An ELISA antibody detection kit for avian infectious bronchitis virus nsp4 and its application

Abstract

The present invention discloses an ELISA antibody detection kit for avian infectious bronchitis virus nsp4 and its application, belonging to the field of immunological detection methods. The kit uses recombinant non-structural protein 4 of avian infectious bronchitis virus as the coating antigen; the nucleotide sequence of the coding gene of the recombinant non-structural protein 4 of avian infectious bronchitis virus is as shown in SEQ ID NO: 3, and its amino acid sequence is as shown in SEQ ID NO: 2. The present invention has successfully established an indirect ELISA detection kit and method for antibodies against non-structural protein 4 of avian infectious bronchitis virus. This method has high specificity, strong sensitivity, and good repeatability. The coefficient of variation of within-batch repeatability is 4.6%, and the coefficient of variation of between-batch repeatability does not exceed 7%. It can be applied to the detection of large-scale serum samples, providing a new selection method for serological diagnosis and immune monitoring of IBV, and having good prospects for popularization and application.

Description

Technical Field

[0001] The present invention relates to the field of immunological detection methods, and particularly to an ELISA antibody detection kit for avian infectious bronchitis virus nsp4 and its application. Background Art

[0002] Avian infectious bronchitis (IB) is one of the important diseases affecting poultry farming caused by avian infectious bronchitis virus (IBV). It can cause chicken death, reduced egg production in laying hens, and reduced feed conversion rate in broilers. It has extremely strong infectivity and is a class II animal disease in China. The proteins encoded by the IBV genome include structural proteins, non-structural proteins (nsp), and accessory proteins. Among them, IBV has 15 non-structural proteins (nsp2 - 16). The IBV genome is prone to mutation, resulting in numerous serotypes. The cross-protection ability between different serotypes is weak, which brings great difficulties to the diagnosis and prevention of this disease.

[0003] Currently, the main diagnostic methods for the differential diagnosis of IBV include virus isolation and identification, serological diagnosis, and molecular biological diagnosis. In serological detection methods, ELISA is widely used due to its characteristics of rapidity, simplicity, accuracy, and specificity and has been determined as a standard method by the World Organization for Animal Health (OIE). Li Min established a double-antibody sandwich ELISA method for IBV M protein; Wang Xin established an indirect ELISA method for N protein to detect IB antibodies; Wang Jianzhong et al. established an indirect ELISA method after prokaryotic expression of the S1 protein of the M41 strain. In addition to establishing ELISA methods for structural proteins, relevant methods have also been established for accessory proteins and non-structural proteins. Dai Xu established an indirect ELISA method for the accessory protein 5b of IBV; Lei Jing established an indirect ELISA method for nsp5 protein, and its sensitivity and accuracy are quite good compared with IFA and commercial kits. The ELISA method is simple to operate and low in cost, and is suitable for large-scale screening of chicken flocks and evaluation of immune effects. The commonly used ELISA methods include the indirect method and the sandwich method. The sandwich method is more suitable for detecting IBV in diseased materials and allantoic fluid, but the virus content needs to reach the TOC median infectious dose of 10 -5 to be detected, and the requirements for samples are relatively high. The indirect method is more suitable for the detection of antibodies. Compared with the sandwich method, this method is simpler, easier to operate, and more applicable to the antibody screening of a large number of samples.

[0004] The current commercially available IDEXX antibody detection kits for IBV use whole virus particles of M41 for coating. However, M41 is not the dominant prevalent strain at present. Its cross-reactivity with local strains of different serotypes varies greatly. Coupled with the difficulties in purifying live viruses, the risk of spreading viruses, and the high detection cost, it is impossible to distinguish between inactivated vaccine immunity and wild virus infection, which limits the application of commercially available IBV antibody detection kits. Most of the ELISA kits developed by other domestic teams use N protein for coating, and the antibodies detected are group-specific antibodies, which also cannot distinguish between inactivated vaccine immunity and wild virus infection. The non-structural protein is extremely stable in structure and function, does not bind to form mature viruses, and does not participate in the composition of virus particles. Establishing an indirect ELISA targeting the non-structural protein has the potential to distinguish between inactivated vaccine immunity and IBV live virus infection.

