGCTGGACAGGCATCATACCCACTTCTGCCCCCTGGAAGGCGAGTCATGGCAAGACTTTCTGCGGAACAACGCCAAGTCATTCCGCTGTGCTCTCCTCTCACATCGCGACGGGGCTAAAGTGCATCTCGGCACCCGCCCAACAGAGAAACAGTAGGAAACCCTGGAAAATCAGCTCGCGTTCCTGTGTCAGCAAGGCTTCTCCCTGGAGAACGCACTGTACGCTCTGTCCGCCGTGGGCCACTTTACACTGGGCTGCGTATTGGAGGATCAGGAGCATCAAGTAGCAAAAGAGGAAAGAGAGACACCTACCACCGATTCTATGCCCCCACTTCTGAGACAAGCAATTGAGCTGTTCGACCATCAGGGAGCCGAACCTGCCTTCCTTTTCGGCCTGGAACTAATCATATGTGGCCTGGAGAAACAGCTAAAGTGCGAAAGCGGCGGGCCGGCCGACGCCCTTGACGATTTTGACTTAGACATGCTCCCAGCCGATGCCCTTGACGACTTTGACCTTGATATGCTGCCTGCTGACGCTCTTGACGATTTTGACCTTGACATGCTCCCCGGGTAA

[0125] The tTA (E159TAG) sequence: as shown in SEQ ID No. 15

[0126] ATGTCTAGACTGGACAAGAGCAAAGTCATAAACTCTGCTCTGGAATTACTCAATGAAGTCGGTATCGAAGGCCTGACGACAAGGAAACTCGCTCAAAAGCTGGGAGTTGAGCAGCCTACCCTGTACTGGCACGTGAAGAACAAGCGGGCCCTGCTCGATGCCCTGGCAATCGAGATGCTGGACAGGCATCATACCCACTTCTGCCCCCTGGAAGGCGAGTCATGGCAAGACTTTCTGCGGAACAACGCCAAGTCATTCCGCTGTGCTCTCCTCTCACATCGCGACGGGGCTAAAGTGCATCTCGGCACCCGCCCAACAGAGAAACAGTACGAAACCCTGGAAAATCAGCTCGCGTTCCTGTGTCAGCAAGGCTTCTCCCTGGAGAACGCACTGTACGCTCTGTCCGCCGTGGGCCACTTTACACTGGGCTGCGTATTGGAGGATCAGGAGCATCAAGTAGCAAAAGAGGAAAGATAGACACCTACCACCGATTCTATGCCCCCACTTCTGAGACAAGCAATTGAGCTGTTCGACCATCAGGGAGCCGAACCTGCCTTCCTTTTCGGCCTGGAACTAATCATATGTGGCCTGGAGAAACAGCTAAAGTGCGAAAGCGGCGGGCCGGCCGACGCCCTTGACGATTTTGACTTAGACATGCTCCCAGCCGATGCCCTTGACGACTTTGACCTTGATATGCTGCCTGCTGACGCTCTTGACGATTTTGACCTTGACATGCTCCCCGGGTAA

[0127] INS(L4TAG) sequence: as shown in SEQ ID No. 16

[0128] ATGGCCCTGTAGGTGCACTTCCTGCCACTGCTGGCCCTGCTGGCCCTGTGGGAGCCAAAGCCAACCCAGGCCTTTGTGAAGCAGCACCTGTGCGGACCACACCTGGTGGAGGCCCTGTACCTGGTGTGCGGAGAGAGGGGCTTCTTTTATACACCCAAGAGCCGGAGAAAGAGGGAGGACCCTCAGGTGGAGCAGCTGGAGCTGGGAGGTTCCCCTGGCGATCTGCAGACCCTGGCCCTGGAGGTGGCAAGGCAGAAGAGGGGCATCGTGGACCAGTGCTGTACAAGCATCTGCTCCCTGTACCAGCTGGAGAACTATTGTAATTGA

[0129] INS(F7TAG) sequence: as shown in SEQ ID No.17

[0130] CCCATGGCCCTGTGGATGCGCTAGCTGCCCCTGCTGGCCCTGCTCGTCCTCTGGGAGCCCAAGCCTGCCCAGGCTTTTGTCAAACAGCACCTTTGTGGTCCTCACCTGGTGGAGGCTCTGTACCTGGTGTGTGGGGAACGTGGTTTCTTCTACACACCCAAGTCCCGTCGTAAAAGGGAGGACCCGCAAGTGCCACAACTGGAGCTGGGTGGAGGCCCGGAGGCCGGGGATCTTCAGACCTTGGCACTGGAGGTTGCCCGGCAGAAGCGTGGCATTGTGGATCAGTGCTGCACCAGCATCTGCTCCCTCTACCAACTGGAGAACTACTGCAACTGA

[0131] INS(Q23TAG) sequence: as shown in SEQ ID No.18

[0132] ATGGCCCTGCTGGTGCACTTCCTGCCACTGCTGGCCCTGCTGGCCCTGTGGGAGCCAAAGCCAACCTAGGCCTTTGTGAAGCAGCACCTGTGCGGACCACACCTGGTGGAGGCCCTGTACCTGGTGTGCGGAGAGAGGGGCTTCTTTTATACACCCAAGAGCCGGAGAAAGAGGGAGGACCCTCAGGTGGAGCAGCTGGAGCTGGGAGGTTCCCCTGGCGATCTGCAGACCCTGGCCCTGGAGGTGGCAAGGCAGAAGAGGGGCATCGTGGACCAGTGCTGTACAAGCATCTGCTCCCTGTACCAGCTGGAGAACTATTGTAATTGA

[0133] INS(E64TAG) sequence: as shown in SEQ ID No.19

[0134] ATGGCCCTGCTGGTGCACTTCCTGCCACTGCTGGCCCTGCTGGCCCTGTGGGAGCCAAAGCCAACCCAGGCCTTTGTGAAGCAGCACCTGTGCGGACCACACCTGGTGGAGGCCCTGTACCTGGTGTGCGGAGAGAGGGGCTTCTTTTATACACCCAAGAGCCGGAGAAAGAGGGAGGACCCTCAGGTGTAGCAGCTGGAGCTGGGAGGTTCCCCTGGCGATCTGCAGACCCTGGCCCTGGAGGTGGCAAGGCAGAAGAGGGGCATCGTGGACCAGTGCTGTACAAGCATCTGCTCCCTGTACCAGCTGGAGAACTATTGTAATTGA

[0135] INS(L66TAG) sequence: as shown in SEQ ID No.20

[0136] ATGGCCCTGCTGGTGCACTTCCTGCCACTGCTGGCCCTGCTGGCCCTGTGGGAGCCAAAGCCAACCCAGGCCTTTGTGAAGCAGCACCTGTGCGGACCACACCTGGTGGAGGCCCTGTACCTGGTGTGCGGAGAGAGGGGCTTCTTTTATACACCCAAGAGCCGGAGAAAGAGGGAGGACCCTCAGGTGGAGCAGTAGGAGCTGGGAGGTTCCCCTGGCGATCTGCAGACCCTGGCCCTGGAGGTGGCAAGGCAGAAGAGGGGCATCGTGGACCAGTGCTGTACAAGCATCTGCTCCCTGTACCAGCTGGAGAACTATTGTAATTGA

[0137] SEAP (V27TAG)-INS (F7TAG) sequence: as shown in SEQ ID No. 21

[0138]

[0139] Example 2: Optimization study of a non-natural amino acid-regulated gene translation system in HEK293T cells, namely, the optimization of the combination of expression vectors of tyrosine tRNA synthetase / tRNA molecules with target gene elements at four different ectopic amber codon insertion sites.

[0140] The first step is plasmid construction. See Table 1 for details of plasmid construction in this example.

[0141] The second step is cell seeding. One day before transfection, HEK293T cells were seeded into 24-well plates at a rate of 1×10^5 cells per well, and 500 μl of DMEM medium containing 10% FBS was added to each well.

[0142] The third step is plasmid transfection. The transfection system in this example can be divided into four groups: TyrRS / tRNA and SEAP (V2TAG), TyrRS / tRNA and SEAP (L22TAG), TyrRS / tRNA and SEAP (V27TAG), and TyrRS / tRNA and SEAP (Q50TAG). Each group of plasmids was premixed with the transfection reagent PEI (plasmid to PEI mass ratio 1:3) at a total volume of 800 ng in 50 μl of Opti-MEM. After standing for 15 minutes, the DNA-PEI premix was added dropwise to each well of the cells.

[0143] Step 4: Add non-natural amino acids. Four hours after transfection, remove the original culture medium. Add fresh culture medium containing 1 mM of the non-natural amino acid O-methyl-tyrosine (OmeY) or without OmeY to each group.

[0144] Step 5: Detect the expression level of the reporter gene SEAP. After 48 hours, cell supernatant was collected and heated in a 65°C oven for 30 minutes to remove endogenous alkaline phosphatase. Then, the detection working solution was premixed at a ratio of 100 μl of 2x buffer and 20 μl of pNPP substrate per well and preheated at 37°C. After heating the cell supernatant for 30 minutes, 80 μl of the supernatant was transferred to a 96-well plate, and 120 μl of the premixed detection working solution was added. The plate was then quickly placed on a microplate reader, and the absorbance of the sample was detected at 405 nm (10 consecutive tests, with a 1-minute interval between each test). Finally, the slope of the curve was calculated by plotting the detection time on the x-axis and the corresponding absorbance value on the y-axis. The formula for calculating enzyme activity is: Enzyme activity = Slope of curve x 256.8 (unit: U / L).

