Methods of protein manufacturing
By reducing the activity of Pep4 and/or YscB and CreA proteins, the *Talaromyces cellulolyticus* strain was modified to solve the problem of insufficient protein production capacity, achieving efficient accumulation of target proteins, especially the production of heterologous proteins.
Patent Information
- Application Number
- CN202180041772.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2020-06-11
- Filing Date
- 2021-06-08
- Publication Date
- 2026-03-13
- Estimated Expiration
- 2041-06-08
AI Technical Summary
In the prior art, the relationship between the Pep4 protein in Talamomyces cellulolyticus and protein production is unclear, leading to insufficient protein production capacity.
By reducing the activity of the Pep4 protein, combined with reducing the activity of YscB and/or CreA proteins, the production capacity of the *Talaromyces cellulolyticus* strain was enhanced.
It enhanced the protein production capacity of *Talaromyces cellulolyticus*, especially the production capacity of heterologous proteins such as antibodies, and achieved efficient accumulation of target proteins.
Smart Images

Figure BDA0003990408380000341 
Figure HDA0003990408390000011 
Figure HDA0003990408390000012
Abstract
Description
Technical Field
[0001] This invention relates to a method for manufacturing proteins. Background Technology
[0002] As a method for protein manufacturing, methods using various microorganisms such as rod-shaped bacteria, Bacillus bacteria, yeast, and filamentous fungi have been reported.
[0003] For example, Non-Patent Document 1 discloses the production of a host-derived cellulase using the filamentous bacterium *Talaromyces cellulolyticus* (formerly *Acremonium cellulolyticus*). Furthermore, Patent Document 1 discloses the production of an antibody using filamentous bacteria. Additionally, Patent Document 2 discloses the production of a lumen-containing multimeric protein using filamentous bacteria such as *Talaromyces cellulolyticus*.
[0004] Furthermore, Patent Documents 3 and 4 disclose the production of heterologous proteins from filamentous bacteria using endogenous protease activity attenuated. Furthermore, Patent Document 5 discloses the production of heterologous proteins from filamentous bacteria using endogenous alkaline protease activity attenuated.
[0005] Furthermore, Patent Document 6 discloses the production of a heterologous protein using yeast lacking carboxypeptidase yscα activity. This document also describes that the yeast may also lack peptidase activity selected from yscA, yscB, yscY, and yscS.
[0006] Furthermore, Patent Document 7 discloses the production of a protein from Talamoyces cellulolyticus that has been modified in a manner that reduces the activity of the protease YscB.
[0007] However, the relationship between the Pep4 protein in Talaromyces cellulolyticus and protein production remains unclear.
[0008] Existing technical documents
[0009] Patent documents
[0010] Patent Document 1: Japanese Patent Application Publication No. 2006-512891
[0011] Patent Document 2: Japanese Patent Application Publication No. 2016-158599
[0012] Patent Document 3: Japanese Patent Application Publication No. 2015-512611
[0013] Patent Document 4: Japanese Patent Application Publication No. 2016-523552
[0014] Patent Document 5: Japanese Patent Application Publication No. 2000-507106
[0015] Patent Document 6: Japanese Patent Application Publication No. 1990-104279
[0016] Patent Document 7: WO2019 / 073954
[0017] Non-patent literature
[0018] Non-patent document 1: Inoue H, et al., Construction of a starch-inducible homologous expression system to produce cellulolytic enzymes from Acremoniumcellulolyticus. J Ind Microbiol Biotechnol. 2013Aug; 40(8): 823-30. Summary of the Invention
[0019] The technical problem solved by the invention
[0020] The purpose of this invention is to provide a method for manufacturing proteins.
[0021] Technical means to solve the problem
[0022] In order to solve the aforementioned problem, the inventors conducted in-depth research and found that by modifying Talamomyces cellulolyticus in a way that reduces the activity of Pep4 protein, the protein production capacity of Talamomyces cellulolyticus can be improved, thus completing the present invention.
[0023] That is, the present invention is as follows.
[0024] [1] A method for manufacturing a target protein, comprising:
[0025] Talamoyces cellulolyticus, capable of producing target proteins, was cultured in a culture medium.
[0026] Compared to the unmodified strain, the *Talaromyces cellulolyticus* strain was modified in a manner that reduced the activity of the Pep4 protein.
[0027] [2] The method, wherein,
[0028] The activity of the Pep4 protein is reduced by decreasing the expression of the pep4 gene or by disrupting the pep4 gene.
[0029] [3] The method, wherein,
[0030] The activity of the Pep4 protein is reduced by the deletion of the pep4 gene.
[0031] [4] The method, wherein,
[0032] The Pep4 protein is one of the proteins described in (a), (b), or (c) below:
[0033] (a) A protein containing the amino acid sequence represented by SEQ ID NO.71;
[0034] (b) A protein comprising an amino acid sequence containing 1 to 10 amino acid residues of substitution, deletion, insertion and / or addition in the amino acid sequence represented by SEQ ID NO.71, and having protease activity;
[0035] (c) A protein containing an amino acid sequence that is more than 90% identical to the amino acid sequence represented by SEQ ID NO.71 and having protease activity.
[0036] [5] The method, wherein,
[0037] Compared to the unmodified strain, the *Talaromyces cellulolyticus* strain is also modified in a manner that reduces the activity of the YscB protein and / or the CreA protein.
[0038] [6] The method, wherein,
[0039] The activity of the YscB protein and / or the CreA protein is reduced by decreasing the expression of the yscB gene and / or the creA gene or by disrupting the yscB gene and / or the creA gene.
[0040] [7] The method, wherein,
[0041] The activity of the YscB protein and / or the CreA protein is reduced by the deletion of the yscB gene and / or the creA gene.
[0042] [8] The method, wherein,
[0043] The Talamomyces cellulolyticus strain is a modified strain derived from Talamomyces cellulolyticus S6-25 (NITE BP-01685).
[0044] [9] The method further includes the recovery of the target protein.
[0045]
[10] The method, wherein,
[0046] Through the culture, the target protein accumulates in the culture medium.
[0047]
[11] The method, wherein,
[0048] The target protein is expressed as a fusion protein with a signal peptide that functions in Talamomyces cellulolyticus.
[0049]
[12] The method, wherein,
[0050] The target protein is a heterologous protein.
[0051]
[13] The method, wherein,
[0052] The target protein is a human-derived protein.
[0053]
[14] The method, wherein,
[0054] The target protein is an antibody-associated molecule. Attached Figure Description
[0055] [ Figure 1 [Image showing the results of trastuzumab degradation based on the culture supernatant of T. cellulolyticus control strain and Δpep4 strain.]
[0056] [ Figure 2 [Image showing the results of trastuzumab production based on trastuzumab-expressing strains derived from T. cellulolyticus F09ΔyscB and its pep4 gene-disrupted strains.] Detailed Implementation
[0057] The present invention will now be described in detail.
[0058] The method of this invention is a method for manufacturing target proteins using Talamomyces cellulolyticus. The Talamomyces cellulolyticus used in this method is also referred to as "the microorganism of this invention".
[0059] <1> The microorganism of the present invention
[0060] The microorganism of the present invention is a *Talaromyces cellulolyticus* modified to reduce the activity of the Pep4 protein and possessing the ability to produce the target protein. It should be noted that in the description of the microorganism of the present invention, the microorganism of the present invention or the *Talaromyces cellulolyticus* used to construct the microorganism of the present invention is sometimes referred to as the "host".
[0061] <1-1>Talaromyces cellulolyticus
[0062] The microorganism of this invention is *Talaromyces cellulolyticus*. *Talaromyces cellulolyticus* was formerly known as *Acremonium cellulolyticus*. That is, *Acremonium cellulolyticus* was reclassified as *Talaromyces cellulolyticus* through a modification of the systematic classification (FEMS Microbiol. Lett., 2014, 351:32-41). Specifically, examples of *Talaromyces cellulolyticus* include: strain C1 (Japanese Patent Application Laid-Open No. 2003-135052), strain CF-2612 (Japanese Patent Application Laid-Open No. 2008-271927), strain TN (FERM BP-685), strain S6-25 (NITEBP-01685), strain Y-94 (FERM BP-5826, CBS 136886), and their derivative strains. It should be noted that "Talaromyces cellulolyticus" refers to the collective term for fungi classified as *Talaromyces cellulolyticus* at at least any point in time before, during, and after the application of this application. That is, for example, strains temporarily classified as *Talaromyces cellulolyticus*, such as the exemplified strains, will be treated as belonging to *Talaromyces cellulolyticus* even if the systematic classification changes in the future.
[0063] Strain S6-25 was originally deposited at the NITE International Patent Collection Center (Room 122, 2-5-8 Kazusa-zutari, Kisarazu City, Chiba Prefecture, Japan 292-0818) on August 8, 2013, and transferred to the NITE International Collection Center on November 15, 2013, under the Budapest Treaty, and assigned the accession number NITE BP-01685. Strain S6-25 is a strain obtained from the TN strain (FERM BP-685) and exhibits high cellulase production capacity. The TN strain is a strain obtained from the Y-94 strain (FERM BP-5826, CBS 136886) (Japanese Patent Application Laid-Open No. 2011-193773).
[0064] These strains can be obtained, for example, from the collections where the individual strains are deposited. Additionally, strain Y-94 can also be obtained from, for example, the CBS-KNAW Collections (Netherlands).
[0065] The microorganisms of the present invention can be obtained by modifying the exemplified strains, such as *Talaromyces cellulolyticus*. That is, the microorganisms of the present invention can be, for example, modified strains derived from the exemplified strains. Specifically, the microorganisms of the present invention can be, for example, modified strains derived from strain S6-25 or strain Y-94. More specifically, the microorganisms of the present invention can be, for example, modified strains derived from strain S6-25. There are no particular limitations on the order of modification used to construct the microorganisms of the present invention.
[0066] <1-2> Target protein production capacity
[0067] The microorganisms of the present invention possess the ability to produce target proteins. "Microorganisms possessing the ability to produce target proteins" refers to microorganisms capable of producing target proteins. Specifically, "microorganisms possessing the ability to produce target proteins" can be microorganisms that, when cultured in a culture medium, express target proteins and accumulate them in the culture to a level that allows for recovery. Specifically, "accumulation in the culture" can be accumulation in the culture medium, on the cell surface, within the cell, or a combination thereof. It should be noted that the accumulation of target proteins outside the cell (e.g., in the culture medium, on the cell surface) is also referred to as the "secretion" or "secretory production" of target proteins. That is, the microorganisms of the present invention can also possess the secretory production capacity of target proteins (the ability to secrete and produce target proteins). Target proteins, particularly, can accumulate in the culture medium. The accumulation amount of target proteins, for example, as the accumulation amount in the culture, can be 10 μg / L or more, 1 mg / L or more, 100 mg / L or more, or 1 g / L or more. The microorganisms of the present invention can possess the ability to produce one target protein, or the ability to produce two or more target proteins.
[0068] The microorganisms of the present invention may inherently possess the ability to produce target proteins, or may be modified to possess this ability. Typically, the microorganisms of the present invention may inherently possess the ability to produce cellulase. Furthermore, the microorganisms of the present invention may be modified to enhance their inherent target protein production ability. Microorganisms possessing target protein production ability can be obtained, for example, by conferring target protein production ability upon *Talaromyces cellulolyticus* as described above, or by enhancing the target protein production ability of *Talaromyces cellulolyticus* as described above. The ability to produce target proteins can be conferred or enhanced, for example, by introducing a gene construct for expressing the target protein, introducing other modifications that enhance target protein production ability, or a combination thereof.
[0069] The microorganisms of the present invention possess at least a gene construct for expressing a target protein, and the microorganisms of the present invention have the ability to produce the target protein. Specifically, the microorganisms of the present invention can possess the ability to produce the target protein by having a gene construct for expressing a target protein, or by having a gene construct for expressing a target protein and a combination of other properties. That is, the microorganisms of the present invention possess a gene construct for expressing a target protein. The microorganisms of the present invention may have one copy of the gene construct for expressing a target protein, or two or more copies of the gene construct for expressing a target protein. The microorganisms of the present invention may have one gene construct for expressing a target protein, or two or more gene constructs for expressing a target protein. The copy number and the number of types of gene constructs for expressing a target protein can be read as the copy number and the number of types of the target protein gene, respectively.