[0005] At present, there has been no report on a serological detection method using the non-structural protein 4 of IBV as a detection antigen. Summary of the Invention

[0006] The object of the present invention is to provide an avian infectious bronchitis virus nsp4 ELISA antibody detection kit and its application to solve the problems existing in the above-mentioned prior art. The kit uses the non-structural protein 4 of IBV as the coating antigen, has low cost, and has the advantages of convenient and fast use, high sensitivity, and good specificity, providing a new and effective detection means for IBV antibody monitoring, epidemiological investigation, and future disease purification of IBV.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides an avian infectious bronchitis virus nsp4 ELISA antibody detection kit, and the kit uses the recombinant non-structural protein 4 of avian infectious bronchitis virus (IBV nsp4) as the coating antigen.

[0009] Further, the nucleotide sequence of the coding gene of the recombinant non-structural protein 4 of avian infectious bronchitis virus is as shown in SEQ ID NO: 3, and its amino acid sequence is as shown in SEQ ID NO: 2.

[0010] Further, the preparation method of the coating antigen includes the following steps:

[0011] Connect the coding gene of the recombinant non-structural protein 4 of avian infectious bronchitis virus with a prokaryotic expression vector, transform it into a host bacterium for induction expression to obtain a bacterial solution, and then perform ultrasonic disruption and purification to harvest the coating antigen.

[0012] Further, the prokaryotic expression vector is pCZN-1, and the host bacterium is Escherichia coli.

[0013] Further, it also includes an enzyme-labeled secondary antibody, a blocking solution, a washing solution, a dilution solution, a positive control sample, a negative control sample, a chromogenic solution, and a termination solution.

[0014] Further, the enzyme-labeled secondary antibody is a horseradish peroxidase-labeled goat anti-chicken IgG antibody (HRP-labeled Goat Anti-Mouse IgG); the positive control sample is a chicken serum against recombinant non-structural protein 4 of avian infectious bronchitis virus, and the negative control sample is a negative chicken serum.

[0015] Further, the blocking solution is PBS containing 5% skim milk powder; the washing solution is PBS containing 0.1% Tween-20; the dilution solution is PBST containing BSA and skim milk powder; the chromogenic solution is a single-component TMB chromogenic solution; the termination solution is 2M H2SO4.

[0016] The present invention also provides an ELISA detection method for avian infectious bronchitis virus antibodies, comprising the following steps:

[0017] (1) Coating antigen: Coating the recombinant non-structural protein 4 of avian infectious bronchitis virus onto an enzyme-labeled plate;

[0018] (2) Blocking: Adding the blocking solution to block for 1 - 2 h; [[ID=ID=16]]

[0019] (3) Incubating the primary antibody: Diluting the serum with the dilution solution and incubating the diluted serum for 30 - 60 min;

[0020] (4) Incubating the secondary antibody: Adding the diluted horseradish peroxidase-labeled goat anti-chicken IgG antibody and incubating for 30 - 60 min;

[0021] (5) Chromogenic reaction: Adding the chromogenic solution and performing chromogenic reaction at 37°C in the dark for 5 - 20 min;

[0022] (6) Termination: Adding the termination solution to terminate the chromogenic reaction;

[0023] (7) Result determination: Measuring the OD value at a wavelength of 450 nm with an enzyme-labeled instrument.

[0024] Further, in step (1), the coating concentration of the recombinant non-structural protein 4 of avian infectious bronchitis virus is 0.25 - 2 μg / mL; in step (2), the blocking time is 2 h; in step (3), the dilution ratio of the primary antibody is 1:50 - 1:500, and the incubation time is 30 min; in step (4), the dilution ratio of the secondary antibody is 1:2000 - 1:8000, and the incubation time is 45 min; in step (5), the chromogenic time is 10 min.

[0025] Further, in step (7), if the OD value of the serum to be tested is greater than or equal to 0.134, it is positive; otherwise, it is negative.

[0026] The present invention also provides an application of the above-mentioned kit in detecting antibodies against avian infectious bronchitis virus.