[0145] Experimental results (see) Figure 2The results showed that different ectopic amber codon insertion sites of the above-mentioned non-natural amino acid-regulated gene translation system could activate the expression of the reporter gene SEAP, but the induction effects produced by the systems were different. Among them, SEAP (V27TAG) had the best signal-to-noise ratio.

[0146] Example 3: Optimization study of a non-natural amino acid-regulated gene translation system in HEK293T cells, namely, the optimization of the combination of expression vectors of pyrrolidone tRNA synthetase / tRNA molecules with target gene elements at four different ectopic amber codon insertion sites.

[0147] The first step is plasmid construction. See Table 1 for details of plasmid construction in this example.

[0148] The second step is cell seeding (the specific steps are the same as in Example 2).

[0149] The third step is plasmid transfection. The transfection system in this example can be divided into four groups: PylRS / tRNA and SEAP (V2TAG), PylRS / tRNA and SEAP (L22TAG), PylRS / tRNA and SEAP (V27TAG), and PylRS / tRNA and SEAP (Q50TAG). Each group of plasmids was premixed with the transfection reagent PEI (plasmid to PEI mass ratio 1:3) at a total volume of 800 ng in 50 μl of Opti-MEM. After standing for 15 minutes, the DNA-PEI premix was added dropwise to each well of the cells.

[0150] Step 4: Add non-natural amino acids. Four hours after transfection, remove the original culture medium. Add fresh culture medium containing 1 mM of the non-natural amino acid N-ε-((tert-butoxy)carbonyl)-l-lysine (BocK) or without BocK to each group.

[0151] The fifth step is to detect the expression level of the reporter gene SEAP (the specific steps are the same as in Example 2).

[0152] Experimental results (see) Figure 3 The results showed that different ectopic amber codon insertion sites of the above-mentioned non-natural amino acid-regulated gene translation system could activate the expression of the reporter gene SEAP, but the induction effects produced by the systems were different. Among them, SEAP (V27TAG) had the best signal-to-noise ratio.

[0153] Example 4: Study on the expression rate characteristics of a gene translation system regulated by non-natural amino acids, i.e., comparing the expression rate of the target protein in the translation regulation system composed of tyrosine tRNA synthetase RS / tRNA and SEAP (V27TAG) with that in the transcription regulation system TetOne.

[0154] The first step is cell seeding (the specific steps are the same as in Example 2).

[0155] The second step is plasmid transfection. The transfection system in this example consists of two groups: TyrRS / tRNA and V27TAG, pLVX-TetOne-SEAP. The plasmid, in a total volume of 800 ng, is premixed with the transfection reagent PEI (plasmid to PEI mass ratio 1:3) in 50 μl of Opti-MEM. After standing for 15 minutes, the DNA-PEI premix is ​​added dropwise to each well of the cells.

[0156] The third step involves introducing a stimulation signal. 24 hours after transfection, the original culture medium is removed. Fresh culture medium containing 1 mM of the non-natural amino acid OmeY or without OmeY is added to the translation regulation system group. Fresh culture medium containing 1 mM of the inducer doxycycline (Dox) or without Dox is added to the transcription regulation system group.

[0157] The fourth step is to detect the expression level of the reporter gene SEAP (the specific steps are the same as in Example 2).

[0158] Experimental results (see) Figure 4 The results showed that gene translation systems regulated by non-natural amino acids expressed the target protein at a faster rate than transcriptionally regulated systems.

[0159] Example 5: Study on the stimulation signal contact time characteristics of a gene translation system regulated by non-natural amino acids, i.e., comparing the stimulation signal contact time required for the translation regulation system composed of tyrosine tRNA synthetase / tRNA and V27TAG with the transcription regulation system TetOne to activate the expression of the target protein.

[0160] The first step is cell seeding (the specific steps are the same as in Example 2).

[0161] The second step is plasmid transfection (the specific steps are the same as in Example 4).

[0162] The third step involves introducing the stimulation signal. 24 hours after transfection, the original culture medium was removed. Fresh culture medium containing 1 mM of the non-natural amino acid OmeY or without OmeY was added to the translation regulation system group. Fresh culture medium containing 1 mM of the inducer Dox or without Dox was added to the transcription regulation system group. The stimulation molecules were allowed to contact the cells for 1, 5, 30, and 180 minutes, respectively, before the culture medium was replaced with fresh medium. Samples were taken 48 hours later to detect the SEAP level in the culture medium.

[0163] The fifth step is to detect the expression level of the reporter gene SEAP (the specific steps are the same as in Example 2).

[0164] Experimental results (see) Figure 5 The results show that the stimulation signal contact time required for the gene translation system regulated by non-natural amino acids to activate the expression of the target protein is shorter than that required by the transcriptional regulatory system.

[0165] Example 6: Study on the reversible expression characteristics of a gene translation system regulated by non-natural amino acids.

[0166] The first step is cell seeding (the specific steps are the same as in Example 2).

[0167] The second step is plasmid transfection (the specific steps are the same as in Example 4).

[0168] The second step involved the following steps: On day 1, the "ON-OFF-ON" experimental group was supplemented with 1 mM of non-natural amino acids; on day 2, the original culture medium was removed and replaced with a medium containing no inducer; on day 3, the culture medium was replaced again with one containing 1 mM of non-natural amino acids. Simultaneously, cell supernatant was aspirated every 8 hours to detect the expression level of the reporter gene SEAP. The "OFF-ON-OFF" experimental group, on day 1, was supplemented with a medium containing no non-natural amino acids; on day 2, 1 mM of non-natural amino acids was added; on day 3, the culture medium was replaced again with one containing no inducer. Similarly, cell supernatant was aspirated every 8 hours to detect the expression level of the reporter gene SEAP (specific steps are the same as in Example 2).

[0169] Experimental results (see) Figure 6 This indicates that the presence or absence of non-natural amino acids can be controlled to turn gene expression on or off, demonstrating that the gene translation system regulated by non-natural amino acids has good reversibility.

[0170] Example 7: Compatibility study of non-natural amino acid-regulated gene translation system with transcriptional level regulatory system, namely, optimization of the combination of expression vectors of tyrosine tRNA synthetase / tRNA molecules with transcription factor tTA elements at 6 different ectopic amber codon insertion sites.

[0171] The first step is plasmid construction. See Table 1 for details of plasmid construction in this example.

[0172] The second step is cell seeding (the specific steps are the same as in Example 2).

[0173] The third step is plasmid transfection. The transfection system in this example consists of 10 groups: TyrRS / tRNA, TRE-SEAP, and tTA (L4TAG); TyrRS / tRNA, TRE-SEAP, and tTA (S7TAG); TyrRS / tRNA, TRE-SEAP, and tTA (K46TAG); TyrRS / tRNA, TRE-SEAP, and tTA (E71TAG); TyrRS / tRNA, TRE-SEAP, and tTA (Y110TAG); and TyrRS / tRNA, TRE-SEAP, and tTA (E159TAG). Each plasmid group was premixed with PEI transfection reagent (plasmid to PEI mass ratio 1:3) at a total volume of 800 ng in 50 μl of Opti-MEM at a ratio of 1:1:1. After standing for 15 minutes, the DNA-PEI premix was added dropwise to each well of the cells.

[0174] The fourth step is to add non-natural amino acids (the specific steps are the same as in Example 2).

[0175] The fifth step is to detect the expression level of the reporter gene SEAP (the specific steps are the same as in Example 2).

[0176] Experimental results (see) Figure 7 The study showed that different ectopic amber codon insertion sites in the non-natural amino acid-regulated gene translation system could activate the expression of transcription factor tTA, but the induction effects produced by the system varied. Among them, tTA (K46TAG) had the best signal-to-noise ratio. This indicates that a transcription-translation binding regulatory system can be formed, that is, the non-natural amino acid-regulated gene translation system can be compatible with the transcriptional level regulatory system.

[0177] Example 8: Study on the operation of a transcription-translation binding regulatory system and logical operation with non-natural amino acids and doxycycline as dual input signals.

[0178] The first step is plasmid construction. Details of plasmid construction in this example are shown in Table 1.

[0179] The second step is cell seeding (the specific steps are the same as in Example 2).

[0180] The third step is plasmid transfection. In this example, the transfection system used was tTA (K46TAG), pTRE-SEAP, and TyrRS / tRNA. The plasmid was premixed with the transfection reagent PEI (plasmid to PEI mass ratio 1:3) at a total volume of 800 ng in 50 μl of Opti-MEM at a ratio of 1:1:1. After standing for 15 minutes, the DNA-PEI premix was added dropwise to each well of the cells.

[0181] The fourth step is to add stimulating molecules. Four hours after transfection, fresh culture medium is replaced and different combinations of stimulating molecules are added. The combinations of inducers involved in the logic gate are divided into four types, including (1) no stimulating molecules are added, (2) only 1 mM of non-natural amino acids are added, (3) only 1 mM of Dox is added, and (4) both 1 mM of non-natural amino acids and 1 mM of Dox are added simultaneously.