[0070] In the microorganisms of the present invention, the gene constructs for expressing the target protein can exist on a vector that autonomously replicates outside the chromosome, such as a plasmid, or can be incorporated into the chromosome. That is, the microorganisms of the present invention can, for example, have gene constructs for expressing the target protein on a vector; in other words, they can have vectors containing gene constructs for expressing the target protein. Furthermore, the microorganisms of the present invention can, for example, have gene constructs for expressing the target protein on the chromosome. If the microorganisms of the present invention have two or more gene constructs for expressing the target protein, then these gene constructs are maintained in the microorganisms of the present invention in a manner capable of producing the target protein. For example, these gene constructs can all be maintained on a single expression vector, or they can all be maintained on the chromosome. Furthermore, these gene constructs can be maintained on multiple expression vectors, or they can be maintained on a single or multiple expression vectors and on the chromosome, respectively.
[0071] The microorganisms of the present invention may originally possess a gene construct for expressing a target protein, or may be modified to possess a gene construct for expressing a target protein. Typically, the microorganisms of the present invention originally possess a gene construct for expressing cellulase. Furthermore, the microorganisms of the present invention may also introduce a gene construct for expressing a target protein instead of the originally possessed gene construct, or additionally introduce a gene construct for expressing a target protein. Microorganisms possessing a gene construct for expressing a target protein can be obtained by introducing the gene construct for expressing a target protein into *Talaromyces cellulolyticus* as described above.
[0072] "A gene construct for expressing a target protein" refers to a gene expression system configured to express a target protein. A gene construct for expressing a target protein is also called a "target protein expression system," a "target protein expression unit," or a "target protein expression cassette." A gene construct for expressing a target protein contains a promoter sequence and a base sequence encoding the target protein in the 5' to 3' direction. The promoter sequence is also simply referred to as a "promoter." The base sequence encoding the amino acid sequence is also referred to as a "gene." For example, the base sequence encoding the target protein is referred to as a "gene encoding the target protein" or a "target protein gene." The target protein gene is linked in such a way that it expresses the target protein under the control of the promoter downstream of the promoter. Furthermore, the gene construct for expressing a target protein may have effective control sequences (operons, terminators, etc.) for expressing the target protein at appropriate functional locations. It should be noted that, in this invention, unless otherwise specified, "expression of the target protein gene," "expression of the target protein," "generation of the target protein," and "production of the target protein" can be used synonymously. Gene constructs used to express target proteins can be appropriately designed based on various conditions such as the type of target protein.
[0073] There are no particular limitations on the promoter as long as it can function in *Talaromyces cellulolyticus*. "A promoter that functions in *Talaromyces cellulolyticus*" refers to a promoter that has promoter activity in *Talaromyces cellulolyticus*, that is, promoters with gene transcriptional activity.
[0074] Promoters can be host-derived or heterologous. They can be intrinsic promoters of the target protein gene or promoters of other genes. Furthermore, promoters can be inducible or constitutive. Examples of promoters include the promoter of cellulase genes in microorganisms. Specifically, the promoter of the cellulase gene in *Talaromyces cellulolyticus* can be cited. Examples of cellulase genes include the cbhI gene (also called the cbh1 gene) and the cbhII gene (also called the cbh2 gene). That is, examples of promoters include the promoters of the cbhI gene and the cbhII gene. The promoter of the cbhI gene is also referred to as the "cbhI promoter" or "cbh1 promoter." The promoter of the cbhII gene is also referred to as the "cbhII promoter" or "cbh2 promoter." SEQ ID NO. 63 shows the base sequence of the cbhII promoter of *Talaromyces cellulolyticus*. That is, the promoter can be a promoter having, for example, the base sequence of the exemplified promoter (e.g., the base sequence of SEQ ID NO. 63). Furthermore, the promoter can be a conserved variant of the exemplified promoter (e.g., a promoter having the base sequence of SEQ ID NO. 63). That is, for example, the exemplified promoter can be used as is or with appropriate modification. The terms "cbhI promoter" and "cbhII promoter" include, in addition to the exemplified cbhI and cbhII promoters, their conserved variants. For conserved variants of the promoter, reference can be made to the description of conserved variants of the pep4 gene described later. For example, as long as the original function is maintained, the promoter can be DNA with a base sequence having at least 80%, preferably at least 90%, more preferably at least 95%, more preferably at least 97%, and particularly preferably at least 99% identity with the base sequence of SEQ ID NO. 63. It should be noted that the "original function" of a promoter refers to the function of expressing (e.g., inducibly or constitutively) the gene directly downstream of it. For example, the function of a promoter can be confirmed by confirming gene expression. For instance, reporter genes can be used to confirm gene expression.
[0075] There are no particular limitations on the target protein. The target protein can be a host-derived protein or a heterologous protein. In this invention, a "heterologous protein" refers to a protein that is exogenous to *Talaromyces cellulolyticus*, the organism that produces the protein. Target proteins can be, for example, proteins derived from microorganisms, plants, animals, viruses, or proteins with artificially designed amino acid sequences. Target proteins, in particular, can be human-derived proteins. Target proteins can be monomeric or multimeric proteins. Multimeric proteins are proteins consisting of two or more subunits that exist as a polymer. In a multimer, the subunits can be linked by covalent bonds such as disulfide bonds, or by non-covalent bonds such as hydrogen bonds or hydrophobic interactions, or by combinations thereof. Preferably, the multimer contains one or more intermolecular disulfide bonds. The multimer can be a homopolymer composed of a single type of subunit or a heteropolymer composed of two or more types of subunits. It should be noted that "the target protein is a heteromeric protein" means that, in the case of a heteromeric protein, at least one subunit constituting the multimer must be a heteromeric protein. That is, all subunits can be heterologous, or only some subunits can be heterologous. The target protein can be a secreted protein or a non-secreting protein. Secreted proteins can be naturally secreted proteins or naturally non-secreting proteins, preferably naturally secreted proteins. Furthermore, the term "protein" also includes substances called peptides, such as oligopeptides and polypeptides.
[0076] Target proteins can be categorized as follows: enzymes, physiologically active proteins, receptor proteins, antigen proteins, and any other proteins.
[0077] Examples of enzymes include: cellulase, xylanase, glutaminase, protein glutaminase, protein asparaginase, isomaltod extranase, protease, endopeptidase, exopeptidase, aminopeptidase, carboxypeptidase, collagenase, chitinase, gamma-glutamylvaline synthase, glutamate-cysteine ligase, and glutathione synthase.
[0078] In this invention, "cellulase" is a general term for enzymes that catalyze the hydrolysis of glycosidic bonds contained in cellulose. Examples of cellulases include: endoglucanase (EC 3.2.1.4), exoglucanase (EC 3.2.1.91), and cellobiase (EC 3.2.1.21). Furthermore, depending on the matrix used in the activity assay, cellulase is also referred to as avicelase, filter paper cellulase (FPase), carboxymethyl cellulase (CMCase), etc. Examples of cellulases include, for example, cellulases from fungi such as *Trichoderma reesei* and *Talaromyces cellulolyticus*, and bacteria such as *Clostridium thermocellum*.
[0079] Examples of glutamyl transaminases include, for example, secretory glutamyl transaminases from actinomycetes such as *Streptoverticillium mobaraense* IFO 13819 (WO01 / 23591), *Streptoverticillium cinnamoneum* IFO 12852, *Streptoverticillium griseocarneum* IFO 12776, and *Streptomyces lydicus* (WO9606931), and filamentous fungi such as *Oomycetes* (WO9622366). Examples of protein glutaminases include, for example, the protein glutaminase of *Chryseobacterium proteolyticum* (WO2005 / 103278). Examples of isomaltose glucanases include, for example, the isomaltose glucanase of *Arthrobacter globiformis* (WO2005 / 103278).
[0080] Examples of physiologically active proteins include growth factors, hormones, cytokines, and antibody-related molecules.
[0081] As growth factors, specific examples include: epidermal growth factor (EGF), insulin-like growth factor-1 (IGF-1), transforming growth factor (TGF), nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), vascular endothelial growth factor (VEGF), granulocyte-colony stimulating factor (G-CSF), granulocyte-macrophage-colony stimulating factor (GM-CSF), platelet-derived growth factor (PDGF), erythropoietin (EPO), thrombopoietin (TPO), and acidic fibroblast growth factor (AGF). Fibrosis growth factor (aFGF or FGF1), basic fibroblast growth factor (bFGF or FGF2), keratinocyte growth factor (KGF-1 or FGF7, KGF-2 or FGF10), hepatocyte growth factor (HGF), stem cell factor (SCF), and activins. Examples of activins include activins A, C, and E.
[0082] As hormones, examples include: insulin, glucagon, somatostatin, human growth hormone (hGH), parathyroid hormone (PTH), calcitonin, and exenatide.
[0083] Cytokines, specifically, include, for example, interleukins, interferons, and tumor necrosis factor (TNF).
[0084] It should be noted that growth factors, hormones, and cytokines do not need to be strictly distinguished from each other. For example, physiologically active proteins can belong to any one of the groups selected from growth factors, hormones, and cytokines, or they can belong to multiple groups of these.
[0085] Furthermore, a physiologically active protein can be the protein as a whole or a part thereof. As a part of a protein, for example, a physiologically active portion can be cited. Specifically, as a physiologically active portion, teriparatide, a physiologically active peptide containing the N-terminal 34 amino acid residues of the mature form of parathyroid hormone (PTH), can be cited as an example.
[0086] "Antibody-associated molecules" refer to proteins that comprise a molecular species consisting of a single domain or a combination of two or more domains selected from the domains constituting a complete antibody. Examples of domains constituting a complete antibody include VH, CH1, CH2, and CH3 as heavy chain domains, and VL and CL as light chain domains. Antibody-associated molecules only need to contain these molecular species and can be either monomeric or multimeric proteins. It should be noted that when an antibody-associated molecule is a multimeric protein, it can be a homopolymer containing a single type of subunit or a heteropolymer containing two or more types of subunits. Examples of antibody-related molecules include, for instance: intact antibodies, Fab, F(ab'), F(ab')2, Fc, dimers containing heavy chains (H chains) and light chains (L chains), Fc fusion proteins, heavy chains (H chains), light chains (L chains), single-chain Fv (scFv), sc(Fv)2, disulfide Fv (sdFv), double-chain antibodies (diabody), and VHH fragments (nanobody (registered trademark)). More specifically, examples of antibody-related molecules include trastuzumab, adalimumab, nivolumab, and VHH antibody N15.
[0087] Receptor proteins can be categorized as those that target physiologically active proteins or other physiologically active substances. Other physiologically active substances include neurotransmitters such as dopamine. Furthermore, receptor proteins can also be orphan receptors with unknown corresponding ligands.
[0088] There are no particular restrictions on antigen proteins, as long as they can elicit an immune response. Antigen proteins can be appropriately selected, for example, based on the intended target of the immune response. Antigen proteins can be used, for example, as vaccines.
[0089] In addition, other proteins include: liver-type fatty acid-binding protein (LFABP), fluorescent proteins, immunoglobulin-binding proteins, albumin, filoprotein-like proteins, and extracellular proteins. Examples of fluorescent proteins include green fluorescent protein (GFP) and monomeric red fluesscent protein (mRFP). Examples of immunoglobulin-binding proteins include Protein A, Protein G, and Protein L. Examples of albumin include human serum albumin. Examples of filoprotein-like proteins include those disclosed in WO2017 / 090665 and WO2017 / 171001.