[0027] The present invention discloses the following technical effects:

[0028] The present invention has successfully established an indirect ELISA method for detecting antibodies against IBV nsp4. This method has high specificity, strong sensitivity, and good repeatability. The within-batch repeatability coefficient of variation is 4.6%, and the between-batch repeatability coefficient of variation does not exceed 7%.

[0029] The indirect ELISA method established by the present invention was used to detect a total of 400 serum samples from clinical cases and artificially infected with IBV. The positive rate was 93.75%. The coincidence rate with the IDEXX IBV antibody detection kit was 95.6%, and the Kappa value was 0.815, indicating a high degree of consistency. This method can be applied to the detection of large-scale serum samples, providing a new alternative method for the serological diagnosis and immune monitoring of IBV, and having good prospects for popularization and application. Description of the Drawings

[0030] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments. Obviously, the following-described drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0031] Figure 1 is the prediction result of antigen epitopes;

[0032] Figure 2 is the prediction result of hydrophilicity and hydrophobicity;

[0033] Figure 3 is the expression and purification of recombinant nsp4 protein; M. Protein Marker, 1. Uninduced, 2. Induced precipitate, 3. Induced supernatant, 4. Effluent after passing through the column, 5. Washing solution, 6. Protein eluate. Detailed Embodiments

[0034] The various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0035] It should be understood that the terms described in the present invention are only for describing specific embodiments and are not used to limit the present invention. In addition, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0036] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0037] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.

[0038] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0039] The materials, instruments and reagents used in the present invention can be obtained commercially without special instructions; the experimental methods used, without special instructions, are conventional experimental methods in the art.

[0040] 1 Test methods

[0041] Construction and expression of IBV nsp4 protein expression vector

[0042] According to the nsp4 nucleotide sequence of the Beaudette strain (accession number M95169.1) published on NCBI, the B-cell antigen epitope prediction was performed using the epitope prediction and analysis tool of the online analysis software IEDB Analysis Resource (http: / / www.tools.iedb.org / main / ) Figure 1 ), and the hydrophilicity and hydrophobicity prediction was performed using the DNASTAR software Figure 2 ). A segment of amino acid sequence Pep408 - 514 with good antigenicity and strong hydrophilicity (see Table 1) was selected for protein expression

[0043] The nucleotide sequence and amino acid sequence of the selected nsp4 in Table 1

[0044]

[0045]

[0046] 1.2 Construction of the prokaryotic expression vector of IBV nsp4 protein

[0047] The nucleotide sequence of the selected nsp4 protein gene (SEQ ID NO: 1) was codon-optimized for the prokaryotic expression system. The optimized nucleotide sequence of the nsp4 protein gene is shown as follows (SEQ ID NO: 3):

[0048] TGGTGCTATGGTACCACCAAAAATACCCGCAAACTGTATGATGGTAATGAATTTGTTGGCAATTACGATCTGGCCGCCAAAAGTACCTTTGTGATTCGCGGCAGTGAATTTGTTAAACTGACCAATGAAATCGGTGATAAATTTGAAGCCTATCTGAGCGCATACGCTCGCCTGAAATATTATAGCGGCACCGGCAGCGAACAGGATTATCTGCAGGCCTGTCGCGCATGGCTGGCATACGCTCTGGATCAGTATCGCAATAGCGGTGTGGAAATTGTGTATACCCCGCCGCGTTATAGCATTGGCGTTAGCCGTCTGCAG. It was commissioned to Nanjing Zhongding Biotechnology Co., Ltd. for synthesis, and then cloned into the pCZN-1 prokaryotic expression vector. The plasmid of the prokaryotic expression vector of IBV Beaudette strain nsp4 constructed was named pCZN-1-HIS-nsp4.