[0182] The fifth step is to detect the expression level of the reporter gene SEAP (the specific steps are the same as in Example 2).

[0183] Experimental results (see) Figure 8 This indicates that in a transcription-translation binding regulatory system that can be regulated by two stimulatory molecules, the different outputs of SEAP in the above logic gate all conform to the corresponding input combinations, which means that the above logic gate can perform correct logical operations in the mammal HEK293T.

[0184] Example 9: Optimization study of a non-natural amino acid-regulated gene translation system in HEK293T cells, namely, optimization of the combination of expression vectors of tyrosine tRNA synthetase / tRNA molecules with insulin gene elements at 6 different ectopic amber codon insertion sites.

[0185] The first step is plasmid construction. See Table 1 for details of plasmid construction in this example.

[0186] The second step is cell seeding (the specific steps are the same as in Example 2).

[0187] The third step is plasmid transfection. The transfection system in this example consists of six groups: TyrRS / tRNA and INS (L4TAG), TyrRS / tRNA and INS (F7TAG), TyrRS / tRNA and INS (Q23TAG), TyrRS / tRNA and INS (E64TAG), and TyrRS / tRNA and INS (L66TAG). Each plasmid group was premixed with PEI transfection reagent (plasmid to PEI mass ratio 1:3) at a total volume of 800 ng in 50 μl of Opti-MEM at a 1:1 ratio. After standing for 15 minutes, the DNA-PEI premix was added dropwise to each well of the cell culture.

[0188] The fourth step is to add non-natural amino acids (the specific steps are the same as in Example 2).

[0189] The fifth step involves measuring insulin expression using an insulin ELISA kit (Mercodia AB; Cat.no.10-1247-01).

[0190] Experimental results (see) Figure 9The results showed that different ectopic amber codon insertion sites of the above-mentioned non-natural amino acid-regulated gene translation system could activate insulin expression, but the induction effects produced by the systems were different. Among them, INS(F7TAG) had the best signal-to-noise ratio.

[0191] Example 10: Screening and determination of stable cell lines containing gene translation systems regulated by non-natural amino acids.

[0192] The first step is plasmid construction. See Table 1 for details of plasmid construction in this example.

[0193] The second step is to seed HEK293T cells (the specific steps are the same as in Example 2).

[0194] The third step is plasmid transfection. The plasmid pSB-SEAP(V27TAG)-INS(F7TAG), pSB-OmeYRS-12tRNA, and transposase plasmid were premixed with the transfection reagent PEI (plasmid to PEI mass ratio 1:3) at a total volume of 200 ng in 5:5:1 and dissolved in 50 μl of Opti-MEM. After standing for 15 minutes, the DNA-PEI premix was added dropwise to each well of the cells.

[0195] The fourth step involves reseeding cells and adding antibiotics for selection. Four hours after transfection, cells from each well are digested with trypsin and reseeded in 10cm dishes, with 1 μg / ml puromycin and 100 μg / ml bleomycin added for selection. Two weeks later, single-clonal cell lines are selected for expansion in 24-well plates.

[0196] The fifth step is to verify the correctness of the monoclonal cell lines. Each expanded monoclonal cell line is seeded into a 24-well plate, with the experimental group receiving a 1 mM non-natural amino acid inducer. The expression level of the reporter gene SEAP is measured 48 hours after drug administration (specific steps are the same as in Example 2). Finally, the stable cell lines with good test results are expanded and preserved.

[0197] Step 6: Verify the insulin expression capacity of the monoclonal cell lines. The expanded monoclonal cell lines were seeded into 24-well plates, with the experimental group receiving 1 mM of a non-natural amino acid inducer. The expression level of the reporter gene insulin was measured 48 hours after drug administration (specific steps are the same as in Example 9).

[0198] Experimental results (see) Figure 10 , Figure 11 The results showed that a monoclonal cell line with high signal-to-noise ratio SEAP expression was obtained, and that insulin expression could be regulated by non-natural amino acids.

[0199] Example 11: Study on the regulation of reporter gene SEAP expression in wild-type mice by a non-natural amino acid-regulated gene translation system via microencapsulated cell transplantation.

[0200] The first step is to prepare the cells. Stable cell lines with a non-natural amino acid-regulated gene translation system that are in good growth condition are cultured in DMEM medium containing 1 μg / ml puromycin, 100 μg / ml bleomycin, and 10% FBS.

[0201] The second step is cell preparation via microcapsule encapsulation. Cells are collected and encapsulated using a microcapsule granulator to form microspheres containing stable cell lines regulated by a non-natural amino acid-based gene translation system. Each microcapsule contains approximately 200 cells and has a diameter of 200 μm.

[0202] The third step is in vivo transplantation of the microcapsules. The microcapsules are transplanted into wild-type mice via intraperitoneal injection, with an average of 2 x 10^6 cells transplanted into each mouse.

[0203] The fourth step is administration. Different concentrations of non-natural amino acids are administered via gavage three times daily.

[0204] The fifth step was to detect the expression level of SEAP in mice. Forty-eight hours after drug administration, mouse serum was collected via orbital blood sampling and analyzed using Roche's SEAP reporter gene chemiluminescence immunoassay kit (Roche Diagnostics; Cat. no. 11779842001).

[0205] Experimental results (see) Figure 12 The results showed that, through microencapsulated cell transplantation, the non-natural amino acid-regulated gene translation system can precisely regulate gene expression in wild-type mice in a concentration-dependent manner, and gavage administration of non-natural amino acids can activate the expression of the target protein in the system.

[0206] Example 12: Study on the regulation of reporter gene SEAP expression in wild-type mice by a non-natural amino acid-regulated gene translation system through hollow fiber tube-embedded cell transplantation.

[0207] The first step is to prepare the cells (the specific steps are the same as in Example 11).

[0208] The second step involves embedding cells in hollow fiber tubes. Cells are collected and infused into hollow fiber tubes using a syringe. The ends of the hollow fiber tubes are then sealed, forming hollow fiber tubes containing a stable cell line with a gene translation system regulated by non-natural amino acids. Each hollow fiber tube contains 1 x 10^6 cells.

[0209] The third step is in vivo transplantation of hollow fiber tubes. Hollow fiber tubes are transplanted into the subcutaneous tissue of wild-type mice, with an average of two hollow fiber tubes transplanted into each mouse.

[0210] Step 4: Administer the medication (the specific steps are the same as in Example 11).

[0211] The fifth step is to detect the expression level of SEAP in mice (the specific steps are the same as in Example 11).

[0212] Experimental results (see) Figure 13 The results showed that, through hollow fiber tube-embedded cell transplantation, the non-natural amino acid-regulated gene translation system can precisely regulate gene expression in wild-type mice in a concentration-dependent manner, and gavage administration of non-natural amino acids can activate the expression of the target protein in the system.

[0213] Example 13: Constructing a type 1 diabetic mouse model using streptozotocin modeling.

[0214] The first step was fasting. Before administration, 40 male C57BL / 6J mice weighing approximately 25g were selected and fasted for up to 16 hours.

[0215] The second step is administration. Streptozotocin was dissolved in citrate buffer (0.1 mol / L, pH 4.5) and then administered intraperitoneally to mice at a dose of 50 mg / kg for 5 consecutive days. Because streptozotocin is easily degraded, the entire process requires keeping the drug at a low temperature and protected from light, and the injection must be rapid.

[0216] The third step is to measure blood glucose levels. On day 14, after the mice have been starved for 4 hours, their blood glucose levels are measured. Mice with blood glucose levels higher than 18 mM are considered to have successfully established the model.

[0217] Example 14: Study on the regulation of insulin expression by the non-natural amino acid-induced insulin expression system during the treatment of type 1 diabetes.

[0218] The first step is to prepare the cells (the specific steps are the same as in Example 11).

[0219] The second step is the preparation of microcapsules (the specific steps are the same as in Example 11).

[0220] The third step is in vivo transplantation of the microcapsules (the specific steps are the same as in Example 11).

[0221] Step 4: Drug administration. Control group mice were administered 0 mg / kg / day of physiological saline by gavage, while experimental group mice were administered 200 mg / kg / day of physiological saline containing non-natural amino acids by gavage. Injections were given three times daily.

[0222] Step 5: Detect fasting blood glucose in mice. The model mice were fasted for 4 hours. The base of the mouse tail was cut open, and a blood glucose meter (Bayer Contour Plus) was used to measure the mouse's blood glucose.

[0223] Step 6: Detect insulin expression levels in mice. Forty-eight hours after drug administration, serum was collected from mice via orbital blood sampling, and insulin expression levels were detected using an insulin ELISA kit.

[0224] Experimental results (see) Figure 14 , Figure 15 The results showed that in type 1 diabetic mice, non-natural amino acids can precisely regulate insulin expression and improve hyperglycemia symptoms in mice.

[0225] Example 15: Study on glucose tolerance in the treatment of type 1 diabetes by non-natural amino acid-induced insulin expression system.

[0226] This example was conducted in type 1 diabetic model mice after treatment as described in Example 14. The specific experimental method for glucose tolerance is as follows:

[0227] The first step was to fast the model mice for 16 hours.

[0228] The second step is to prepare a 100 mg / ml glucose solution.