[0090] Examples of extracellular proteins include fibronectin, hydrin, collagen, osteopontin, laminin, and partial sequences thereof. Laminins are proteins with a heterotrimeric structure comprising α, β, and γ chains. Examples of mammalian laminins include: primates such as humans, monkeys, and chimpanzees; rodents such as mice, rats, hamsters, and guinea pigs; rabbits, horses, cattle, sheep, goats, pigs, dogs, cats, and various other mammals. Humans are a particularly notable example of a mammal. The subunit chains of laminins (i.e., α, β, and γ chains) include: 5 types of α chains (α1–α5), 3 types of β chains (β1–β3), and 3 types of γ chains (γ1–γ3). Laminins form various isoforms through the combination of these subunit chains. Examples of laminin proteins include, for instance: laminin 111, laminin 121, laminin 211, laminin 213, laminin 221, laminin 311, laminin 321, laminin 332, laminin 411, laminin 421, laminin 423, laminin 511, laminin 521, and laminin 523. Examples of partial sequences of laminin proteins include laminin E8, which is the E8 fragment of a laminin protein. Specifically, laminin E8 is a protein having a heterotrimeric structure comprising an E8 fragment of an α-chain (α-chain E8), an E8 fragment of a β-chain (β-chain E8), and an E8 fragment of a γ-chain (γ-chain E8). The subunit chains of laminin E8 (i.e., α-chain E8, β-chain E8, and γ-chain E8) are collectively referred to as "E8 subunit chains". Examples of E8 subunit chains include E8 fragments of the laminin subunit chains described above. Laminin E8 forms various isoforms through combinations of these E8 subunit chains. Specifically, examples of laminin E8 include, for instance: laminin 111E8, laminin 121E8, laminin 211E8, laminin 221E8, laminin 332E8, laminin 421E8, laminin 411E8, laminin 511E8, and laminin 521E8.
[0091] Target protein genes can be used as is or with appropriate modifications. Target protein genes can be modified, for example, to obtain the desired activity. For the target protein gene and variants of the target protein, reference can be made to the description of conserved variants of the pep4 gene and Pep4 protein, as described later. For example, a target protein gene can be modified such that one or more amino acids are included in the amino acid sequence encoding the target protein through substitution, deletion, insertion, and / or addition. It should be noted that a specific protein derived from a particular species is not limited to proteins found in that species itself, but also includes proteins having the amino acid sequence of proteins found in that species and their variants. These variants may or may not be found in that species. That is, for example, "protein derived from a human" means, not limited to proteins found in the human body itself, but also includes proteins having the amino acid sequence of proteins found in the human body and their variants. Furthermore, target protein genes can have any codon replaced with its equivalent codon. For example, with regard to target protein genes, modifications can be made according to the frequency of codon usage in the host to give it the most suitable codon.
[0092] Regarding the target protein, in addition to the amino acid sequences of the target proteins exemplified above, other amino acid sequences may also be included. That is, the target protein may be a fusion protein formed with other amino acid sequences. There are no particular restrictions on the "other amino acid sequences" as long as they can produce a target protein with the desired properties. The "other amino acid sequences" may be appropriately selected according to various conditions such as their intended use. Examples of "other amino acid sequences" include: signal peptides (also called signal sequences), peptide tags, and recognition sequences of proteases. For example, the "other amino acid sequences" may be linked to the N-terminus or C-terminus of the target protein, or both. One amino acid sequence may be used as the "other amino acid sequence," or two or more amino acid sequences may be used in combination.
[0093] Signal peptides, for example, can be utilized in the secretory production of target proteins. The signal peptide can be linked to the N-terminus of the target protein. That is, in one embodiment, the gene construct for expressing the target protein may include a promoter sequence, a base sequence encoding the signal peptide, and a base sequence encoding the target protein in the 5' to 3' direction. In this case, the nucleic acid sequence encoding the target protein can be linked downstream of the nucleic acid sequence encoding the signal peptide, so that the target protein is expressed as a fusion protein formed with the signal peptide. It should be noted that in such fusion proteins, the signal peptide and the target protein may or may not be adjacent. That is, "the target protein is expressed as a fusion protein formed with the signal peptide" is not limited to the case where the target protein is adjacent to the signal peptide and expressed as a fusion protein formed with the signal peptide, but also includes the case where the target protein is expressed as a fusion protein formed with the signal peptide using other amino acid sequences. In the case of secretory production of the target protein using a signal peptide, typically, the signal peptide is cleaved during secretion, and the target protein without the signal peptide is secreted outside the bacterial cell. In other words, "the target protein is expressed as a fusion protein with the signal peptide" or "the target protein contains the signal peptide" means that as long as the target protein is expressed as a fusion protein with the signal peptide, it is not necessary for the final target protein to be a fusion protein with the signal peptide.
[0094] There are no particular restrictions on signal peptides as long as they function in Talamomyces cellulolyticus. "Signal peptides that function in Talamomyces cellulolyticus" refers to peptides that, when attached to the N-terminus of a target protein, induce the secretion of that target protein within Talamomyces cellulolyticus.
[0095] Signal peptides can be derived from the host or from a foreign source. They can be intrinsic to the target protein or from other proteins. Examples of signal peptides include the signal peptides of secretory cellulases in microorganisms. Specifically, examples include the signal peptides of secretory cellulases from *Talaromyces cellulolyticus*. Examples of secretory cellulases include the CbhI protein (also known as Cbh1 protein) encoded by the cbhI gene and the CbhII protein (also known as Cbh2 protein) encoded by the cbhII gene. That is, examples of signal peptides include the signal peptides of the CbhI and CbhII proteins. The signal peptide of the CbhI protein is referred to as the "CbhI signal peptide" or "Cbh1 signal peptide." The signal peptide of the CbhII protein is referred to as the "CbhII signal peptide" or "Cbh2 signal peptide." The amino acid sequence of the CbhI signal peptide from *Talaromyces cellulolyticus* is shown in SEQ ID NO. 72. That is, a signal peptide, for example, can be a signal peptide having the amino acid sequence of the exemplified signal peptide (e.g., the amino acid sequence of SEQ ID NO. 72). Furthermore, the signal peptide can be a conserved variant of the exemplified signal peptide (e.g., a signal peptide having the amino acid sequence of SEQ ID NO. 72). That is, for example, the exemplified signal peptide can be used as is or with appropriate modification. The terms “CbhI signal peptide” and “CbhII signal peptide” include, in addition to the exemplified CbhI and CbhII signal peptides, their conserved variants. For conserved variants of the signal peptide, reference can be made to the description of conserved variants of the Pep4 protein described later. For example, a signal peptide that retains its original function can be a peptide having an amino acid sequence in which one or more amino acids at one or more positions in the amino acid sequence of SEQ ID NO. 72 are replaced, deleted, inserted, and / or added. It should be noted that the "one or several" in the variants of the signal peptide specifically refers to, preferably, 1 to 7, more preferably 1 to 5, further preferably 1 to 3, and particularly preferably 1 to 2. Furthermore, for example, if the signal peptide retains its original function, it can be a peptide having an amino acid sequence with at least 80%, preferably at least 90%, more preferably at least 95%, further preferably at least 97%, and particularly preferably at least 99% homology with respect to the amino acid sequence of SEQ ID NO. 72. It should be noted that the "original function" of the signal peptide can be the function of inducing the secretion of the target protein upon attachment to the N-terminus of the target protein. The function of the signal peptide can be confirmed, for example, by confirming the secretion of the protein caused by attachment to the N-terminus of the protein.
[0096] Specifically, examples of peptide tags include: His tags, FLAG tags, GST tags, Myc tags, MBP (maltose-binding protein), CBP (cellulose-binding protein), TRX (thioredoxin), GFP (green fluorescent protein), HRP (horseradish peroxidase), ALP (alkaline phosphatase), and the Fc region of antibodies. Peptide tags can be used, for example, in the detection and purification of expressed target proteins.
[0097] Examples of protease recognition sequences include the HRV3C protease recognition sequence, the Factor Xa protease recognition sequence, and the proTEV protease recognition sequence. These protease recognition sequences can, for example, be utilized in the cleavage of expressed target proteins. Specifically, for example, when a target protein is expressed as a fusion protein with a peptide tag, by introducing the protease recognition sequence into the linker between the target protein and the peptide tag, the protease can cleave the peptide tag from the expressed target protein, resulting in a target protein without a peptide tag.
[0098] The N-terminal region of the final target protein can be the same as or different from the natural protein. For example, compared with the natural protein, the N-terminal region of the final target protein may have one or more amino acids added or missing. It should be noted that "one or more" refers to the number of amino acids, which varies depending on the full length and structure of the target protein. Specifically, it is preferably 1 to 20, more preferably 1 to 10, further preferably 1 to 5, and particularly preferably 1 to 3.
[0099] Furthermore, the target protein can be expressed as a protein with a precursor structure (precursor protein). When the target protein is expressed as a precursor protein, the final target protein may or may not be a precursor protein. That is, the precursor protein can be cleaved to become a mature protein. In terms of cleavage, for example, it can be carried out by a protease. When using a protease, from the viewpoint of the activity of the final protein, the precursor protein is generally preferably cleaved at a position approximately the same as the native protein, and more preferably cleaved at an exact position to obtain a mature protein identical to the native protein. Therefore, generally, a specific protease that cleaves the precursor protein at a position identical to the naturally produced mature protein is most preferred. However, as mentioned above, the N-terminal region of the final target protein may not be the same as the native protein. For example, depending on the type of target protein to be produced, the intended use, etc., a protein with an N-terminus that is 1 to a few amino acids longer or shorter than the native protein may have more suitable activity. In addition to commercially available proteases such as Dispase (manufactured by BOEHRIN GER MANNHEIM), proteases obtained from microbial cultures, such as actinomycete cultures, can be used in this invention. Such proteases can be used in their unpurified state or purified to an appropriate purity as needed.
[0100] Target protein genes, for example, can be obtained by cloning. Cloning can be achieved, for example, using nucleic acids such as genomic DNA or cDNA containing the target protein gene. Furthermore, target protein genes can also be obtained, for example, through total synthesis based on their base sequence (Gene, 60(1), 115-127(1987)). The obtained target protein gene can be used as is or after appropriate modification. That is, variants can be obtained by modifying the target protein gene. Gene modification can be performed using known methods. For example, a target mutation can be introduced into the target site of the DNA using site-specific mutagenesis. Site-specific mutagenesis methods include: PCR (Higuchi, R., 61, in PCR technology, Erlich, HAE Eds., Stockton press (1989); Carter, P., Meth. in Enzymol., 154, 382 (1987)) and phage methods (Kramer, W. and Frits, HJ, Meth. in Enzymol., 154, 350 (1987); Kunkel, TA et al., Meth. in Enzymol., 154, 367 (1987)). Alternatively, variants of the target protein gene can be synthesized. Furthermore, the obtained target protein gene can be modified by introducing a suitable promoter sequence to obtain a gene construct for expressing the target protein. It should be noted that other components of the gene construct for expressing the target protein (e.g., promoter sequence) and the gene construct for expressing the target protein can also be obtained in the same way as the target protein gene.
[0101] Gene modification can be performed using known methods. For example, a target mutation can be introduced into the DNA at a target site using site-specific mutagenesis. Examples of site-specific mutagenesis include: PCR (Higuchi, R., 61, in PCR technology, Erlich, H.A. Eds., Stockton press (1989); Carter, P., Meth. in Enzymol., 154, 382 (1987)) and phage methods (Kramer, W. and Frits, H.J., Meth. in Enzymol., 154, 350 (1987); Kunkel, T.A. et al., Meth. in Enzymol., 154, 367 (1987)).
[0102] There are no particular restrictions on the method of introducing a gene construct for expressing the target protein into *Talaromyces cellulolyticus*. "Introduction of a gene construct for expressing the target protein" means simply maintaining the gene construct within the host; specifically, it means introducing the target protein gene into the host in a manner that enables its expression. Unless otherwise specified, "introduction of a gene construct for expressing the target protein" is not limited to introducing a pre-constructed gene construct for expressing the target protein into the host, but also includes introducing a portion of the gene construct for expressing the target protein into the host and constructing the gene construct for expressing the target protein within the host. For example, the gene construct for expressing the target protein can be constructed on the chromosome by introducing the target protein gene downstream of a promoter already present in the host.