[0049] 1.3 Induced expression, purification and identification of the recombinant nsp4 protein

[0050] After transforming the recombinant plasmid pCZN-1-HIS-nsp4 into BL-21 competent cells, single colonies were picked and inoculated into LB liquid medium with Amp resistance. After expanded culture, IPTG was added to a final concentration of 0.2 mmol / L, and induction was carried out overnight at 16 °C and 200 rpm, with an uninduced control set. The uninduced and induced overnight bacterial solutions were centrifuged to collect the bacteria, resuspended with PBS, and sonicated after adding PMSF protease inhibitor. The supernatant was taken, filtered through a 0.45 μm filter, and protein purification was carried out according to the steps of the Ni-NTA affinity column (purchased from Nanjing Genscript Biotech Corporation). The purified protein was analyzed by SDS-PAGE again, and the mass concentration of the protein was determined using a BCA kit (purchased from Suzhou New Saimei Biotechnology Company) according to the steps of the instruction manual.

[0051] The results of the induced expression and purification of the recombinant nsp4 protein are as Figure 3 shown. The bacterial solution before induction, as well as the supernatant and precipitate after induction, fragmentation, and centrifugation, were purified and subjected to SDS-PAGE electrophoresis. After Coomassie brilliant blue staining, protein expression was visible in both the supernatant after induction, fragmentation, and the protein eluate ( Figure 3 ), and the bands were as expected. The concentration of the purified protein was determined to be 0.51 mg / mL using a BCA kit.

[0052] 2 Preparation of IBV nsp4 positive and negative sera

[0053] After immunizing SPF chickens three times with the purified recombinant nsp4 protein at a dose of 1 mg per chicken, the immune chicken sera were collected and separated. After verifying that the sera contained high-titer anti-nsp4 antibodies using indirect immunofluorescence assay (IFA), they were aliquoted and stored at -70 °C as IBV nsp4 positive sera. The sera of non-immunized SPF chickens, which were verified to be negative for IBV nsp4 antibodies using IFA, were aliquoted and stored at -70 °C as IBV nsp4 negative sera.

[0054] 3 Optimization of the indirect ELISA method

[0055] 3.1 Operating steps of the indirect ELISA

[0056] (1) Antigen coating: The purified recombinant nsp4 protein was used as the antigen and diluted to a certain concentration with coating buffer and then added to the enzyme-linked immunosorbent assay (ELISA) plate, 100 μL per well. After incubation in a humid box at 37 °C for 2 hours, it was placed in a 4 °C refrigerator for overnight coating. Then, it was washed 3 times with washing solution (PBST), 200 μL of washing solution per well, 3 min per wash. Unbound antigen and impurities were removed.

[0057] (2) Blocking: After draining the liquid in the plate, 200 μL of 5% skim milk blocking solution was added to each well, and the plate was blocked in a humid box at 37 °C for 2 h. The liquid was discarded, and it was washed (to remove specificity) 3 times as above;

[0058] (3) Add primary antibody: After diluting the serum to be tested at a certain concentration, add 100 μL to each well. At the same time, set the positive control as the positive serum of IBV nsp4 and the negative control as the negative serum of IBV nsp4; Incubate in a humid box at 37 °C for 45 min, and wash 3 times as above;

[0059] (4) Add secondary antibody (HRP-labeled Goat Anti-Mouse IgG): After diluting the secondary antibody to a certain concentration with PBST, add 100 μL to each well. Incubate in a humid box at 37 °C for 45 min, and wash 3 times as above;

[0060] (5) Add substrate for color development: Add 100 μL of TMB chromogenic solution to each well, and develop color in the dark in a humid box at 37 °C for 15 min;

[0061] (6) Terminate the reaction: Add 50 μL of termination solution to each well to end the reaction;

[0062] (7) Measure the value: Read the absorbance (OD value) with an enzyme-linked immunosorbent assay (ELISA) reader at a wavelength of 450 nm.

[0063] Using the positive serum of IBV nsp4 as the positive control, denoted as the P value, and the negative serum of IBV as the negative control, denoted as the N value, perform indirect ELISA. By processing the experimental data, calculate the P / N value, and take the maximum P / N value as the best condition for judging the indirect ELISA reaction.