[0229] The third step involved measuring the mice's blood glucose at 0:00 and administering an intraperitoneal injection of glucose at a dose of 1 g / kg. Then, the mice's blood glucose levels were measured sequentially at 30, 60, 90, and 120 minutes.

[0230] Experimental results (see) Figure 16 The results showed that, compared with the control group, the hyperglycemia in the treatment group was well improved and controlled, indicating that insulin regulated by non-natural amino acids has a significant effect on the treatment of type 1 diabetes.

[0231] Example 16: Study on the regulation of insulin expression rate by non-natural amino acid-induced insulin expression system during the treatment of type 1 diabetes.

[0232] The first step is to prepare the cells (the specific steps are the same as in Example 11).

[0233] The second step is the preparation of microcapsules (the specific steps are the same as in Example 11).

[0234] The third step is in vivo transplantation of the microcapsules (the specific steps are the same as in Example 11).

[0235] The fourth step is to test the initial blood glucose level of the mice. The base of the mouse's tail is cut open, and a blood glucose meter (Bayer Contour Plus) is used to measure the mouse's blood glucose.

[0236] Step 5: Drug administration. Control group mice were administered 0 mg / kg of physiological saline by gavage, while experimental group mice were administered physiological saline containing 200 mg / kg of non-natural amino acids by gavage. This was recorded as 0 minutes.

[0237] The fifth step is to test the mouse's blood glucose. The base of the mouse's tail is cut open, and a blood glucose meter (Bayer Contour Plus) is used to test the mouse's blood glucose. Blood glucose was measured at 30, 60, 90, 120, 150, and 180 minutes after drug administration.

[0238] Experimental results (see) Figure 17 The results showed that in type 1 diabetic mice, non-natural amino acids could rapidly regulate insulin expression and improve hyperglycemia symptoms.

[0239] Example 17: Making non-natural amino acid "biscuits".

[0240] The first step is to crush ordinary mouse feed into powder.

[0241] The second step is to take 6 mL of OmeY solution (400 mg / mL) and add it to 24 g of ordinary feed powder.

[0242] The third step is to mix the ingredients thoroughly, then press them into shape using a mold. Let them air dry at room temperature to produce non-natural amino acid "biscuits" (equivalent to 100mg of Omega-3 fatty acids per gram of biscuit).

[0243] Example 18: Long-term study of the regulation of insulin expression by the non-natural amino acid-induced insulin expression system during the treatment of type 1 diabetes.

[0244] The first step is to prepare the cells (the specific steps are the same as in Example 11).

[0245] The second step is the preparation of microcapsules (the specific steps are the same as in Example 11).

[0246] The third step is in vivo transplantation of the microcapsules (the specific steps are the same as in Example 11).

[0247] Step 4: Drug administration. Control group mice were administered 0 mg / kg / day of physiological saline via gavage, three times daily. Experimental group mice were administered 200 mg / kg / day of non-natural amino acids via gavage, three times daily. The non-natural amino acid "biscuit" group was fed non-natural amino acid "biscuits" instead of their regular diet.

[0248] Fifth step: Detect fasting blood glucose in mice (specific steps are the same as in Example 14).

[0249] Step 6: Detect the expression level of insulin in mice (specific steps are the same as in Example 14).

[0250] Experimental results (see) Figure 18 , Figure 19 The results showed that in type 1 diabetic mice, gavage administration of non-natural amino acids and feeding with non-natural amino acid "biscuits" could regulate insulin expression in the long term and improve hyperglycemia symptoms in mice.

[0251] Example 19: Study on glucose tolerance in the treatment of type 1 diabetes by non-natural amino acid-induced insulin expression system.

[0252] This case study was conducted in type 1 diabetic model mice after treatment as described in Example 17. The specific experimental method for glucose tolerance is as follows:

[0253] The first step was to fast the model mice for 16 hours.

[0254] The second step is to prepare a 100 mg / ml glucose solution.

[0255] The third step is to measure the blood glucose level of the mice (the specific steps are the same as in Example 15).

[0256] Experimental results (see) Figure 20 The results showed that, compared with the control group, the group receiving non-natural amino acid gavage and non-natural amino acid "biscuit" feeding had significantly improved and controlled hyperglycemia, indicating that the insulin regulated by non-natural amino acids has a significant effect on the treatment of type 1 diabetes.