[0103] Regarding the gene construct for expressing the target protein, for example, it can be introduced into the host using a vector containing the gene construct for expressing the target protein. The vector containing the gene construct for expressing the target protein is also called a "target protein expression vector." The target protein expression vector can be constructed, for example, by linking the gene construct for expressing the target protein to a vector. Furthermore, for example, if the vector has a promoter, the target protein expression vector can be constructed by linking the target protein gene downstream of that promoter. Transformations of the host using the target protein expression vector can be performed to obtain transformants containing that vector; that is, the gene construct for expressing the target protein is introduced into the host. Regarding the vector, there are no particular restrictions as long as it can replicate autonomously within the host cells. The vector can be a single-copy vector, a low-copy vector, or a multi-copy vector. The vector can contain a marker gene for selecting transformants. The vector can also contain a promoter and a terminator for expressing the target protein gene.
[0104] Furthermore, the gene construct for expressing the target protein can be introduced into the host's chromosome. Gene introduction into the chromosome can be achieved using homologous recombination. Specifically, the host is transformed with recombinant DNA containing the gene construct for expressing the target protein, and homologous recombination occurs with the target site on the host's chromosome, thereby introducing the gene construct for expressing the target protein into the host's chromosome. The structure of the recombinant DNA used in homologous recombination is not particularly limited as long as homologous recombination can occur in the desired manner. For example, it can be linear DNA containing the gene construct for expressing the target protein. The host can be transformed with linear DNA containing sequences upstream and downstream of the chromosomal replacement site at both ends of the gene construct for expressing the target protein, and homologous recombination occurs upstream and downstream of the replacement site, replacing the replacement site with the gene construct for expressing the target protein. The recombinant DNA used in homologous recombination can contain a marker gene for selecting transformants. It should be noted that the introduction of a portion of the gene construct for expressing the target protein, such as the target protein gene or promoter, into the chromosome can also be carried out in the same manner as the introduction of the entire gene construct for expressing the target protein into the chromosome.
[0105] Marker genes can be appropriately selected based on host traits such as auxotrophic traits. For example, when a host exhibits an uracil-deficient phenotype through variations in the pyrF or pyrG genes, using the pyrF or pyrG genes as marker genes allows for the selection of strains with the targeted modification by using complementation of the uracil-deficient phenotype (i.e., non-uracil-deficient phenotype) as an indicator. Furthermore, drug resistance genes such as hygromycin resistance genes can be used as marker genes.
[0106] In terms of transformation, for example, it can be carried out using methods commonly used in the transformation of eukaryotic microorganisms such as molds and yeasts. One such method is the protoplast method.
[0107] <1-3> Reduced activity of Pep4 protein
[0108] The microorganism of the present invention is modified to reduce the activity of the Pep4 protein. Specifically, the microorganism of the present invention is modified to reduce the activity of the Pep4 protein compared to unmodified strains. More specifically, for example, the microorganism of the present invention may be modified to reduce the expression of the pep4 gene or to disrupt the pep4 gene. By modifying *Talaromyces cellulolyticus* to reduce the activity of the Pep4 protein, the target protein production capacity of the microorganism can be improved, that is, the production of target proteins based on the microorganism can be increased.
[0109] The following section describes the Pep4 protein and the pep4 gene that encodes it.
[0110] Pep4 protein is a protease. A "protease" is a protein that catalyzes reactions that hydrolyze proteins. This activity is also known as "protease activity."
[0111] The pep4 gene (containing introns) of *Talaromyces cellulolyticus* Y-94 strain (FERM BP-5826, CBS 136886) corresponds to the complementary sequence of positions 2810881–2812244 of the genome sequence registered in NCBI as NCBI ACCESSION DF933830.1. The Pep4 protein of *Talaromyces cellulolyticus* Y-94 strain is registered in NCBI as NCBI ACCESSION GAM39722.1. The base sequence of the pep4 gene (containing introns) of *Talaromyces cellulolyticus* Y-94 strain and the amino acid sequence of the Pep4 protein encoded by this gene are shown in SEQ ID NO. 70 and 71, respectively. That is, the pep4 gene can be, for example, a gene having the base sequence represented by SEQ ID NO. 70. Furthermore, the Pep4 protein can be, for example, a protein having the amino acid sequence represented by SEQ ID NO. 71. It should be noted that the expression "a gene or protein has a base sequence or amino acid sequence" can refer to a gene or protein containing that base sequence or amino acid sequence, or it can refer to a gene or protein being composed of that base sequence or amino acid sequence, unless otherwise specified.
[0112] The pep4 gene, as long as it retains its original function, can be a variant of the exemplified pep4 gene (e.g., the gene having the base sequence shown in SEQ ID NO. 70). Similarly, the pep4 protein, as long as it retains its original function, can be a variant of the exemplified pep4 protein (e.g., the protein having the amino acid sequence shown in SEQ ID NO. 71). Such variants that retain their original function are sometimes referred to as "conserved variants." In this invention, the term "pep4 gene" is not limited to the exemplified pep4 gene, but also includes its conserved variants. Similarly, the term "pep4 protein" is not limited to the exemplified pep4 protein, but also includes its conserved variants. Examples of conserved variants include, for example, the exemplified pep4 gene, homologues of the pep4 protein, and artificially modified forms.
[0113] "Maintaining the original function" means that the variant of a gene or protein has a function (activity, property) corresponding to the original gene or protein. That is, in the case of the pep4 gene, "maintaining the original function" means that the variant encodes a protein that retains its original function. Furthermore, "maintaining the original function" also means that, in the case of the Pep4 protein, the variant possesses protease activity.
[0114] Protease activity can be measured by incubating the enzyme with a matrix (protein) and determining the enzyme-dependent degradation of the matrix. Alternatively, protease activity can be measured using commercially available protease activity assay kits.
[0115] The following examples illustrate conservative variants.
[0116] Homologues of the pep4 gene or the Pep4 protein can be readily obtained from publicly available databases, for example, by using the exemplified base sequence of the pep4 gene or the exemplified amino acid sequence of the Pep4 protein as the query sequence via BLAST or FASTA search. Furthermore, homologues of the pep4 gene can be obtained, for example, via PCR using the chromosome of *Talaromyces cellulolyticus* as a template and employing oligonucleotides prepared based on these known pep4 gene base sequences as primers.
[0117] The pep4 gene, provided it retains its original function, can be a gene encoding a protein having an amino acid sequence in which one or more amino acids at one or more positions of the exemplified Pep4 protein (e.g., the amino acid sequence shown in SEQ ID NO. 71) are replaced, deleted, inserted, and / or added. It should be noted that the term "one or more" varies depending on the position of the amino acid residues in the protein's three-dimensional structure and the type of amino acid residues. Specifically, it can be, for example, 1 to 50, 1 to 40, 1 to 30, preferably 1 to 20, more preferably 1 to 10, further preferably 1 to 5, and particularly preferably 1 to 3.
[0118] The substitution, deletion, insertion, and / or addition of one or more amino acids are conserved variations that maintain the normal function of the protein. A representative conserved variation is a conserved substitution. A conserved substitution, when the substitution site is an aromatic amino acid, is a variation that substitutes for Phe, Trp, and Tyr; when the substitution site is a hydrophobic amino acid, it is a variation that substitutes for Leu, Ile, and Val; when the substitution site is a polar amino acid, it is a variation that substitutes for Gln and Asn; when the substitution site is a basic amino acid, it is a variation that substitutes for Lys, Arg, and His; when the substitution site is an acidic amino acid, it is a variation that substitutes for Asp and Glu; and when the substitution site is an amino acid with a hydroxyl group, it is a variation that substitutes for Ser and Thr. As substitutions considered conservative, specific examples include: substitutions from Ala to Ser or Thr; substitutions from Arg to Gln, His, or Lys; substitutions from Asn to Glu, Gln, Lys, His, or Asp; substitutions from Asp to Asn, Glu, or Gln; substitutions from Cys to Ser or Ala; substitutions from Gln to Asn, Glu, Lys, His, Asp, or Arg; substitutions from Glu to Gly, Asn, Gln, Lys, or Asp; substitutions from Gly to Pro; and substitutions from His to Asn, Lys, Gln, Arg, or Tyr. The substitutions include: substitutions from Ile to Leu, Met, Val, or Phe; substitutions from Leu to Ile, Met, Val, or Phe; substitutions from Lys to Asn, Glu, Gln, His, or Arg; substitutions from Met to Ile, Leu, Val, or Phe; substitutions from Phe to Trp, Tyr, Met, Ile, or Leu; substitutions from Ser to Thr or Ala; substitutions from Thr to Ser or Ala; substitutions from Trp to Phe or Tyr; substitutions from Tyr to His, Phe, or Trp; and substitutions from Val to Met, Ile, or Leu. Furthermore, such amino acid substitutions, deletions, insertions, or additions include those resulting from naturally occurring variations (mutants or variants) based on individual differences in the organism from which the gene originates, species differences, etc.
[0119] Furthermore, the pep4 gene, provided it retains its original function, can be a gene encoding a protein having an amino acid sequence having an identity of 80% or more, preferably 90% or more, more preferably 95% or more, further preferably 97% or more, and particularly preferably 99% or more, with respect to the entire amino acid sequence of the exemplified Pep4 protein (e.g., the amino acid sequence shown in SEQ ID NO. 71).
[0120] Furthermore, the pep4 gene, provided it retains its original function, can be DNA that hybridizes under stringent conditions with the complementary sequence of the exemplified pep4 gene (e.g., the sequence shown in SEQ ID NO. 70) or with a probe prepared from that complementary sequence. “Stringent conditions” refers to conditions that form so-called specific hybridization and do not form non-specific hybridization. An example could be given where DNAs with high identity hybridize with each other, for example, DNAs with 80% or more, preferably 90% or more, more preferably 95% or more, further preferably 97% or more, particularly preferably 99% or more identity hybridize with each other, and DNAs with low identity do not hybridize with each other; or conditions where washing is performed once, preferably two to three times, at a salt concentration and temperature equivalent to that of typical Southern hybridization washing at 60°C, 1×SSC, 0.1% SDS, preferably 60°C, 0.1×SSC, 0.1% SDS, more preferably 68°C, 0.1×SSC, 0.1% SDS.
[0121] The probe, for example, may be part of a complementary sequence of a gene. Such a probe can be prepared by PCR using oligonucleotides prepared based on a known gene base sequence as primers and a DNA fragment containing those base sequences as a template. For example, a DNA fragment of approximately 300 bp in length can be used as a probe. In such cases, washing conditions for hybridization can be exemplified as: 50°C, 2×SSC, 0.1% SDS.
[0122] Furthermore, the pep4 gene can be obtained by replacing any codon with its equivalent. That is, the pep4 gene can be a variant of the pep4 gene described above based on codon degeneracy.
[0123] It should be noted that the "identity" between amino acid sequences, unless otherwise specified, refers to the identity between amino acid sequences calculated using the default Scoring Parameters (Matrix: BLOSU M62; Gap Costs: Existence = 11, Extension = 1; Compositional Adjustments: Conditional compositional score matrix adjustment) set by BLASTP. Furthermore, the "identity" between base sequences refers to the identity between base sequences calculated using the default Scoring Parameters (Match / Mismatch Scores = 1, -2; Gap Costs = Linear) set by BLASTN.
[0124] It should be noted that the descriptions relating to the variants of the aforementioned genes and proteins can also be applied to any protein such as the target protein and the genes that encode them.
[0125] <1-4> Other properties
[0126] The microorganisms of the present invention can possess other desired properties (e.g., modifications) as long as they do not impair the production capacity of target proteins. Examples of modifications include those that enhance the production capacity of target proteins in *Talaromyces cellulolyticus*. Specifically, examples of modifications include those that reduce the activity of YscB protein and those that reduce the activity of CreA protein. These properties and modifications can be used individually or in suitable combinations.
[0127] That is, the microorganism of the present invention, for example, can be modified in a manner that reduces the activity of the YscB protein. Specifically, the microorganism of the present invention can be modified in a manner that reduces the activity of the YscB protein compared to an unmodified strain. More specifically, the microorganism of the present invention can be modified, for example, in a manner that reduces the expression of the yscB gene, or in a manner that disrupts the yscB gene. The YscB protein is a protease.