[0064] 3.2 Optimization and exploration of the optimal coating concentration and the detection concentration of the primary antibody

[0065] Use the purified nsp4 protein as the antigen, and dilute it with coating buffer to 0.25 μg / mL, 0.5 μg / mL, 1 μg / mL, and 2 μg / mL in turn. Add 100 μL to each well, incubate in a humid box at 37 °C for 2 h, and then place it overnight in a refrigerator at 4 °C. Wash to remove non-specific binding and then block. Then, dilute the positive control serum 1:50, 1:100, 1:200, 1:300, 1:400, and 1:500 times and add it to the ELISA plate, and perform the steps as described. After the operation is completed, read the OD 450nm value, and calculate and analyze to obtain the optimal antigen coating concentration and the detection concentration of the primary antibody.

[0066] 3.3 Optimization and exploration of the optimal detection concentration of the enzyme-labeled secondary antibody

[0067] Conduct experiments according to the optimal antigen coating concentration and the detection concentration of the primary antibody. Dilute the secondary antibody 1:2000, 1:3000, 1:4000, 1:5000, 1:6000, and 1:8000 times respectively. After the operation is completed, read the OD 450nm value, and calculate and analyze to obtain the optimal detection concentration of the enzyme-labeled secondary antibody.

[0068] 3.4 Optimization and Exploration of the Optimal Incubation Time of the Primary Antibody

[0069] Conduct experiments according to the optimal antigen coating concentration, primary antibody detection concentration, and optimal detection concentration of the enzyme-labeled secondary antibody. The primary antibody was incubated for 30 min, 45 min, and 60 min respectively, and the OD was read on an enzyme-linked immunosorbent assay (ELISA) reader 450nm After calculating and analyzing the values, the optimal incubation time of the primary antibody was obtained

[0070] 3.5 Optimization and Exploration of the Optimal Incubation Time of the Enzyme-Labeled Secondary Antibody

[0071] Conduct experiments according to the optimal antigen coating concentration, primary antibody detection concentration, primary antibody incubation time, and optimal detection concentration of the enzyme-labeled secondary antibody. The incubation time of the secondary antibody was 30 min, 45 min, and 60 min respectively, and the OD was read on an ELISA reader 450nm After calculating and analyzing the values, the optimal incubation time of the secondary antibody was obtained

[0072] 3.6 Optimization and Exploration of the Optimal Blocking Time

[0073] Coat according to the optimal antigen coating concentration, and the blocking time was 1 h and 2 h respectively. After blocking, conduct experiments according to the optimal primary antibody detection concentration, primary antibody incubation time, secondary antibody detection concentration, and optimal secondary antibody incubation time, and read the OD on an ELISA reader 450nm After calculating and analyzing the values, the optimal blocking time was obtained

[0074] 3.7 Optimization and Exploration of the Optimal Color Development Time

[0075] Conduct experiments according to the optimal antigen coating concentration, blocking time, primary antibody detection concentration, primary antibody incubation time, secondary antibody detection concentration, and secondary antibody incubation time. The color development time was 5 min, 10 min, 15 min, and 20 min respectively, and the OD was read on an ELISA reader 450nm After calculating and analyzing the values, the optimal color development time was obtained

[0076] 3.8 Determination of the Positive and Negative Cutoff Value [[ID=3�]]

[0077] Take 50 negative sera of infectious bronchitis virus (IBV), conduct ELISA reactions according to the optimal conditions obtained from the experimental exploration, and calculate the mean value (X) and standard deviation (SD) based on the OD values of the 50 serum samples. The positive and negative cutoff value is equal to the mean value X + 3SD. Samples with OD values greater than or equal to this value are positive, and vice versa are negative 450nm After calculating and analyzing the values, the optimal color development time was obtained

[0078] 3.9 Specificity Test

[0079] Take the standard positive sera of IBDV, ALV, MDV, NDV, ILTV, as well as the positive and negative sera of IBV, and detect them by the established indirect ELISA method. Determine the specificity of the established method by detecting the serum cross-reaction situation.

[0080] 3.10 Sensitivity test

[0081] Select the positive control serum diluted 1:200, 1:400, 1:800, 1:1600, 1:3200, 1:6400, 1:12800, 1:25600 times, and detect the OD 450nm value according to the established indirect ELISA method, analyze the detection results, and judge the sensitivity of the method.