[0257] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention. sequence list <110> Beijing University <120> Non-natural amino acid-regulated gene translation systems and their applications <130> MP21008835 <160> twenty one <170> SIPOSequenceListing 1.0 <210> 1 <211> 1281 <212> DNA <213> Artificial Sequence <400> 1 atggcaagca gtaacttgat taaacaattg caagagcggg ggctggtagc ccaggtgacg 60 gacgaggaag cgttagcaga gcgactggcg caaggcccga tcgcactcgt gtgtggcttc 120 gatcctaccg ctgacagctt gcatttgggg catcttgttc cattgttatg cctgaaacgc 180 ttccagcagg cgggccacaa gccggttgcg ctggtaggcg gcgcgacggg tctgattggc 240 gacccgagct tcaaagctgc cgagcgtaag ctgaacaccg aagaaactgt tcaggagtgg 300 gtggacaaaa tccgtaagca ggttgccccg ttcctcgatt tcgactgtgg agaaaactct 360 gctatcgcgg ccaataatta tgactggttc ggcaatatga atgtgctgac cttcctgcgc 420 gatattggca aacacttctc cgttaaccag atgatcaaca aagaagcggt taagcagcgt 480 ctcaaccgtg aagatcaggg gatttcgttc actgagtttt cctacaacct gctgcagggt 540 tatagtatgg cctgtttgaa caaacagtac ggtgtggtgc tgcaaattgg tggttctgac 600 cagtggggta acatcacttc tggtatcgac ctgacccgtc gtctgcatca gaatcaggtg 660 tttggcctga ccgttccgct gatcactaaa gcagatggca ccaaatttgg taaaactgaa 720 ggcggcgcag tctggttgga tccgaagaaa accagcccgt acaaattcta ccagttctgg 780 atcaacactg cgcgtgccga cgtttaccgc ttcctgaagt tcttcacctt tatgagcatt 840 atcaacactg cgcgtgccga cgtttaccgc ttcctgaagt tcttcacctt tatgagcatt 840 gaagagatca acgccctgga agaagaagat aaaaacagcg gtaaagcacc gcgcgcccag 900 gaagagatca acgccctgga agaagaagat aaaaacagcg gtaaagcacc gcgcgcccag 900 tatgtactgg cggagcaggt gactcgtctg gttcacggtg aagaaggttt acaggcggca 960 tatgtactgg cggagcaggt gactcgtctg gttcacggtg aagaaggttt acaggcggca 960 aaacgtatta ccgaatgcct gttcagcggt tctttgagtg cgctgagtga agcggacttc 1020 aaacgtatta ccgaatgcct gttcagcggt tctttgagtg cgctgagtga agcggacttc 1020 gaacagctgg cgcaggacgg cgtaccgatg gttgagatgg aaaagggcgc agacctgatg 1080 gaacagctgg cgcaggacgg cgtaccgatg gttgagatgg aaaagggcgc agacctgatg 1080 caggcactgg tcgattctga actgcaacct tcccgtggtc aggcacgtaa aactatcgcc 1140 caggcactgg tcgattctga actgcaacct tcccgtggtc aggcacgtaa aactatcgcc 1140 tccaatgcca tcaccattaa cggtgaaaaa cagtccgatc ctgaatactt ctttaaagaa 1200 tccaatgcca tcaccattaa cggtgaaaaa cagtccgatc ctgaatactt ctttaaagaa 1200 gaagatcgtc tgtttggtcg ttttacctta ctgcgtcgcg gtaaaaagaa ttactgtctg 1260 gaagatcgtc tgtttggtcg ttttacctta ctgcgtcgcg gtaaaaagaa ttactgtctg 1260 atttgctgga aagggcccgt t 1281 atttgctgga aagggcccgt t 1281 <210> 2<210> 2 <211> 185 <211> 185 <212> DNA <212> DNA <213> 人工序列(Artificial Sequence) <213> Artificial Sequence <400> 2 <400> 2 aaaaaatggt gggggacgga ttcgaaccgc cgaacccaaa gggagcggat ttagagtccg 60 aaaaaatggt gggggacgga ttcgaaccgc cgaacccaaa gggagcggat ttagagtccg 60 ccgcgtttag ccacttcgct accccaccgg atccgagtgg tctcatacag aacttataag 120 ccgcgtttag ccacttcgct accccaccgg atccgagtgg tctcatacag aacttataag 120 attcccaaat ccaaagacat ttcacgttta tggtgatttc ccagaacaca tagcgacatg 180 caaat 185 <210> 3 <211> 1281 <212> DNA <213> Artificial Sequence <400> 3 atggcaagca gtaacttgat taaacaattg caagagcggg ggctggtagc ccaggtgacg 60 gacgaggaag cgttagcaga gcgactggcg caaggcccga tcgcactcgt gtgtggcttc 120 gatcctaccg ctgacagctt gcatttgggg catcttgttc cattgttatg cctgaaacgc 180 ttccagcagg cgggccacaa gccggttgcg ctggtaggcg gcgcgacggg tctgattggc 240 gacccgagct tcaaagctgc cgagcgtaag ctgaacaccg aagaaactgt tcaggagtgg 300 gtggacaaaa tccgtaagca ggttgccccg ttcctcgatt tcgactgtgg agaaaactct 360 gctatcgcgg ccaataatta tgactggttc ggcaatatga atgtgctgac cttcctgcgc 420 gatattggca aacacttctc cgttaaccag atgatcaaca aagaagcggt taagcagcgt 480 ctcaaccgtg aagatcaggg gatttcgttc actgagtttt cctacaacct gctgcagggt 540 tatagtatgg cctgtttgaa caaacagtac ggtgtggtgc tgcaaattgg tggttctgac 600 cagtggggta acatcacttc tggtatcgac ctgacccgtc gtctgcatca gaatcaggtg 660 tttggcctga ccgttccgct gatcactaaa gcagatggca ccaaatttgg taaaactgaa 720 ggcggcgcag tctggttgga tccgaagaaa accagcccgt acaaattcta ccagttctgg 780 atcaacactg cgcgtgccga cgtttaccgc ttcctgaagt tcttcacctt tatgagcatt 840 gaagagatca acgccctgga agaagaagat aaaaacagcg gtaaagcacc gcgcgcccag 900 tatgtactgg cggagcaggt gactcgtctg gttcacggtg aagaaggttt acaggcggca 960 aaacgtatta ccgaatgcct gttcagcggt tctttgagtg cgctgagtga agcggacttc 1020 gaacagctgg cgcaggacgg cgtaccgatg gttgagatgg aaaagggcgc agacctgatg 1080 caggcactgg tcgattctga actgcaacct tcccgtggtc aggcacgtaa aactatcgcc 1140 tccaatgcca tcaccattaa cggtgaaaaa cagtccgatc ctgaatactt ctttaaagaa 1200 gaagatcgtc tgtttggtcg ttttacctta ctgcgtcgcg gtaaaaagaa ttactgtctg 1260 atttgctgga aagggcccgt t 1281 <210> 4 <211> 185 <212> DNA <213> Artificial Sequence <400> 4 aaaaaatggt gggggacgga ttcgaaccgc cgaacccaaa gggagcggat ttagagtccg 60 ccgcgtttag ccacttcgct accccaccgg atccgagtgg tctcatacag aacttataag 120 attcccaaat ccaaagacat ttcacgttta tggtgatttc ccagaacaca tagcgacatg 180 caaat 185 <210> 5 <211> 1560 <212> DNA <213> Artificial Sequence <400> 5 atgtagctgg ggccctgcat gctgctgctg ctgctgctgc tgggcctgag gctacagctc 60 tccctgggca tcatcccagt tgaggaggag aacccggact tctggaaccg cgaggcagcc 120 gaggccctgg gtgccgccaa gaagctgcag cctgcacaga cagccgccaa gaacctcatc 180 atcttcctgg gcgatgggat gggggtgtct acggtgacag ctgccaggat tctaaaaggg 240 cagaagaagg acaaactggg gcctgagata cccctggcta tggaccgctt cccatatgtg 300 gctctgtcca agacatacaa tgtagacaaa catgtgccag acagtggagc cacagccacg 360 gcctacctgt gcggggtcaa gggcaacttc cagaccattg gcttgagtgc agccgcccgc 420 tttaaccagt gcaacacgac acgcggcaac gaggtcatct ccgtgatgaa tcgggccaag 480 aaagcaggga agtcagtggg agtggtaacc accacacgag tgcagcacgc ctcgccagcc 540 ggcacctacg cccacacggt gaaccgcaac tggtactcgg acgccgacgt gcctgcctcg 600 gcccgccagg aggggtgcca ggacatcgct acgcagctca tctccaacat ggacattgat 660 gtgatcctgg gtggaggccg aaagtacatg tttcgcatgg gaaccccaga ccctgagtac 720 ccagatgact acagccaagg tgggaccagg ctggacggga agaatctggt gcaggaatgg 780 ctggcgaagc gccagggtgc ccggtatgtg tggaaccgca ctgagctcat gcaggcttcc 840 ctggacccgt ctgtgaccca tctcatgggt ctctttgagc ctggagacat gaaatacgag 900 atccaccgag actccacact ggacccctcc ctgatggaga tgacagaggc tgccctgcgc 960 ctgctgagca ggaacccccg cggcttcttc ctcttcgtgg agggtggtcg catcgaccac 1020 ggtcatcacg aaagcagggc ttaccgggca ctgactgaga cgatcatgtt cgacgacgcc 1080 attgagaggg cgggccagct caccagcgag gaggacacgc tgagcctcgt cactgccgac 1140 cactcccacg tcttctcctt cggaggctac cccctgcgag ggagctccat cttcgggctg 1200[[ID=J]] gcccctggca aggcccggga caggaaggcc tacacggtcc tcctatacgg aaacggtcca 1260 ggctatgtgc tcaaggacgg cgcccggccg gatgttaccg agagcgagag cgggagcccc 1320 gagtatcggc agcagtcagc agtgcccctg gacgaagaga cccacgcagg cgaggacgtg 1380 gcggtgttcg cgcgcggccc gcaggcgcac ctggttcacg gcgtgcagga gcagaccttc 1,440 atagcgcacg tcatggcctt cgccgcctgc ctggagccct acaccgcctg cgacctggcg 1,500 ccccccgccg gcaccaccga cgccgcgcac ccggggcggt cccggtccaa gcgtctggat 1,560 <210> 6` <211> 1,560 <212> DNA <213> Artificial Sequence <400> 6 atggttctgg ggccctgcat gctgctgctg ctgctgctgc tgggcctgag gctacagctc 60 tcctagggca tcatcccagt tgaggaggag aacccggact tctggaaccg cgaggcagcc 120 gaggccctgg gtgccgccaa gaagctgcag cctgcacaga cagccgccaa gaacctcatc 180 atcttcctgg gcgatgggat gggggtgtct acggtgacag ctgccaggat tctaaaaggg 240 cagaagaagg acaaactggg gcctgagata cccctggcta tggaccgctt cccatatgtg 300 gctctgtcca agacatacaa tgtagacaaa catgtgccag acagtggagc cacagccacg 360 gcctacctgt gcggggtcaa gggcaacttc cagaccattg gcttgagtgc agccgcccgc 420 tttaaccagt gcaacacgac acgcggcaac gaggtcatct ccgtgatgaa tcgggccaag 480 aaagcaggga agtcagtggg agtggtaacc accacacgag tgcagcacgc ctcgccagcc 540 ggcacctacg cccacacggt gaaccgcaac tggtactcgg acgccgacgt gcctgcctcg 600 gcccgccagg aggggtgcca ggacatcgct acgcagctca tctccaacat ggacattgat 660 gtgatcctgg gtggaggccg aaagtacatg tttcgcatgg gaaccccaga ccctgagtac 720 ccagatgact acagccaagg tgggaccagg ctggacggga agaatctggt gcaggaatgg 780 ctggcgaagc gccagggtgc ccggtatgtg tggaaccgca ctgagctcat gcaggcttcc 840 ctggacccgt ctgtgaccca tctcatgggt ctctttgagc ctggagacat gaaatacgag 900 atccaccgag actccacact ggacccctcc ctgatggaga tgacagaggc tgccctgcgc 960 ctgctgagca ggaacccccg cggcttcttc ctcttcgtgg agggtggtcg catcgaccac 1020 ggtcatcacg aaagcagggc ttaccgggca ctgactgaga cgatcatgtt cgacgacgcc 1080 attgagaggg cgggccagct caccagcgag gaggacacgc tgagcctcgt cactgccgac 1140 cactcccacg tcttctcctt cggaggctac cccctgcgag ggagctccat cttcgggctg 1200 gcccctggca aggcccggga