[0128] The base sequence of the yscB gene (containing introns) of *Talaromyces cellulolyticus* S6-25 strain and the amino acid sequence of the YscB protein encoded by this gene are shown in SEQ ID NO. 60 and 73, respectively. That is, the yscB gene can be, for example, a gene having the base sequence represented by SEQ ID NO. 60. Furthermore, the YscB protein can be, for example, a protein having the amino acid sequence represented by SEQ ID NO. 73. The yscB gene and YscB protein can be conserved variants of the exemplified yscB gene and YscB protein, respectively. Regarding conserved variants of the yscB gene and YscB protein, conserved variants of the pep4 gene and Pep4 protein can be used. It should be noted that "maintaining the original function" means that, in the case of the YscB protein, the protein variant may have protease activity. Protease activity can be determined, for example, as described above.
[0129] Furthermore, for example, the microorganisms of the present invention can be modified to reduce the activity of the CreA protein. Specifically, the microorganisms of the present invention can be modified to reduce the activity of the CreA protein compared with unmodified strains. More specifically, for example, the microorganisms of the present invention can be modified to reduce the expression of the creA gene or to destroy the creA gene. The creA gene is a gene encoding a transcription factor involved in the repression of catabolites. The creA gene is known to be involved in the expression of cellulase in filamentous fungi (Mol Gen Genet. 1996 Jun 24; 251(4):451-60, Biosci Biotechnol Biochem. 1998 Dec; 62(12):2364-70).
[0130] The base sequence of the creA gene from *Talaromyces cellulolyticus* S6-25 strain is shown in SEQ ID NO. 74. That is, for example, the creA gene can be a gene having the base sequence shown in SEQ ID NO. 74. Furthermore, for example, the CreA protein can be a protein having the amino acid sequence encoded by the base sequence shown in SEQ ID NO. 74. The creA gene and CreA protein can be conserved variants of the creA gene and CreA protein described above, respectively. The description of conserved variants of the pep4 gene and Pep4 protein can be referenced for conserved variants of the creA gene and CreA protein. It should be noted that "maintaining the original function" means that, in the case of the CreA protein, the variant of the protein functions as a transcription factor involved in the repression of catabolites.
[0131] <1-5> Techniques to reduce protein activity
[0132] The following describes the methods for reducing the activity of proteins such as Pep4, YscB, and CreA.
[0133] "Reduced protein activity" refers to a decrease in the activity of the protein compared to an unmodified strain. Specifically, "reduced protein activity" means a decrease in the activity of the protein per unit cell compared to an unmodified strain. The "unmodified strain" referred to here is a control strain that has not been modified in a way that reduces the activity of the target protein. Examples of unmodified strains include wild-type strains and parental strains. Specifically, examples of unmodified strains include the strains exemplified in the description of *Talaromyces cellulolyticus*. That is, in one approach, the protein activity can be reduced compared to the *Talaromyces cellulolyticus* S6-25 strain. It should be noted that "reduced protein activity" also includes the complete loss of protein activity. More specifically, "reduced protein activity" can refer to a decrease in the number of protein molecules per unit cell compared to an unmodified strain, and / or a decrease in the function of the protein molecule per unit cell. That is, the "activity" in cases of "reduced protein activity" is not limited to the catalytic activity of the protein, but can refer to the amount of transcription (mRNA) or translation (protein) of the gene encoding the protein. "Number of protein molecules per unit cell" can refer to the average number of protein molecules per unit cell. It should be noted that "reduction in the number of protein molecules per unit cell" also includes cases where the protein is completely absent. Furthermore, "reduction in the function of a protein molecule per unit cell" also includes cases where the function of the protein molecule per unit cell is completely lost. The degree of reduction in protein activity is not particularly limited if the protein activity is reduced compared to the unmodified strain. For example, the protein activity can be reduced to less than 50%, less than 20%, less than 10%, less than 5%, or 0% of that in the unmodified strain.
[0134] Such modifications that reduce protein activity can be achieved, for example, by reducing the expression of the gene encoding the protein. "Reduced gene expression" means a decrease in gene expression compared to an unmodified strain. More specifically, "reduced gene expression" refers to a decrease in the amount of gene expressed per unit cell compared to an unmodified strain. "Gene expression per unit cell" can refer to the average expression level of the gene per unit cell. More specifically, "reduced gene expression" can refer to a decrease in the amount of gene transcription (mRNA) and / or a decrease in the amount of gene translation (protein). "Reduced gene expression" includes cases where the gene is not expressed at all. It should be noted that "reduced gene expression" is also referred to as "attenuated gene expression." Gene expression, for example, can be reduced to less than 50%, less than 20%, less than 10%, less than 5%, or 0% of that in an unmodified strain.
[0135] A decrease in gene expression can be based on, for example, a decrease in transcription efficiency, a decrease in translation efficiency, or a combination thereof. A decrease in gene expression can also be achieved, for example, by modifying the gene's expression regulatory sequence. "Expression regulatory sequence" is a general term for sites that affect gene expression, such as promoters. Expression regulatory sequences can be identified, for example, using promoter search vectors, gene analysis software such as GENETYX, etc. When modifying the expression regulatory sequence, it is preferable that the expression regulatory sequence is modified by 1 or more bases, more preferably 2 or more bases, and particularly preferably 3 or more bases. A decrease in gene transcription efficiency can be achieved, for example, by replacing the gene's promoter on the chromosome with a weaker promoter. A "weaker promoter" refers to a promoter whose transcription is weaker than the originally present wild-type promoter. Examples of weaker promoters include inducible promoters. That is, an inducible promoter can function as a weaker promoter under non-inducible conditions (e.g., in the absence of inducing substances). Furthermore, a portion or all of the expression regulatory sequence can be deleted. Furthermore, a decrease in gene expression can be achieved, for example, by manipulating factors related to expression control. Examples of factors related to expression control include low-molecular-weight molecules (inducing substances, repressing substances, etc.), proteins (transcription factors, etc.), and nucleic acids (siRNA, etc.) involved in transcription and translation control. Additionally, a decrease in gene expression can also be achieved, for example, by introducing mutations that reduce gene expression into the coding region of the gene. For example, replacing a codon in the coding region of a gene with a synonymous codon that is used less frequently in the host can thus reduce gene expression. Furthermore, gene expression itself can be reduced, for example, through gene disruption as described later.
[0136] Furthermore, such modifications that reduce protein activity can be achieved, for example, by disrupting the gene encoding the protein. "Disrupting a gene" means modifying the gene so that it does not produce a normally functioning protein. "Not producing a normally functioning protein" includes cases where no protein is produced from the gene at all, and cases where a unit molecule of protein is produced from the gene with reduced or absent function (activity, properties).
[0137] Gene destruction can be achieved, for example, by deleting (removing) a gene from a chromosome. "Gene deletion" refers to the deletion of part or all of the coding region of a gene. Furthermore, it can also involve deleting the entire gene, including the sequences preceding and following the coding region. The sequences preceding and following the coding region may, for example, contain gene expression regulatory sequences. The deleted region can be any region, such as the N-terminal region (the region flanking the N-terminus of the encoded protein), the internal region, or the C-terminal region (the region flanking the C-terminus of the encoded protein), as long as it reduces protein activity. Generally, a longer deleted region reliably inactivates the gene. The deleted region can, for example, be more than 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% of the full length of the coding region. Furthermore, it is preferable that the reading frames before and after the deleted region are inconsistent. Frameshifting can occur downstream of the deleted region due to inconsistent reading frames. In the case of the creA gene, specifically, for example, the gene can be disrupted by deleting a portion corresponding to positions 3262–4509 of SEQ ID NO. 74 (Japanese Patent Application Laid-Open No. 2016-131533).
[0138] Furthermore, gene disruption can be achieved, for example, by introducing amino acid substitutions (missense mutations), stop codons (nonsense mutations), or the addition or deletion of 1-2 bases in the coding region of a gene on a chromosome (frameshift mutations) (Journal of Biological Chemistry 272:8611-8617 (1997), Proceedings of the National Academy of Sciences, USA 95 5511-5515 (1998), Journal of Biological Chemistry 26 116,20833-20839 (1991)).
[0139] Furthermore, gene disruption can be achieved, for example, by inserting additional base sequences into the coding region of a gene on a chromosome. The insertion site can be any region of the gene, and a longer inserted base sequence can reliably inactivate the gene. Moreover, it is preferable that the reading frames before and after the insertion site are not aligned. This inconsistency in the reading frames allows for frameshifting downstream of the insertion site. There are no particular limitations on the other base sequences, as long as they can reduce or eliminate the activity of the encoded protein; examples include genes useful in marker genes and target protein production.
[0140] In particular, gene disruption can be achieved by deleting (or removing) the amino acid sequence of the encoded protein. In other words, such modifications that reduce protein activity can be achieved, for example, by deleting the amino acid sequence of the protein; specifically, this can be achieved by modifying the gene to produce a protein with a deleted amino acid sequence. It should be noted that "deletion of the amino acid sequence of a protein" refers to the deletion of a portion or all of the protein's amino acid sequence. Furthermore, "deletion of the amino acid sequence of a protein" means that the original amino acid sequence in the protein is no longer present, and also includes cases where the original amino acid sequence is replaced by a different amino acid sequence. That is, for example, a region that is changed to a different amino acid sequence through frameshifting can be considered a deleted region. Typically, the deletion of the protein's amino acid sequence shortens the entire protein, but it is also possible for the protein to remain unchanged or to become longer. For example, by deleting a portion or all of the coding region of a gene, the region encoded by the deleted region can be deleted from the amino acid sequence of the encoded protein. Furthermore, for example, by introducing a stop codon into the coding region of a gene, the region encoded by the region downstream of the introduced site can be deleted from the amino acid sequence of the encoded protein. Furthermore, for example, by shifting the frameshift in the coding region of a gene, it is possible to delete the region encoded by that frameshift site. For the location and length of the deleted region in an amino acid sequence deletion, the description of the location and length of the deleted region in a gene deletion can be referenced.
[0141] When genes on chromosomes are modified as described above, this can be achieved, for example, by preparing a modified disruptive gene that does not produce a normally functioning protein; transforming the host with recombinant DNA containing this disruptive gene; and allowing homologous recombination to occur between the disruptive gene and the wild-type gene on the chromosome, thereby replacing the wild-type gene on the chromosome with the disruptive gene. In this case, if the recombinant DNA contains a marker gene based on traits such as auxotrophy in the host, it is easily manipulated. Examples of disruptive genes include: genes that have deleted part or all of their coding region; genes with introduced missense mutations; genes with introduced nonsense mutations; genes with introduced frameshift mutations; and genes with inserted sequences such as transposons or marker genes. Even if a protein encoded by a disruptive gene is generated, it will have a different three-dimensional structure than the wild-type protein, and its function will be reduced or lost.
[0142] The structure of the recombinant DNA used in homologous recombination is not particularly limited, as long as homologous recombination occurs in the desired manner. For example, a linear DNA containing any sequence can be used to transform the host. This linear DNA, with sequences upstream and downstream of the target chromosomal site at both ends of the arbitrary sequence, induces homologous recombination upstream and downstream of the target chromosomal site, respectively, thereby enabling the target chromosomal site to be replaced with the arbitrary sequence in step 1. For example, a sequence containing a marker gene can be used as the arbitrary sequence.
[0143] Marker genes can be appropriately selected based on host traits such as auxotrophic phenotypes. For example, when a host exhibits a uracil auxotrophic phenotype through mutations in the pyrF or pyrG genes, using the pyrF or pyrG genes as marker genes allows for the selection of strains with targeted modifications by using uracil auxotroph complementation (i.e., non-uracil auxotrophy) as an indicator. Furthermore, for example, when a host exhibits a methionine auxotrophic phenotype through mutations in the sC gene (sulfate permiase gene), using the sC gene as a marker gene allows for the selection of strains with targeted modifications by using methionine auxotroph complementation (i.e., non-methionine auxotrophy) as an indicator. Additionally, drug resistance genes such as hygromycin resistance genes can be used as marker genes.
[0144] Furthermore, such modifications that reduce protein activity can be achieved, for example, through mutagenesis. Examples of mutagenesis include X-ray irradiation, ultraviolet irradiation, and treatment with mutagens such as N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), ethyl methanesulfonate (EMS), and methyl methanesulfonate (MMS).