[0082] 3.11 Repeatability test

[0083] According to the indirect ELISA method established in this study, select 10 replicates of IBV positive serum on the enzyme-linked immunosorbent assay (ELISA) plates coated at the same time for within-batch repeatability test. Then select 3 batches of nsp4 proteins prepared at different batches, coat them according to the established indirect ELISA method, and then perform between-batch repeatability test on IBV positive serum, also with 10 replicates. Perform statistical analysis on the detection results. According to the coefficient of variation formula: C.V% = SD / X × 100%, calculate its coefficient of variation and judge the repeatability of the method.

[0084] 3.12 Clinical application

[0085] Detect 400 chicken serum samples at 7 dpi, 14 dpi, 21 dpi after artificial infection with IBV and serum samples collected from 7 different farms according to the indirect ELISA method established in this study.

[0086] 3.13 Comparison with the detection results of the kit

[0087] Randomly select 92 serum samples, detect them respectively by the indirect ELISA method established in this study and the IDEXX IBV antibody detection kit, calculate the coincidence rate of the two methods, and compare the consistency of the indirect ELISA method established and the detection results of the kit by calculating the Kappa value (Table 2). The Kappa value ranges from -1 to 1, and a Kappa value greater than 0.6 can indicate a high degree of consistency.

[0088] Table 2 Calculation method of Kappa value

[0089]

[0090] Note: Kappa value = P0 - P e / 1 - P e; P0 = a + d / N; P e = [(N1*N3) / N + (N2*N4) / N] / N.

[0091] 4 Results

[0092] 4.1 Optimal Coating Concentration and Primary Antibody Detection Concentration

[0093] After analyzing and calculating the detection results, when the coating concentration is 2 μg / mL and the primary antibody dilution is 1:100, the P / N value is the largest (Table 3), which is the optimal coating concentration and primary antibody detection concentration.

[0094] Table 3 Optimization of Optimal Coating Concentration and Primary Antibody Detection Concentration

[0095]

[0096]

[0097] 4.2 Optimal Detection Concentration of Enzyme-Labeled Secondary Antibody

[0098] After analyzing and calculating the detection results, when the enzyme-labeled secondary antibody dilution is 1:4000, the P / N value is the largest (Table 4), which is the optimal detection concentration of the enzyme-labeled secondary antibody.

[0099] Table 4 Optimization of Optimal Detection Concentration of Enzyme-Labeled Secondary Antibody

[0100]

[0101] 4.3 Optimal Incubation Time of Primary Antibody

[0102] After analyzing and calculating the detection results, when the incubation time of the primary antibody is 30 min, the P / N value is the largest (Table 5), which is the optimal incubation time of the primary antibody.

[0103] Table 5 Optimization of Optimal Incubation Time of Primary Antibody

[0104]

[0105] 4.4 Optimal Incubation Time of Enzyme-Labeled Secondary Antibody

[0106] After analyzing and calculating the detection results, when the incubation time of the enzyme-labeled secondary antibody is 45 min, the P / N value is the largest (Table 6), which is the optimal incubation time of the enzyme-labeled secondary antibody.

[0107] Table 6 Optimization of Optimal Incubation Time of Enzyme-Labeled Secondary Antibody

[0108]

[0109] 4.5 Optimal Blocking Time

[0110] After analyzing and calculating the test results, when the sealing time is 2 h, the P / N value is the largest (Table 7), which is the optimal sealing time.

[0111] Table 7 Optimization of the Optimal Sealing Time

[0112]

[0113] 4.6 Optimal Chromogenic Time

[0114] After analyzing and calculating the test results, when the chromogenic time is 10 min, the P / N value is the largest (Table 8), which is the optimal chromogenic time.

[0115] Table 8 Optimization of the Optimal Chromogenic Time

[0116]

[0117] 4.7 Positive and Negative Critical Values

[0118] After determination and calculation, the positive and negative critical value is 0.134 (Table 9). For the test sample, if the OD 450nm value is greater than or equal to this value, it is positive; otherwise, it is negative.