caggaaggcc tacacggtcc tcctatacgg aaacggtcca 1260 ggctatgtgc tcaaggacgg cgcccggccg gatgttaccg agagcgagag cgggagcccc 1320 gagtatcggc agcagtcagc agtgcccctg gacgaagaga cccacgcagg cgaggacgtg 1380 gcggtgttcg cgcgcggccc gcaggcgcac ctggttcacg gcgtgcagga gcagaccttc 1440 atagcgcacg tcatggcctt cgccgcctgc ctggagccct acaccgcctg cgacctggcg 1500 ccccccgccg gcaccaccga cgccgcgcac ccggggcggt cccggtccaa gcgtctggat 1560 <210> 7 <211> 1560 <212> DNA <213> Artificial Sequence <400> 7 atggttctgg ggccctgcat gctgctgctg ctgctgctgc tgggcctgag gctacagctc 60 tccctgggca tcatcccata ggaggaggag aacccggact tctggaaccg cgaggcagcc 120 gaggccctgg gtgccgccaa gaagctgcag cctgcacaga cagccgccaa gaacctcatc 180 atcttcctgg gcgatgggat gggggtgtct acggtgacag ctgccaggat tctaaaaggg 240 cagaagaagg acaaactggg gcctgagata cccctggcta tggaccgctt cccatatgtg 300 gctctgtcca agacatacaa tgtagacaaa catgtgccag acagtggagc cacagccacg 360 gcctacctgt gcggggtcaa gggcaacttc cagaccattg gcttgagtgc agccgcccgc 420 tttaaccagt gcaacacgac acgcggcaac gaggtcatct ccgtgatgaa tcgggccaag 480 aaagcaggga agtcagtggg agtggtaacc accacacgag tgcagcacgc ctcgccagcc 540 ggcacctacg cccacacggt gaaccgcaac tggtactcgg acgccgacgt gcctgcctcg 600 gcccgccagg aggggtgcca ggacatcgct acgcagctca tctccaacat ggacattgat 660 gtgatcctgg gtggaggccg aaagtacatg tttcgcatgg gaaccccaga ccctgagtac 720 ccagatgact acagccaagg tgggaccagg ctggacggga agaatctggt gcaggaatgg 780 ctggcgaagc gccagggtgc ccggtatgtg tggaaccgca ctgagctcat gcaggcttcc 840 ctggacccgt ctgtgaccca tctcatgggt ctctttgagc ctggagacat gaaatacgag 900 atccaccgag actccacact ggacccctcc ctgatggaga tgacagaggc tgccctgcgc 960 ctgctgagca ggaacccccg cggcttcttc ctcttcgtgg agggtggtcg catcgaccac 1020 ggtcatcacg aaagcagggc ttaccgggca ctgactgaga cgatcatgtt cgacgacgcc 1080 attgagaggg cgggccagct caccagcgag gaggacacgc tgagcctcgt cactgccgac 1140 cactcccacg tcttctcctt cggaggctac cccctgcgag ggagctccat cttcgggctg 1200 gcccctggca aggcccggga caggaaggcc tacacggtcc tcctatacgg aaacggtcca 1260 ggctatgtgc tcaaggacgg cgcccggccg gatgttaccg agagcgagag cgggagcccc 1320 gagtatcggc agcagtcagc agtgcccctg gacgaagaga cccacgcagg cgaggacgtg 1380 gcggtgttcg cgcgcggccc gcaggcgcac ctggttcacg gcgtgcagga gcagaccttc 1440 atagcgcacg tcatggcctt cgccgcctgc ctggagccct acaccgcctg cgacctggcg 1500 ccccccgccg gcaccaccga cgccgcgcac ccggggcggt cccggtccaa gcgtctggat 1560 <210> 8 <211> 1560 <212> DNA <213> Artificial Sequence <400> 8 atggttctgg ggccctgcat gctgctgctg ctgctgctgc tgggcctgag gctacagctc 60 tccctgggca tcatcccagt tgaggaggag aacccggact tctggaaccg cgaggcagcc 120 gaggccctgg gtgccgccaa gaagctgtag cctgcacaga cagccgccaa gaacctcatc 180 atcttcctgg gcgatgggat gggggtgtct acggtgacag ctgccaggat tctaaaaggg 240 cagaagaagg acaaactggg gcctgagata cccctggcta tggaccgctt cccatatgtg 300 gctctgtcca agacatacaa tgtagacaaa catgtgccag acagtggagc cacagccacg 360 gcctacctgt gcggggtcaa gggcaacttc cagaccattg gcttgagtgc agccgcccgc 420 tttaaccagt gcaacacgac acgcggcaac gaggtcatct ccgtgatgaa tcgggccaag 480 aaagcaggga agtcagtggg agtggtaacc accacacgag tgcagcacgc ctcgccagcc 540 ggcacctacg cccacacggt gaaccgcaac tggtactcgg acgccgacgt gcctgcctcg 600 gcccgccagg aggggtgcca ggacatcgct acgcagctca tctccaacat ggacattgat 660 gtgatcctgg gtggaggccg aaagtacatg tttcgcatgg gaaccccaga ccctgagtac 720 ccagatgact acagccaagg tgggaccagg ctggacggga agaatctggt gcaggaatgg 780 ctggcgaagc gccagggtgc ccggtatgtg tggaaccgca ctgagctcat gcaggcttcc 840 ctggacccgt ctgtgaccca tctcatgggt ctctttgagc ctggagacat gaaatacgag 900 atccaccgag actccacact ggacccctcc ctgatggaga tgacagaggc tgccctgcgc 960 ctgctgagca ggaacccccg cggcttcttc ctcttcgtgg agggtggtcg catcgaccac 1020 ggtcatcacg aaagcagggc ttaccgggca ctgactgaga cgatcatgtt cgacgacgcc 1080 attgagaggg cgggccagct caccagcgag gaggacacgc tgagcctcgt cactgccgac 1140 cactcccacg tcttctcctt cggaggctac cccctgcgag ggagctccat cttcgggctg 1200 gcccctggca aggcccggga caggaaggcc tacacggtcc tcctatacgg aaacggtcca 1260 ggctatgtgc tcaaggacgg cgcccggccg gatgttaccg agagcgagag cgggagcccc 1320 gagtatcggc agcagtcagc agtgcccctg gacgaagaga cccacgcagg cgaggacgtg 1380 gcggtgttcg cgcgcggccc gcaggcgcac ctggttcacg gcgtgcagga gcagaccttc 1440 atagcgcacg tcatggcctt cgccgcctgc ctggagccct acaccgcctg cgacctggcg 1500 ccccccgccg gcaccaccga cgccgcgcac ccggggcggt cccggtccaa gcgtctggat 1560 <210> 9 <211> 1560 <212> DNA <213> Artificial Sequence <400> 9 atggttctgg ggccctgcat gctgctgctg ctgctgctgc tgggcctgag gctacagctc 60 tccctgggca tcatcccagt tgaggaggag aacccggact tctggaaccg cgaggcagcc 120 gaggccctgg gtgccgccaa gaagctgcag cctgcacaga cagccgccaa gaacctcatc 180 atcttcctgg gcgatgggat gggggtgtct acggtgacag ctgccaggat tctaaaaggg 240 cagaagaagg acaaactggg gcctgagata cccctggcta tggaccgctt cccatatgtg 300 gctctgtcca agacatacaa tgtagacaaa catgtgccag acagtggagc cacagccacg 360 gcctacctgt gcggggtcaa gggcaacttc cagaccattg gcttgagtgc agccgcccgc 420 tttaaccagt gcaacacgac acgcggcaac gaggtcatct ccgtgatgaa tcgggccaag 480 aaagcaggga agtcagtggg agtggtaacc accacacgag tgcagcacgc ctcgccagcc 540 ggcacctacg cccacacggt gaaccgcaac tggtactcgg acgccgacgt gcctgcctcg 600 gcccgccagg aggggtgcca ggacatcgct acgcagctca tctccaacat ggacattgat 660 gtgatcctgg gtggaggccg aaagtacatg tttcgcatgg gaaccccaga ccctgagtac 720 ccagatgact acagccaagg tgggaccagg ctggacggga agaatctggt gcaggaatgg 780 ctggcgaagc gccagggtgc ccggtatgtg tggaaccgca ctgagctcat gcaggcttcc 840 ctggacccgt ctgtgaccca tctcatgggt ctctttgagc ctggagacat gaaatacgag 900 atccaccgag actccacact ggacccctcc ctgatggaga tgacagaggc tgccctgcgc 960 ctgctgagca ggaacccccg cggcttcttc ctcttcgtgg agggtggtcg catcgaccac 1020 ggtcatcacg aaagcagggc ttaccgggca ctgactgaga cgatcatgtt cgacgacgcc 1080 attgagaggg cgggccagct caccagcgag gaggacacgc tgagcctcgt cactgccgac 1140 cactcccacg tcttctcctt cggaggctac cccctgcgag ggagctccat cttcgggctg 1200 gcccctggca aggcccggga caggaaggcc tacacggtcc tcctatacgg aaacggtcca 1260 ggctatgtgc tcaaggacgg cgcccggccg gatgttaccg agagcgagag cgggagcccc 1320 gagtatcggc agcagtcagc agtgcccctg gacgaagaga cccacgcagg cgaggacgtg 1380 gcggtgttcg cgcgcggccc gcaggcgcac ctggttcacg gcgtgcagga gcagaccttc 1440 atagcgcacg tcatggcctt cgccgcctgc ctggagccct acaccgcctg cgacctggcg 1500 ccccccgccg gcaccaccga cgccgcgcac ccggggcggt cccggtccaa gcgtctggat 1560 <210> 10 <211> 747 <212> DNA <213> Artificial Sequence <400> 10 atgtctagat aggacaagag caaagtcata aactctgctc tggaattact caatgaagtc 60 ggtatcgaag gcctgacgac aaggaaactc gctcaaaagc tgggagttga gcagcctacc 120 ctgtactggc acgtgaagaa caagcgggcc ctgctcgatg ccctggcaat cgagatgctg 180 gacaggcatc atacccactt ctgccccctg gaaggcgagt catggcaaga ctttctgcgg 240 aacaacgcca agtcattccg ctgtgctctc ctctcacatc gcgacggggc taaagtgcat 300 ctcggcaccc gcccaacaga gaaacagtac gaaaccctgg aaaatcagct cgcgttcctg 360 tgtcagcaag gcttctccct ggagaacgca ctgtacgctc tgtccgccgt gggccacttt 420 acactgggct gcgtattgga ggatcaggag catcaagtag caaaagagga aagagagaca 480 cctaccaccg attctatgcc cccacttctg agacaagcaa ttgagctgtt cgaccatcag 540 ggagccgaac ctgccttcct tttcggcctg gaactaatca tatgtggcct ggagaaacag 600 ctaaagtgcg aaagcggcgg gccggccgac gcccttgacg attttgactt agacatgctc 660 ccagccgatg cccttgacga ctttgacctt gatatgctgc ctgctgacgc tcttgacgat 720 tttgaccttg acatgctccc cgggtaa 747 <210> 11 <211> 747 <212> DNA <213> Artificial Sequence <400> 11 atgtctagac tggacaagta gaaagtcata aactctgctc tggaattact caatgaagtc 60 ggtatcgaag gcctgacgac aaggaaactc gctcaaaagc tgggagttga gcagcctacc 120 ctgtactggc acgtgaagaa caagcgggcc ctgctcgatg ccctggcaat cgagatgctg 180 gacaggcatc atacccactt ctgccccctg gaaggcgagt catggcaaga ctttctgcgg 240 aacaacgcca agtcattccg ctgtgctctc ctctcacatc gcgacggggc taaagtgcat 300 ctcggcaccc gcccaacaga gaaacagtac gaaaccctgg aaaatcagct cgcgttcctg 360 tgtcagcaag gcttctccct ggagaacgca ctgtacgctc tgtccgccgt gggccacttt 420 acactgggct gcgtattgga ggatcaggag catcaagtag caaaagagga aagagagaca 480 cctaccaccg attctatgcc cccacttctg agacaagcaa ttgagctgtt cgaccatcag 540 ggagccgaac ctgccttcct tttcggcctg gaactaatca tatgtggcct ggagaaacag 600 ctaaagtgcg aaagcggcgg gccggccgac gcccttgacg attttgactt agacatgctc 660 ccagccgatg cccttgacga ctttgacctt gatatgctgc ctgctgacgc tcttgacgat 720 tttgaccttg acatgctccc cgggtaa 747 <210> 12 <211> 747 <212> DNA <213> Artificial Sequence <400> 12 atgtctagac tggacaagag caaagtcata aactctgctc tggaattact caatgaagtc 60 ggtatcgaag gcctgacgac aaggaaactc gctcaaaagc tgggagttga gcagcctacc 