[0145] The decrease in protein activity can be confirmed by measuring the activity of the protein. The activities of Pep4 and YscB proteins can be measured, for example, as described above. For example, the activity of CreA protein can be determined by measuring the degree of catabolite repression. For example, the degree of catabolite repression can be determined by measuring cellulase production under culture conditions containing glucose as a carbon source. Specifically, for example, the decrease in CreA protein activity can be confirmed by using an increase in cellulase production under culture conditions containing glucose as a carbon source as an indicator.
[0146] The reduced activity of the protein can also be confirmed by the decreased expression of the gene encoding the protein. Decreased gene expression can also be determined by either a decrease in the amount of the gene transcribed or a decrease in the amount of protein expressed from the gene.
[0147] The reduction in gene transcription can be confirmed by comparing the amount of mRNA transcribed from the gene with that of the unmodified strain. Methods for evaluating mRNA levels include Northern blotting, RT-PCR, etc. (Molecular cloning (Cold Spring Harbor Laboratory Press, Cold Spring Harbor (USA), 2001)). The amount of mRNA (e.g., molecules per unit cell) can, for example, be reduced to less than 50%, less than 20%, less than 10%, less than 5%, or 0% of that in the unmodified strain.
[0148] The reduction in protein levels can be confirmed using antibodies via Western blotting (Molecular cloning (Cold Spring Harbor Laboratory Press, Cold Spring Harbor (USA), 2001)). The amount of protein (e.g., molecules per unit cell) can be reduced, for example, to less than 50%, less than 20%, less than 10%, less than 5%, or 0% of that in the unmodified strain.
[0149] Gene damage can be confirmed by determining a portion or all of the gene's base sequence, restriction enzyme map, or full length, depending on the methods used in the damage.
[0150] In terms of transformation, for example, it can be carried out using methods commonly used in the transformation of eukaryotic microorganisms such as molds and yeasts. One such method is the protoplast method.
[0151] <2> The method of the present invention
[0152] The microorganisms of the present invention can be used to manufacture target proteins. Specifically, target proteins can be manufactured by culturing the microorganisms of the present invention. That is, specifically, the method of the present invention can be a method for manufacturing target proteins that includes culturing the microorganisms of the present invention in a culture medium.
[0153] The culture medium used is not particularly limited as long as it enables the microorganisms of the present invention to proliferate and produce the target protein. For example, a culture medium containing, as needed, a component selected from carbon sources, nitrogen sources, phosphate sources, sulfur sources, and various other organic and inorganic components can be used. Those skilled in the art can appropriately determine the type and concentration of the culture medium components. For specific culture medium compositions, for example, the culture medium compositions described in reports related to *Talaromyces cellulolyticus* (Japanese Patent Application Laid-Open No. 2003-135052, 2008-271826, 2008-271927, etc.), and the culture medium compositions used for various cellulase-producing microorganisms such as *Trichoderma reesei* can be referred to.
[0154] Regarding the carbon source, there are no particular limitations as long as the microorganisms of the present invention can assimilate and generate the target protein. Examples of carbon sources include: sugars and cellulosic matrices. Specifically, examples of sugars include: glucose, fructose, galactose, xylose, arabinose, sucrose, lactose, cellobiose, molasses, starch hydrolysate, and biomass hydrolysate. Specifically, examples of cellulosic matrices include: microcrystalline cellulose (Avicel), filter paper, waste paper, pulp, wood, rice straw, wheat straw, rice husk, rice bran, wheat bran, bagasse, coffee grounds, and tea residue. Cellulosic matrices can be used as carbon sources after pretreatment such as hydrothermal decomposition, acid treatment, alkali treatment, cooking, crushing, or pulverizing. A commercially available suitable cellulosic matrix is SOLKA FLOC (International Fiber Corp, North Tonawanda, NY, USA). One carbon source can be used, or two or more carbon sources can be used in combination.
[0155] Specifically, examples of nitrogen sources include: ammonium salts such as ammonium sulfate, ammonium chloride, and ammonium phosphate; peptone; yeast extract; meat extract; corn steep liquor; soybean protein decomposition products; ammonia; and urea. One nitrogen source can be used, or two or more nitrogen sources can be used in combination.
[0156] Specifically, examples of phosphoric acid sources include phosphates such as potassium dihydrogen phosphate and dipotassium hydrogen phosphate, and phosphoric acid polymers such as pyrophosphate. One phosphoric acid source can be used, or two or more phosphoric acid sources can be used in combination.
[0157] Specifically, sulfur sources can include inorganic sulfur compounds such as sulfates, thiosulfates, and sulfites, as well as sulfur-containing amino acids such as cysteine, cystine, and glutathione. One sulfur source can be used, or two or more sulfur sources can be used in combination.
[0158] Other organic and inorganic components include, specifically, inorganic salts such as sodium chloride and potassium chloride; trace metals such as iron, manganese, magnesium, and calcium; vitamins such as vitamin B1, vitamin B2, vitamin B6, niacin, nicotinamide, and vitamin B12; amino acids; nucleic acids; and organic components containing these, such as peptones, casein amino acids, yeast extracts, and soy protein breakdown products. One or more of these components can be used.
[0159] Regarding culture conditions, there are no particular limitations as long as the microorganism of the present invention can proliferate and produce the target protein. For example, the culture can be carried out under the usual conditions used in the culture of filamentous fungi and other microorganisms. For specific culture conditions, for example, the culture conditions described in reports related to *Talaromyces cellulolyticus* (Japanese Patent Application Laid-Open No. 2003-135052, 2008-271826, 2008-271927, etc.), and the culture conditions used for various cellulase-producing microorganisms such as *Trichoderma reesei* can be referred to.
[0160] Regarding cultivation, for example, liquid culture medium can be used under aerobic conditions. Specifically, aerobic cultivation can be carried out through aeration, shaking, stirring, or a combination thereof. Regarding cultivation temperature, for example, it can be 15–43°C, particularly about 30°C. Regarding cultivation period, for example, it can be 2 hours to 20 days. Cultivation can be carried out through batch culture, fed-batch culture, continuous culture, or a combination thereof. It should be noted that the culture medium at the beginning of cultivation is also referred to as the "initial culture medium." Furthermore, the culture medium supplied to the culture system (fermentation tank) in fed-batch or continuous culture is also referred to as "fed-batch medium." Furthermore, the supply of fed-batch medium to the culture system in fed-batch or continuous culture is also referred to as "fed-batch." Moreover, cultivation can be carried out in two stages: pre-cultivation and main culture. For example, pre-cultivation can be carried out in a solid culture medium such as agar, and main culture can be carried out in a liquid culture medium. Cultivation can continue, for example, until the carbon source in the culture medium is consumed or until the activity of the microorganisms of the present invention is lost.
[0161] In this invention, each culture medium component may be contained in an initial culture medium, a fed-batch culture medium, or both. The types of components contained in the initial culture medium may be the same as or different from those contained in the fed-batch culture medium. Furthermore, the concentrations of each component in the initial culture medium may be the same as or different from those in the fed-batch culture medium. Additionally, two or more fed-batch culture media containing different types and / or concentrations of components may be used. For example, in the case of intermittent multiple fed-batch operations, the types and / or concentrations of components contained in each fed-batch culture medium may be the same or different.
[0162] The concentrations of various components can be determined by gas chromatography (Hashimoto, K. et al. 1996. Biosci. Biotechnol. Biochem. 70:22-30) and HPLC (Lin, JT et al. 1998. J. Chromatogr. A. 808:43-49).
[0163] By culturing the microorganisms of the present invention as described above, the target protein is expressed, resulting in a culture containing the target protein. Specifically, the target protein can accumulate in the culture medium, on the surface of the bacterial cells, inside the bacterial cells, or a combination thereof. The target protein can accumulate particularly in the culture medium.
[0164] The production of target proteins can be confirmed using well-known methods for protein detection or identification. Examples of such methods include SDS-PAGE, Western blotting, mass spectrometry, N-terminal amino acid sequence analysis, and enzyme activity assays. These methods can be used individually or in combination of two or more.
[0165] The generated target protein can be appropriately recovered. That is, the method for manufacturing the target protein of the present invention can include recovering the generated target protein. Specifically, the target protein can be recovered as a suitable component containing the target protein. Examples of such components include: culture, culture supernatant, bacterial cells, bacterial cell processing materials (broken material, dissolved material, extract (cell-free extract)). Regarding the bacterial cells, for example, they can be provided as immobilized bacterial cells immobilized with carriers such as acrylamide or carrageenan.
[0166] Furthermore, the target protein can be isolated and purified to the desired extent. The target protein can be provided in a free state or as an immobilized enzyme that has been immobilized in a solid phase such as resin.
[0167] In cases where the target protein is accumulated in the culture medium, the target protein can be isolated and purified from the supernatant, for example, after removing solid components such as bacterial cells from the culture by centrifugation or the like.
[0168] When the target protein is within the bacterial cell, the target protein can be isolated and purified from the treated material after processes such as cell disruption, dissolution, or extraction. The bacterial cell can be recovered from the culture by centrifugation or similar methods. Cell disruption, dissolution, or extraction can be performed using known methods. Examples of such methods include: ultrasonic disruption, Dyno-milling, bead disruption, French press crushing, and lysozyme treatment. These methods can be used individually or in combination of two or more.
[0169] When target proteins accumulate on the bacterial cell surface, the target proteins can be isolated and purified from the solubilized material, for example, after solubilization. Solubilization can be performed using known methods. Examples of such methods include increasing the salt concentration and using surfactants. These methods can be used individually or in combination of two or more.
[0170] Purification of the target protein (e.g., purification from the supernatant, processed material, or solubilizer as described above) can be performed using known methods used in protein purification. Examples of such methods include, for instance, ammonium sulfate fractionation, ion exchange chromatography, hydrophobic chromatography, affinity chromatography, gel filtration chromatography, and isoelectric point precipitation. These methods can be used individually or in combination of two or more.
[0171] It should be noted that other enzymes, such as cellulase, xylanase, β-xylosidase, and arabinofuranosidase, can be generated and accumulated in the culture along with the target protein. The target protein can be recovered as a mixture with these other enzymes, or it can be recovered separately from these other enzymes.
[0172] The recovered target protein can be suitable for formulation. There are no particular restrictions on dosage form; it can be appropriately determined based on various conditions such as the intended use of the target protein. Examples of dosage forms include: liquids, suspensions, powders, tablets, pills, and capsules. In formulation, pharmacologically permissible additives such as excipients, binders, disintegrants, lubricants, stabilizers, flavoring agents, odorants, fragrances, diluents, and surfactants can be used.
[0173] Example
[0174] The present invention will be further described in detail below through non-limiting embodiments.
[0175] (1) Construction of a yscB gene-deleted strain derived from Talaromyces cellulolyticus F09 strain
[0176] Using *Talaromyces cellulolyticus* strain F09 (Japanese Patent Application Laid-Open No. 2016-131533) as the parent strain, the *T. cellulolyticus* F09ΔsC strain was constructed by disrupting the *sC* gene (SEQ ID NO. 59) through the following steps, allowing the *sC* gene to be used as a recombinant marker. The F09 strain is a strain with a variant (single base substitution) in the *pyrF* gene obtained by using *T. cellulolyticus* strain S6-25 (NITE BP-01685) as the parent strain. The F09 strain exhibits a uracil-deficient genotype through this variant in the *pyrF* gene.
[0177] First, a DNA fragment for sC gene disruption was prepared according to the following steps, containing a base sequence linked in the order of the upstream and downstream regions of the sC gene of *T. cellulolyticus*. Genomic DNA of *T. cellulolyticus* strain Y-94 (FERM BP-5826, CBS 136886) was used as a template. The upstream region of the sC gene was amplified by PCR using primers (SEQ ID NO. 1 and 2), and the downstream region was amplified by PCR using primers (SEQ ID NO. 3 and 4). The PCR products were purified using the Wizard SV Gel and PCR Clean-Up System (Promega). The purified PCR products were assembled into and ligated to the pUC plasmid provided with the kit using the In-Fusion HD Cloning Kit (TAKARABIO). *Escherichia coli* strain JM109 was transformed with the reactants, and colonies were formed by overnight incubation in LB agar medium (containing 100 mg / L ampicillin) at 37°C. Using the Wizard Plus Miniprep System (Promega), pUC-ΔsC plasmids containing the DNA fragment for sC disruption were obtained from the transformed organisms. The pUC-ΔsC plasmid was used as a template to amplify the DNA fragment for sC disruption via PCR using primers (SEQ ID NO. 1 and 4), followed by concentration and purification via ethanol precipitation.