[0119] Table 9 Determination of the Positive and Negative Critical Values

[0120]

[0121] 4.8 Specificity Test

[0122] Using the IBDV, ALV, MDV, NDV, ILTV standard positive sera, as well as the IBV positive and negative sera as the primary antibodies, and detecting them using the established indirect ELISA method. The results show that only the IBV positive serum has a positive reaction, and the rest are negative (Table 10), indicating that the method has good specificity.

[0123] Table 10 Specificity Test Results

[0124]

[0125] 4.9 Sensitivity Test

[0126] Select the positive control serum diluted 1:200, 1:400, 1:800, 1:1600, 1:3200, 1:6400, 1:12800, 1:25600 times, and detect them using the established indirect ELISA method. The results show that when the dilution of the positive control serum is 1:3200, it can still be detected as positive (Table 11), indicating that the method has good sensitivity.

[0127] Table 11 Sensitivity Test Results

[0128]

[0129] 4.10 Repeatability Test

[0130] According to the indirect ELISA method established in this study, 10 replicates of IBV positive serum were selected on the enzyme-labeled plates coated at the same time for within-batch repeatability test. The coefficient of variation was calculated based on the measured OD 450nm values. The coefficient of variation of the within-batch repeatability test was 4.6% (Table 12). Then, three different batches of nsp4 proteins were selected and coated according to the established indirect ELISA method, and the between-batch repeatability test was carried out on IBV positive serum. Similarly, 10 replicates were made. By calculating, the coefficients of variation of the between-batch repeatability test were 6.2%, 3.5%, and 4.6% respectively (Table 13). The results of the repeatability test showed that the coefficients of variation of this method did not exceed 7%, indicating good repeatability.

[0131] Table 12 Results of within-batch repeatability test

[0132]

[0133] Table 13 Results of between-batch repeatability test

[0134]

[0135] 4.11 Clinical Application

[0136] According to the indirect ELISA method established in this study, 400 chicken serum samples after artificial infection with IBV at 7 dpi, 14 dpi, and 21 dpi and serum samples collected from 7 different farms were detected. A total of 375 positive samples and 25 negative samples were detected, and the positive rate was 93.75%. Most of the negative samples were from chickens artificially infected with IBV at 14 dpi and 21 dpi (Table 14).

[0137] Table 14 Results of clinical application

[0138]

[0139] 4.12 Comparison with the detection results of the kit

[0140] Ninety-two serum samples were randomly selected and detected by the indirect ELISA method established in this study and the IDEXX IBV antibody detection kit (purchased from IDEXX). Among the 92 samples, 88 samples were consistent with the detection results of the kit, and the coincidence rate was 95.6%. The Kappa value = 0.815 was calculated based on the detection results of the two methods (Table 15), indicating a high consistency between the established method and the kit.

[0141] Table 15 Detection results of samples by the indirect ELISA method and the kit

[0142]

[0143] 5 Conclusion Analysis

[0144] As the most commonly used serological detection method in IBV detection, ELISA has the advantages of strong specificity, good sensitivity, simple operation, and low cost. In clinical applications, it is not only used to monitor the immune status of chicken flocks and the infection status of chicken flocks, but also can be used to detect the impact of maternal antibodies on immunity. In this study, recombinant IBV nsp4 protein was used as the coating antigen to conduct specificity, sensitivity, and repeatability tests on the constructed indirect ELISA method. The results showed that the method had high specificity and only reacted with IBV, and did not react with viruses such as IBDV, ALV, MDV, NDV, and ILTV; when the positive serum was diluted 3200 times, it could still be detected, indicating that the method had strong sensitivity; when the repeatability test was carried out on it, the results showed that the within-batch repeatability coefficient of variation was 4.6%, and the between-batch repeatability coefficient of variation did not exceed 7%, and the repeatability was good, showing the stability of nsp4 as a non-structural protein. Using this method to detect 400 chicken serum samples after artificial infection with IBV at 7 dpi, 14 dpi, and 21 dpi and serum samples collected from 7 different farms, the positive rate was 93.75%, indicating that the method could detect both artificially infected IBV and clinical serum samples. Most of the negatives were chicken serum samples after artificial infection with IBV at 14 dpi and 21 dpi, which was in line with the antibody level rule after artificial infection with IBV and could be applied to large-scale antibody level detection, etc. Sampling and comparing with the IDEXX IBV antibody detection kit, the coincidence rate was 95.6%. Calculating the Kappa value showed that the consistency of the two methods was very good, indicating that this method was worthy of popularization and application.