120 ctgtactggc acgtgtagaa caagcgggcc ctgctcgatg ccctggcaat cgagatgctg 180 gacaggcatc atacccactt ctgccccctg gaaggcgagt catggcaaga ctttctgcgg 240 aacaacgcca agtcattccg ctgtgctctc ctctcacatc gcgacggggc taaagtgcat 300 ctcggcaccc gcccaacaga gaaacagtac gaaaccctgg aaaatcagct cgcgttcctg 360 tgtcagcaag gcttctccct ggagaacgca ctgtacgctc tgtccgccgt gggccacttt 420 acactgggct gcgtattgga ggatcaggag catcaagtag caaaagagga aagagagaca 480 cctaccaccg attctatgcc cccacttctg agacaagcaa ttgagctgtt cgaccatcag 540 ggagccgaac ctgccttcct tttcggcctg gaactaatca tatgtggcct ggagaaacag 600 ctaaagtgcg aaagcggcgg gccggccgac gcccttgacg attttgactt agacatgctc 660 ccagccgatg cccttgacga ctttgacctt gatatgctgc ctgctgacgc tcttgacgat 720 tttgaccttg acatgctccc cgggtaa 747 <210> 13 <211> 747 <212> DNA <213> Artificial Sequence <400> 13 atgtctagac tggacaagag caaagtcata aactctgctc tggaattact caatgaagtc 60 ggtatcgaag gcctgacgac aaggaaactc gctcaaaagc tgggagttga gcagcctacc 120 ctgtactggc acgtgaagaa caagcgggcc ctgctcgatg ccctggcaat cgagatgctg 180 gacaggcatc atacccactt ctgccccctg tagggcgagt catggcaaga ctttctgcgg 240 aacaacgcca agtcattccg ctgtgctctc ctctcacatc gcgacggggc taaagtgcat 300 ctcggcaccc gcccaacaga gaaacagtac gaaaccctgg aaaatcagct cgcgttcctg 360 tgtcagcaag gcttctccct ggagaacgca ctgtacgctc tgtccgccgt gggccacttt 420 acactgggct gcgtattgga ggatcaggag catcaagtag caaaagagga aagagagaca 480 cctaccaccg attctatgcc cccacttctg agacaagcaa ttgagctgtt cgaccatcag 540 ggagccgaac ctgccttcct tttcggcctg gaactaatca tatgtggcct ggagaaacag 600 ctaaagtgcg aaagcggcgg gccggccgac gcccttgacg attttgactt agacatgctc 660 ccagccgatg cccttgacga ctttgacctt gatatgctgc ctgctgacgc tcttgacgat 720<l tttgaccttg acatgctccc cgggtaa 747 <210> 14 <211> 747 <212> DNA <213> Artificial Sequence <400> 14 atgtctagac tggacaagag caaagtcata aactctgctc tggaattact caatgaagtc 60 ggtatcgaag gcctgacgac aaggaaactc gctcaaaagc tgggagttga gcagcctacc 120 ctgtactggc acgtgaagaa caagcgggcc ctgctcgatg ccctggcaat cgagatgctg 180 gacaggcatc atacccactt ctgccccctg gaaggcgagt catggcaaga ctttctgcgg 240 aacaacgcca agtcattccg ctgtgctctc ctctcacatc gcgacggggc taaagtgcat 300 ctcggcaccc gcccaagaga gaacagtag gaaaccctgg aaaatcagct cgcgttcctg 360 tgtcagcaag gcttctccct ggagaacgca ctgtacgctc tgtccgccgt gggccacttt 420 acactgggct gcgtattgga ggatcaggag catcaagtag caaaaagaga aagagagaca 480 cctaccaccg attctatgcc cccacttctg agaaagcaa ttgagctgtt cgaccatcag 540 ggagccgaac ctgccttcct tttcggcctg gaataatca tatgtggcct ggagaaacag 600 ctaaagtgcg aaagcggcgg gccggccgac gcccttgacg attttgactt agacatgctc 660 ccagccgatg cccttgacga ctttgacctt gatatgctgc ctgctgacgc tcttgacgat 720 tttgaccttg acatgctccc cgggtaa 747 <210> 15 <211> 747 <212> DNA <213> Artificial Sequence <400> 15 atgtctagac tggacaagag caaagtcata aactctgctc tggaattact caatgaagtc 60 ggtatcgaag gcctgacgac aaggaaactc gctcaaaagc tgggagttga gcagcctacc 120 ctgtactggc acgtgaagaa caagcgggcc ctgctcgatg ccctggcaat cgagatgctg 180 gacaggcatc atacccactt ctgccccctg gaaggcgagt catggcaaga ctttctgcgg 240 aacaacgcca agtcattccg ctgtgctctc ctctcacatc gcgacggggc taaagtgcat 300 ctcggcaccc gcccaacaga gaaacagtac gaaaccctgg aaaatcagct cgcgttcctg 360 tgtcagcaag gcttctccct ggagaacgca ctgtacgctc tgtccgccgt gggccacttt 420 acactgggct gcgtattgga ggatcaggag catcaagtag caaaagagga aagatagaca 480 cctaccaccg attctatgcc cccacttctg agacaagcaa ttgagctgtt cgaccatcag 540 ggagccgaac ctgccttcct tttcggcctg gaactaatca tatgtggcct ggagaaacag 600 ctaaagtgcg aaagcggcgg gccggccgac gcccttgacg attttgactt agacatgctc 660 ccagccgatg cccttgacga ctttgacctt gatatgctgc ctgctgacgc tcttgacgat 720 tttgaccttg acatgctccc cgggtaa 747 <210> 16 <211> 327 <212> DNA <213> Artificial Sequence <400> 16 atggccctgt aggtgcactt cctgccactg ctggccctgc tggccctgtg ggagccaaag 60 ccaacccagg cctttgtgaa gcagcacctg tgcggaccac acctggtgga ggccctgtac 120 ctggtgtgcg gagagagggg cttcttttat acacccaaga gccggagaaa gagggaggac 180 cctcaggtgg agcagctgga gctgggaggt tcccctggcg atctgcagac cctggccctg 240 gaggtggcaa ggcagaagag gggcatcgtg gaccagtgct gtacaagcat ctgctccctg 300 taccagctgg agaactattg taattga 327 <210> 17 <211> 336 <212> DNA <213> Artificial Sequence <400> 17 cccatggccc tgtggatgcg ctagctgccc ctgctggccc tgctcgtcct ctgggagccc 60 aagcctgccc aggcttttgt caaacagcac ctttgtggtc ctcacctggt ggaggctctg 120 tacctggtgt gtggggaacg tggtttcttc tacacaccca agtcccgtcg taaaagggag 180 gacccgcaag tgccacaact ggagctgggt ggaggcccgg aggccgggga tcttcagacc 240 ttggcactgg aggttgcccg gcagaagcgt ggcattgtgg atcagtgctg caccagcatc 300 tgctccctct accaactgga gaactactgc aactga 336 <210> 18 <211> 327 <212> DNA <213> Artificial Sequence <400> 18 atggccctgc tggtgcactt cctgccactg ctggccctgc tggccctgtg ggagccaaag 60 ccaacctagg cctttgtgaa gcagcacctg tgcggaccac acctggtgga ggccctgtac 120 ctggtgtgcg gagagagggg cttcttttat acacccaaga gccggagaaa gagggaggac 180 cctcaggtgg agcagctgga gctgggaggt tcccctggcg atctgcagac cctggccctg 240 gaggtggcaa ggcagaagag gggcatcgtg gaccagtgct gtacaagcat ctgctccctg 300 taccagctgg agaactattg taattga 327 <210> 19 <211> 327 <212> DNA <213> Artificial Sequence <400> 19 atggccctgc tggtgcactt cctgccactg ctggccctgc tggccctgtg ggagccaaag 60 ccaacccagg cctttgtgaa gcagcacctg tgcggaccac acctggtgga ggccctgtac 120 ctggtgtgcg gagagagggg cttcttttat acacccaaga gccggagaaa gagggagac 180 cctcaggtgt agcagctgga gctgggaggt tcccctggcg atctgcagac cctggccctg 240 gaggtggcaa ggcagaagag gggcatcgtg gaccagtgct gtacaagcat ctgctccctg 300 taccagctgg agaactattg taattga 327 <210> 20 <211> 327 <212> DNA <213> Artificial Sequence <400> 20 atggccctgc tggtgcactt cctgccactg ctggccctgc tggccctgtg ggagccaaag 60 ccaacccagg cctttgtgaa gcagcacctg tgcggaccac acctggtgga ggccctgtac 120 ctggtgtgcg gagagagggg cttcttttat acacccaaga gccggagaaa gagggagac 180 cctcaggtgg agcagtagga gctgggaggt tcccctggcg atctgcagac cctggccctg 240 gaggtggcaa ggcagaagag gggcatcgtg gaccagtgct gtacaagcat ctgctccctg 300 taccagctgg agaactattg taattga 327 <210> 21 <211> 1950 <212> DNA <213> Artificial Sequence <400> 21 atgctgctgc tgctgctgct gctgggcctg aggctacagc tctccctggg catcatccca 60 gttgaggagg agaacccgga cttctggaac cgcgaggcag ccgaggccct gggtgccgcc 120 aagaagctgc agcctgcaca gacagccgcc aagaacctca tcatcttcct gggcgatggg 180 atgggggtgt ctacggtgac agctgccagg atcctaaaag ggcagaagaa ggacaaactg 240 gggcctgaga tacccctggc catggaccgc ttcccatatg tggctctgtc caagacatac 300 aatgtagaca aacatgtgcc agacagtgga gccacagcca cggcctacct gtgcggggtc 360 aagggcaact tccagaccat tggcttgagt gcagccgccc gctttaacca gtgcaacacg 420 acacgcggca acgaggtcat ctccgtgatg aatcgggcca agaaagcagg gaagtcagtg 480 ggagtggtaa ccaccacacg agtgcagcac gcctcgccag ccggcaccta cgcccacacg 540 gtgaaccgca actggtactc ggacgccgac gtgcctgcct cggcccgcca ggaggggtgc 600 caggacatcg ctacgcagct catctccaac atggacattg acgtgatcct aggtggaggc 660 cgaaagtaca tgtttcgcat gggaacccca gaccctgagt acccagatga ctacagccaa 720 ggtgggacca ggctggacgg gaagaatctg gtgcaggaat ggctggcgaa gcgccagggt 780 gcccggtatg tgtggaaccg cactgagctc atgcaggctt ccctggaccc gtctgtgacc 840 catctcatgg gtctctttga gcctggagac atgaaatacg agatccaccg agactccaca 900 ctggacccct ccctgatgga gatgacagag gctgccctgc gcctgctgag caggaacccc 960 cgcggcttct tcctcttcgt ggagggtggt cgcatcgacc atggtcatca tgaaagcagg 1020 gcttaccggg cactgactga gacgatcatg ttcgacgacg ccattgagag ggcgggccag 1080 ctcaccagcg aggaggacac gctgagcctc gtcactgccg accactccca cgtcttctcc 1140 ttcggaggct accccctgcg agggagctcc atcttcgggc tggcccctgg caaggcccgg 1200 gacaggaagg cctacacggt cctcctatac ggaaacggtc caggctatgt gctcaaggac 1260 ggcgcccggc cggatgttac cgagagcgag agcgggagcc ccgagtatcg gcagcagtca 1320 gcagtgcccc tggacgaaga gacccacgca ggcgaggacg tggcggtgtt cgcgcgcggc 1380 ccgcaggcgc acctggttca cggcgtgcag gagcagacct tcatagcgca cgtcatggcc 1440 ttcgccgcct gcctggagcc ctacaccgcc tgcgacctgg cgccccccgc cggcaccacc 1500 gacgccgcgc acccgggtta ctctagagtc ggggcggccg gccgcttcga gcagacagga 1560 gcaaccaact tttccctgct gaagcaggca ggcgacgtgg aggagaatcc tggacccatg 1620 gccctgtgga tgcgctagct gcccctgctg gccctgctcg tcctctggga gcccaagcct 1680 gcccaggctt ttgtcaaaca gcacctttgt ggtcctcacc tggtggaggc tctgtacctg 1740 gtgtgtgggg aacgtggttt cttctacaca cccaagtccc gtcgtaaaag ggaggacccg 1800 caagtgccac aactggagct gggtggaggc ccggaggccg gggatcttca gaccttggca 1860 ctggaggttg cccggcagaa gcgtggcatt gtggatcagt gctgcaccag catctgctcc 1920 ctctaccaac tggagaacta ctgcaactga 1950