[0178] Next, strain F09 was inoculated into a medium containing 12 g / L Potato Dextrose Broth (Difco) and 20 g / L Lacto Agar (Difco) and cultured at 30°C. One agar dish, obtained by punching a hole near the end of a colony formed on the agar medium with a pipette, was inoculated into a medium containing 30 g / L glucose, 20 g / L Yeast Extract (Becton, Dickinson and Company), 1 g / L uracil, and 1 g / L uridine. After two days of shaking culture at 30°C and 120 rpm, 2 ml of this pre-culture solution was inoculated into a medium containing 24 g / L Potato Dextrose Broth and cultured by rotation at 30°C and 220 rpm for one day. The bacterial cells were centrifuged (5000 rpm, 5 min) and recovered. 30 mL of an aqueous solution (pH 6.0) containing 10 g / L Yatalase (TAKARABIO), 10 mM KH₂PO₄, and 0.8 M NaCl was added, and the mixture was incubated at 30°C for 2 hours with shaking to digest the cell wall and induce protoplastization. After removing the residue through a glass filter, the protoplasts were recovered by centrifugation (2000 rpm, 10 min) and resuspended in Tris-HCl buffer (pH 7.5) containing 1.2 M sorbitol and 10 mM CaCl₂ to a final volume of 1 mL to prepare the protoplast solution. 10 μg of purified sC-destruction DNA fragment and 50 μL of Tris-HCl buffer (pH 7.5) containing 400 g / L PEG4000 and 10 mM CaCl₂ were added to 200 μL of the protoplast solution, and the mixture was incubated on ice for 30 min. Then, 1 mL of Tris-HCl buffer (pH 7.5) containing 400 g / L PEG4000 and 10 mM CaCl2 was added and mixed, and the mixture was incubated at room temperature for 15 minutes for transformation. The protoplasts recovered by centrifugation (2000 rpm, 10 min) were inoculated into a minimum essential medium containing 1 M sucrose, 1 mM sodium selenate, 30 mg / L methionine, 1 g / L uracil, and 1 g / L uridine (10 g / L glucose, 10 mM NH4Cl, 10 mM KH2PO4, 7 mM KCl, 2 mM MgSO4, 0.06 mg / L H3BO3, 0.26 mg / L (NH4)6Mo7O3). 24Selenic acid-resistant strains were selected by culturing at 30°C for 7 days using a mixture of 4H₂O, 1 mg / L FeCl₃·6H₂O, 0.4 mg / L CuSO₄·5H₂O, 0.08 mg / L MnCl₂, 2 mg / L ZnCl₂, and 20 g / L Bacto Agar. Strains with disrupted sC genes exhibited selenic acid resistance and methionine deficiency, thus allowing selection in selenic acid-containing media containing methionine. Colonies were inoculated into a minimum essential medium containing 1 mM sodium selenate, 30 mg / L methionine, 1 g / L uracil, and 1 g / L uridine. After culturing at 30°C for 4 days, sC gene deletion was confirmed, yielding sC-disrupted strains derived from F09 (F09ΔsC strain).
[0179] Next, using T. cellulolyticus F09ΔsC strain as the parent strain, the yscB gene (SEQ ID NO.60) was destroyed through the following steps to construct T. cellulolyticus F09ΔyscB strain.
[0180] First, a DNA fragment for yscB gene disruption was prepared according to the following steps, consisting of a base sequence linked in the order of the upstream region of the yscB gene of *T. cellulolyticus*, the sC gene marker of *T. cellulolyticus* (SEQ ID NO. 61), and the downstream region of the yscB gene of *T. cellulolyticus*. Using genomic DNA from *T. cellulolyticus* strain Y-94 (FERM BP-5826) as a template, the upstream region of the yscB gene was amplified by PCR using primers (SEQ ID NO. 5 and 6), the downstream region of the yscB gene was amplified by PCR using primers (SEQ ID NO. 7 and 8), and the sC gene marker was amplified by PCR using primers (SEQ ID NO. 9 and 10). The PCR products were purified using the Wizard SV Gel and PCR Clean-Up System. The purified PCR products were then incorporated into and ligated into the pUC plasmid provided with the In-Fusion HD Cloning Kit. E. coli JM109 strain was transformed with the reactants, and colonies were formed by overnight incubation on LB agar medium (containing 100 mg / L ampicillin) at 37°C. Using the Wizard Plus Miniprep System, the pUC-yscB::sC plasmid containing the DNA fragment for yscB gene disruption was obtained from the transformed organisms. Using the pUC-yscB::sC plasmid as a template, the DNA fragment for yscB gene disruption was amplified by PCR using primers (SEQ ID NO. 5 and 8), and then concentrated and purified by ethanol precipitation.
[0181] Next, strain F09ΔsC was inoculated into a medium containing 12 g / L Potato Dextrose Broth and 20 g / L BactoAgar and cultured at 30°C. A single agar dish, obtained by punching a hole near the end of a colony formed on the agar medium using a pipette, was inoculated into a medium containing 30 g / L glucose, 20 g / L yeast extract, 1 g / L uracil, and 1 g / L uridine. After two days of shaking culture at 30°C and 120 rpm, 2 ml of this pre-culture solution was inoculated into a medium containing 24 g / L Potato Dextrose Broth and cultured at 30°C and 220 rpm for one day. The cells were centrifuged (5000 rpm, 5 min) and recovered. 30 mL of an aqueous solution (pH 6.0) containing 10 g / L Yatalase, 10 mM KH₂PO₄, and 0.8 M NaCl was added, and the mixture was reacted at 30°C with shaking for 2 hours to digest the cell wall and induce protoplastization. After removing residue through a glass filter, protoplasts were recovered by centrifugation (2000 rpm, 10 min) and resuspended in 1 mL of Tris-HCl buffer (pH 7.5) containing 1.2 M sorbitol and 10 mM CaCl2 to prepare a protoplast solution. In a 200 μL protoplast solution, 10 μg of purified yscB gene disruption DNA fragment and 50 μL of Tris-HCl buffer (pH 7.5) containing 400 g / L PEG4000 and 10 mM CaCl2 were added, and the solution was incubated on ice for 30 min. Then, 1 mL of Tris-HCl buffer (pH 7.5) containing 400 g / L PEG4000 and 10 mM CaCl2 was added and mixed, and the solution was incubated at room temperature for 15 min for transformation. Protoplasts recovered by centrifugation (2000 rpm, 10 min) were inoculated into a minimum essential medium containing 1 M sucrose, 1 g / L uracil, 1 g / L uridine (10 g / L glucose, 10 mM NH4Cl, 10 mM KH2PO4, 7 mM KCl, 2 mM MgSO4, 0.06 mg / L H3BO3, 0.26 mg / L (NH4)6Mo7O 24Strains with complementary methionine deficiency were selected by culturing at 30°C for 7 days using a mixture of 4H₂O, 1 mg / L FeCl₃·6H₂O, 0.4 mg / L CuSO₄·5H₂O, 0.08 mg / L MnCl₂, 2 mg / L ZnCl₂, and 20 g / L Bacto Agar. The resulting colonies were inoculated into a minimum essential medium containing 1 g / L uracil and 1 g / L uridine, and cultured at 30°C for 4 days. The replacement of the yscB gene with the sC gene was confirmed, yielding a yscB gene-disrupted strain (F09ΔyscB strain) derived from strain F09.
[0182] (2) Construction and culture of a pep4 gene-deleted strain derived from T. cellulolyticus F09
[0183] Using T. cellulolyticus F09ΔyscB as the parent strain, a pep4 gene-disrupted strain encoding the Pep4 protease (GenBank accession number: GAM39722.1) was constructed through the following steps.
[0184] First, a DNA fragment for pep4 gene disruption was prepared according to the following steps, comprising a base sequence linked in the order of the upstream region of the pep4 gene of *T. cellulolyticus*, the pyrF gene marker of *T. cellulolyticus* (SEQ ID NO. 62), and the downstream region of the pep4 gene of *T. cellulolyticus*. Using genomic DNA of *T. cellulolyticus* strain Y-94 (FERM BP-5826) as a template, the upstream region of the pep4 gene was amplified by PCR using primers (SEQ ID NO. 27 and 28), the downstream region of the pep4 gene was amplified by PCR using primers (SEQ ID NO. 29 and 30), and the pyrF gene marker was amplified by PCR using primers (SEQ ID NO. 31 and 32). The PCR products were purified using the Wizard SV Gel and PCR Clean-Up System. The purified PCR product was incorporated into the pUC plasmid provided with the kit using the In-Fusion HD Cloning Kit, combining the upstream and downstream regions of the pep4 gene with the pyrF marker gene. E. coli JM109 strain was transformed with the reactants, and colonies were formed by overnight incubation on LB agar (containing 100 mg / L ampicillin) at 37°C. Using the Wizard Plus Miniprep System, the pUC-pep4::pyrF plasmid containing the pep4 gene disruption DNA fragment was obtained from the transformants. Using the pUC-pep4::pyrF plasmid as a template, the Pep4 protease gene disruption DNA fragment was amplified by PCR using primers (SEQ ID NO. 33 and 34), and then concentrated and purified by ethanol precipitation.
[0185] Next, strain F09ΔyscB was cultured using the same method as in (1), protoplastized, and transformed using the purified pep4 gene-destroying DNA fragment, just as in (1). The protoplasts recovered by centrifugation (2000 rpm, 10 min) were inoculated into a minimum essential medium containing 1 M sucrose, and strains with complementary uracil-deficient genotypes were selected by culturing at 30°C for 7 days. The resulting colonies were inoculated into the minimum essential medium, and after culturing at 30°C for 4 days, it was confirmed that the pep4 gene region was replaced by the pyrF gene marker, thus obtaining a pep4 gene-destroying strain from strain F09ΔyscB (hereinafter also referred to as the "Δpep4 strain").
[0186] In addition, as a control, in order to complete the auxotrophic strain, strain F09 was used as the parent strain, and the yscB gene-disrupted strain was constructed through the following steps.
[0187] First, a DNA fragment for yscB gene disruption was prepared according to the following steps, consisting of a base sequence linked in the order of the upstream region of the yscB gene of *T. cellulolyticus*, the pyrF gene marker of *T. cellulolyticus* (SEQ ID NO. 62), and the downstream region of the yscB gene of *T. cellulolyticus*. Using genomic DNA from *T. cellulolyticus* strain Y-94 (FERM BP-5826) as a template, the upstream region of the yscB gene was amplified by PCR using primers (SEQ ID NO. 5 and 35), the downstream region of the yscB gene was amplified by PCR using primers (SEQ ID NO. 36 and 8), and the pyrF gene marker was amplified by PCR using primers (SEQ ID NO. 31 and 32). The PCR products were purified using the Wizard SV Gel and PCR Clean-Up System. The purified PCR products were then incorporated into the pUC plasmid provided with the In-Fusion HD Cloning Kit. E. coli JM109 strain was transformed with the reactants, and colonies were formed by overnight incubation on LB agar medium (containing 100 mg / L ampicillin) at 37°C. Using the Wizard Plus Miniprep System, the pUC-yscB::pyrF plasmid containing the DNA fragment for yscB gene disruption was obtained from the transformed organisms. Using the pUC-yscB::pyrF plasmid as a template, the DNA fragment for yscB gene disruption was amplified by PCR using primers (SEQ ID NO. 5 and 8), and then concentrated and purified by ethanol precipitation.
[0188] Next, strain F09 was cultured using the same method as in (1) and protoplastized. Transformation was performed using the purified yscB gene-destroying DNA fragment, similar to that in (1). Protoplasts recovered by centrifugation (2000 rpm, 10 min) were inoculated into minimal essential medium containing 1 M sucrose, and strains with complementary uracil-deficient cytokines were selected by incubation at 30°C for 7 days. The resulting colonies were inoculated into minimal essential medium and incubated at 30°C for 4 days to confirm that the yscB gene region was replaced by the pyrF gene marker, thus obtaining a yscB gene-destroying strain derived from strain F09 (hereinafter also referred to as the "control strain") for protease activity evaluation as a control.