[0145] In current research, many indirect ELISA methods have been established based on IBV structural proteins. However, with the high mutation of IBV and the possible deletion or recombination of its structural proteins, the detection values may also change accordingly. Seeking a more stable indirect ELISA method can more effectively identify and detect IBV. In this study, an indirect ELISA detection method for IBV nsp4 antibodies was established. Through experiments, it was confirmed that the method had high specificity, strong sensitivity, good repeatability, and the coefficient of variation was between 3-7%, with very good stability. It could detect both clinical serum samples and serum samples of artificially infected IBV, and could be applied to large-scale sample detection in clinical practice, contributing to the epidemiological investigation, antibody level detection, and immune effect monitoring of IBV, etc. The IDEXX IBV antibody detection kit is the gold standard for IBV antibody level detection. This method has a high coincidence rate and consistency with the kit, confirming that the indirect ELISA method and detection kit established in this invention have good application prospects.

[0146] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the spirit of the present invention's design, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. An ELISA antibody detection kit for avian infectious bronchitis virus nsp4, characterized in that, The kit uses recombinant non-structural protein 4 of avian infectious bronchitis virus as the coating antigen; The nucleotide sequence of the coding gene of the recombinant non-structural protein 4 of avian infectious bronchitis virus is shown in SEQ ID NO: 3, and its amino acid sequence is shown in SEQ ID NO:

2.

2. The kit according to claim 1, characterized in that, The preparation method of the coating antigen includes the following steps: Connect the coding gene of the recombinant non-structural protein 4 of avian infectious bronchitis virus with a prokaryotic expression vector, transform it into a host bacterium for induced expression to obtain a bacterial solution, then perform ultrasonic disruption and purification, and harvest the coating antigen.

3. The kit according to claim 2, wherein The prokaryotic expression vector is pCZN-1, and the host bacterium is Escherichia coli.

4. The kit according to claim 1, wherein It also includes an enzyme-labeled secondary antibody, a blocking solution, a washing solution, a dilution solution, a positive control sample, a negative control sample, a chromogenic solution, and a termination solution.

5. The kit according to claim 4, characterized in that, The enzyme-labeled secondary antibody is a horseradish peroxidase-labeled goat anti-chicken IgG antibody; the positive control sample is a chicken serum against recombinant non-structural protein 4 of avian infectious bronchitis virus, and the negative control sample is a negative chicken serum.

6. Use of a kit according to any one of claims 1-5 in the preparation of a product for detecting antibodies against avian infectious bronchitis virus, characterized in that, The usage method of the product includes the following steps: (1) Coating antigen: Coat the recombinant non-structural protein 4 of avian infectious bronchitis virus described in claim 1 onto an enzyme-labeled plate; (2) Blocking: Add the blocking solution and block for 1 - 2 h; (3) Incubation with primary antibody: Dilute the serum with the dilution solution and incubate the diluted serum for 30 - 60 min; (4) Incubation with secondary antibody: Add the diluted horseradish peroxidase-labeled goat anti-chicken IgG antibody and incubate for 30 - 60 min; (5) Chromogenic reaction: Add the chromogenic solution and develop color at 37°C in the dark for 5 - 20 min; (6) Termination: Add the termination solution to terminate the color development; (7) Result determination: Measure the OD value at a wavelength of 450 nm using an enzyme-labeled instrument; In step (1), the coating concentration of the recombinant non-structural protein 4 of avian infectious bronchitis virus is 1 - 2 μg / mL; in step (2), the blocking time is 2 h; in step (3), the dilution ratio of the primary antibody is 1:50 - 1:400, and the incubation time is 30 min; in step (4), the dilution ratio of the secondary antibody is 1:2000 - 1:8000, and the incubation time is 45 min; in step (5), the chromogenic reaction time is 10 min.

Images