Claims

1. A gene translation system regulated by non-natural amino acids, characterized in that, It consists of three parts: aminoacyl-tRNA synthetase, orthogonal tRNA molecular pairs, and the gene sequence of the target protein containing a stop codon in the reading frame; The aminoacyl-tRNA synthetase is either tyrosine aminoacyl-tRNA synthetase or pyrrolidone-lysine aminoacyl-tRNA synthetase. The non-natural amino acid is oxy-methyltyrosine or Nε-(tert-butoxycarbonyl)-L-lysine; The gene sequence of the target protein is a reporter gene, or a gene sequence that simultaneously expresses a reporter gene and a functional protein; the target protein is a transcription factor or a drug protein. The target protein is a secretory alkaline phosphatase, and the stop codon introduction site in its reading frame is SEAP(V27TAG); or The gene sequence that simultaneously expresses the reporter gene and the functional protein is SEAP(V27TAG)-P2A-INS(F7TAG); The transcription factor is tTA, and the stop codon introduction site in its reading frame is tTA(K46TAG); or The drug protein is insulin, and the stop codon introduction site in its reading frame is INS(F7TAG); The tRNA is a tyrosine tRNA orthogonal to the tyrosine aminoacyl-tRNA synthetase in a eukaryotic system, and its antisense codon is UAG; or The tRNA is a pyrrolidone aminoacyl-tRNA orthogonal to the pyrrolidone aminoacyl-tRNA synthetase in a eukaryotic system, and its antisense codon is UAG; The stop codon is TAG.

2. A eukaryotic expression vector, characterized in that, Including the non-natural amino acid-regulated gene translation system as described in claim 1.

3. Engineered cells, characterized in that, This includes the non-natural amino acid-regulated gene translation system as described in claim 1 or the eukaryotic expression vector as described in claim 2.

4. The engineered cell as described in claim 3, characterized in that, Including one or more of HEK293 series cells, human stem cells, or animal stem cells.

5. Microcapsules, characterized in that, Includes one or more of the non-natural amino acid-regulated gene translation system as described in claim 1, the eukaryotic expression vector as described in claim 2, or the engineered cells as described in claim 3 or 4.

6. A hollow fiber tube, characterized in that, Includes one or more of the non-natural amino acid-regulated gene translation system as described in claim 1, the eukaryotic expression vector as described in claim 2, or the engineered cells as described in claim 3 or 4.

7. The composition, characterized in that, The combination of one or more of the following: a gene translation system regulated by non-natural amino acids as described in claim 1; a eukaryotic expression vector as described in claim 2; an engineered cell as described in claim 3 or 4; a microcapsule as described in claim 5; or a hollow fiber tube as described in claim 6; with non-natural amino acids.

8. The non-natural amino acid-regulated gene translation system of claim 1, the eukaryotic expression vector of claim 2, the engineered cell of claim 3 or 4, the microcapsule of claim 5, the hollow fiber tube of claim 6, or the composition of claim 7, for the application in protein translation regulation, transcription-translation binding regulation, or in biological computing.

9. The use of the non-natural amino acid-regulated gene translation system of claim 1, the eukaryotic expression vector of claim 2, the engineered cell of claim 3 or 4, the microcapsule of claim 5, the hollow fiber tube of claim 6, or the composition of claim 7 in the preparation of a medicament for the prevention and / or treatment of a disease; The disease in question is diabetes. The target protein is insulin.

10. A medicine for the prevention and / or treatment of diabetes, characterized in that, The invention includes a non-natural amino acid-regulated gene translation system as described in claim 1, a eukaryotic expression vector as described in claim 2, engineered cells as described in claim 3 or 4, microcapsules as described in claim 5, hollow fiber tubes as described in claim 6, or a composition as described in claim 7, and pharmaceutically acceptable excipients. The target protein is insulin.

Citation Information

Patent Citations

  • Ultra-remote intelligent diagnosis and treatment system for diabetes and application of system in treatment of diabetes

    CN108720848A

  • Proteins containing multiple, different unnatural amino acids and methods of making and using such proteins

    WO2021072129A2