[0189] The control strain and Δpep4 strain were inoculated into a medium containing 12 g / L Potato Dextrose Broth and 20 g / L Lacto Agar and cultured at 30°C. An agar dish obtained by punching a hole near the end of a colony formed on the agar medium with a pipette was broken and transferred to a 14 ml polypropylene round tube (corning tube). 2 mL of liquid medium containing 5 g / L Potato Dextrose Broth was added, and the mixture was cultured at 30°C and 120 rpm for 2 days with reciprocating shaking. The total volume of culture medium was inoculated into 20 mL of liquid medium containing 40 g / L Solka Floc(R) (International Fiber Corporation), 1 g / L Corn steep liquor (Sigma-Aldrich, Lot number: MKBN0183V), 24 g / L KH2PO4, 5 g / L (NH4)2SO4, 4 g / L urea, 1 g / L Tween80, 1.2 g / L MgSO4·7H2O, 0.01 g / L ZnSO4·7H2O, 0.01 g / L MnSO4·5H2O, and 0.01 g / L CuSO4·5H2O. The medium was then cultured for 10 days in a 300 mL Erlenmeyer flask using a rotating shaking method (30°C, 220 rpm). The resulting culture was centrifuged at 15000 rpm for 5 minutes, and the supernatant was obtained by passing the supernatant through a 0.22 μm filter.
[0190] (3) Determination of protease activity in the supernatant of T. cellulolyticus culture medium in the presence and absence of pepsin A.
[0191] Protein concentrations in the culture supernatants of each strain were determined using the Protein Assay CBB (NACALAITESQUE). To confirm protease activity against casein, protease activity was measured using the Amplite™ Universal Fluorimetric Protease Activity Assay Kit*Green (AAT Bioquest, Inc.). Protease activity was also measured under conditions where the aspartic protease inhibitor pepsin A was added.
[0192] Dispense 50 μL of the 2× assay buffer (included with the kit, containing 0.5 μL of the protease matrix (green fluorescent casein matrix)) into 96-well plates (Greiner, trade number: 655090). Add 50 μL of culture supernatant from the control strain and Δpep4 strain to each well. Note that, when pepsin A was added, pepsin A (Sigma-Aldrich, trade number P2032) was added to achieve a final concentration of 10 μM. Protease activity was determined using a SpectraMax® M2 (Molecular Devices) microplate reader at 37°C every 2 minutes by measuring Relative Fluorescence Units (RFU, excitation / emission = 490 / 525 nm). The specific protease activity per unit of total protein in the culture supernatant was calculated by dividing the obtained RFU by the total protein amount used in the assay and the reaction time.
[0193] The results are shown in Table 1. In the table, "relative activity" represents the proportion of the specific protease activity of each sample relative to the specific protease activity of the control strain in the absence of pep4 A. In the absence of pep4 A, the specific protease activity of the culture supernatant of strain Δpep4 decreased to approximately 36% of that of the control strain. Furthermore, most (approximately 88%) of the specific protease activity of the culture supernatant of the control strain was inhibited by pep4 A. On the other hand, the specific protease activity of the culture supernatant of strain Δpep4 showed almost no change in the presence and absence of pep4 A. This result indicates that most of the extracellular protease activity of *T. cellulolyticus* originates from aspartic proteases, and most of the aspartic protease-derived protease activity originates from the Pep4 protease. From the above results, it can be concluded that the majority of the protease activity in the culture supernatant of *T. cellulolyticus* originates from the Pep4 protease, which is an important protease that should be deleted when *T. cellulolyticus* is used as a host to express heterologous proteins.
[0194] [Table 1]
[0195]
[0196] (4) Evaluation of the biodegradative activity of human IgG (trastuzumab) in T. cellulolyticus culture supernatant
[0197] To confirm the trastuzumab-degrading activity of the protease contained in the culture supernatant of the control strain and the Δpep4 strain, 0.5 g / L Herceptin (R) (CHUGAI PHARMACEUTICAL, trastuzumab (recombinant)) was dissolved in a solution (pH 4.3) simulating the culture medium used in actual liquid culture, containing 24 g / L KH2PO4, 5 g / L (NH4)2SO4, 2 g / L urea, 1 g / L Tween 80, 1.2 g / L MgSO4·7H2O, 0.01 g / L ZnSO4·7H2O, 0.01 g / L MnSO4·5H2O, and 0.01 g / L CuSO4·5H2O. For 90 μL of this Herceptin solution, 10 μL of the culture supernatant of the control strain or the Δpep4 strain, diluted with water to achieve a total protein concentration of 0.2 g / L, was added. In addition, for each 90 μL of the Herceptin solution, 10 μL of the supernatant (total protein concentration 0.2 g / L) of the culture medium of the control strain and the Δpep4 strain, which had been treated at 95 °C for 5 minutes to inactivate the protease, were added. Each mixture was incubated at 37 °C for 3 days.
[0198] Next, the incubated mixtures were used as samples for Western blotting. For each sample diluted 20-fold with water, 3 μL of water and 5 μL of Laemmli buffer were added, heated at 70°C for 10 minutes, and then loaded onto Any kD™ Mini-PROTEAN™ TGX™ precast gel (Bio-Rad). The gel was then swirled at 200V for 40 minutes with the APrecision Plus Protein Dual Color Standard (Bio-Rad) as a marker of protein molecular weight. Proteins from the gel were transcribed into a PVDF membrane (Invitrogen) using an iBind Western Device (ThermoFisher). A highly cross-absorbed-peroxidase antibody against human IgG F(ab′)2,F(ab′)2 fragment, highly cross-absorbed-peroxidase produced in goat (Sigma-Aldrich, trade name: SAB3701242), diluted 1:20000 in iBind™ FD Solution (Invitrogen) at a 5-fold dilution, was used as a probe. ECL (Enhanced Chemi Luminescence) reaction was performed by adding ECL-based Western Blotting Detection Reagent (GE HEALTHCARE) to the PVDF membrane, and the luminescence was detected using an Amersham Imager 600 (GE HEALTHCARE).
[0199] The results are shown in Figure 1 In samples incubated with water or culture supernatant inactivated with protease activity and Herceptin(R), only a band representing the full length of trastuzumab was detected. On the other hand, in samples incubated with culture supernatant of the control strain and Herceptin(R), a band representing trastuzumab degradation products was detected at the low molecular weight side (around 150 kDa), suggesting that a portion of the trastuzumab was degraded. In samples incubated with culture supernatant of the Δpep4 strain and Herceptin(R), virtually no band representing trastuzumab degradation products was detected. Therefore, the Pep4 protease in the culture supernatant of the control strain contributes significantly to the enzyme-dependent degradation of trastuzumab. It can be considered that the Pep4 protease is an important protease that should be deleted when *T. cellulolyticus* secretes and expresses heterologous proteins (e.g., trastuzumab and other IgG) using this host.
[0200] (5) Evaluation of the Pep4 protease gene disruption effect in trastuzumab-producing strains of T. cellulolyticus
[0201] Using T. cellulolyticus F09ΔyscB as the parent strain, a trastuzumab expression strain was constructed through the following steps.
[0202] First, according to the following steps, a sequence containing the following components was prepared: the upstream region of the creA gene of *T. cellulolyticus*, the upstream region of the cbh2 gene of *T. cellulolyticus* (promoter; SEQ ID NO. 63), the CBH1 secretion signal sequence of *T. cellulolyticus* (SEQ ID NO. 64), the trastuzumab heavy chain gene (SEQ ID NO. 65), the downstream region of the cbh1 gene of *T. cellulolyticus* (terminator; SEQ ID NO. 66), the pyrF gene marker of *T. cellulolyticus* (SEQ ID NO. 62), the upstream region of the cbh2 gene of *T. cellulolyticus* (promoter; SEQ ID NO. 63), the CBH1 secretion signal sequence of *T. cellulolyticus* (SEQ ID NO. 64), the trastuzumab light chain gene (SEQ ID NO. 67), and the downstream region of the cbh2 gene of *T. cellulolyticus* (terminator; SEQ ID NO. 66). The DNA fragment for trastuzumab expression was obtained by linking the base sequences of the downstream region of the creA gene of T. cellulolyticus (NO. 68). Using genomic DNA from *T. cellulolyticus* strain Y-94 (FERM BP-5826) as a template, PCR was performed using primers (SEQ ID NO. 37 and 38) to amplify the upstream region of the creA gene, the upstream region of the cbh2 gene, the CBH1 secretion signal sequence, the downstream sequence of the cbh1 gene, the pyrF gene marker, the upstream region of the cbh2 gene, and the CBH1 secretion signal sequence. The PCR was also performed using primers (SEQ ID NO. 39 and 40), primers (SEQ ID NO. 41 and 42), primers (SEQ ID NO. 71 and 44), primers (SEQ ID NO. 31 and 32), primers (SEQ ID NO. 45 and 40), primers (SEQ ID NO. 41 and 46), and primers (SEQ ID NO. 46). The downstream sequence of the cbh2 gene was amplified by PCR using primers (SEQ ID NO. 47 and 48), and the downstream region of the creA gene was amplified by PCR using primers (SEQ ID NO. 49 and 50).In addition, the fully synthesized gene purchased from EUROFINS Co., Ltd. was used as a template. The trastuzumab heavy chain gene was amplified by PCR using primers (SEQ ID NO. 51 and 52), and the trastuzumab light chain gene was amplified by PCR using primers (SEQ ID NO. 53 and 54). PCR products were purified using the Wizard SV Gel and PCR Clean-Up System. The mixture of the two purified PCR products was used as a template for PCR re-enzyme ligation. This process was repeated, and the resulting product was then incorporated into the pUC plasmid provided with the In-Fusion HD Cloning Kit. The reactants were transformed into E. coli JM109 strain, and colonies were formed by overnight incubation at 37°C on LB agar medium (containing 100 mg / L ampicillin). Using the Wizard Plus Miniprep System, the transformed organisms yielded the pUC-creA::Pcbh2-Her_H-pyrF-Pcbh2-Her_L plasmid containing the DNA fragment for trastuzumab expression. Using the pUC-creA::Pcbh2-Her_H-pyrF-Pcbh2-Her_L plasmid as a template, the DNA fragment for trastuzumab expression was amplified by PCR using primers (SEQ ID NO. 37 and 50), followed by concentration and purification via ethanol precipitation. It should be noted that by linking the upstream and downstream sequences of the creA gene to both ends of the trastuzumab expression sequence, the trastuzumab expression sequence can be inserted into the creA gene region rather than at a random location on the genome.
[0203] Next, strain F09ΔyscB was cultured using the same method as in (1) and protoplastized. The purified trastuzumab expression DNA fragment was then transformed in the same manner as in (1). Protoplasts recovered by centrifugation (2000 rpm, 10 min) were inoculated into minimal essential medium containing 1 M sucrose, and strains with complementary uracil deficiency were selected by culturing at 30°C for 7 days. The resulting colonies were inoculated into minimal essential medium, and after culturing at 30°C for 4 days, it was confirmed that the creA gene region was replaced by the trastuzumab expression sequence, yielding a trastuzumab expression strain derived from strain F09ΔyscB.
[0204] Next, using the trastuzumab-expressing strain derived from strain F09ΔyscB as the parent strain, a pep4 gene-disrupting strain was constructed through the following steps.
[0205] First, a DNA fragment for disrupting the pep4 gene was prepared according to the following steps, containing a base sequence linked in the order of the upstream region of the pep4 gene of *T. cellulolyticus*, the hygromycin resistance gene marker (SEQ ID NO. 69), and the downstream region of the pep4 gene of *T. cellulolyticus*. Using genomic DNA from *T. cellulolyticus* strain Y-94 (FERM BP-5826) as a template, the upstream region of the pep4 gene was amplified by PCR using primers (SEQ ID NO. 27 and 55), and the downstream region of the pep4 gene was amplified by PCR using primers (SEQ ID NO. 56 and 30). Furthermore, using pcDNA3.1 / Hygro(+) (Life Technologies) carrying the hygromycin resistance gene as a template, the hygromycin resistance gene (containing the promoter and terminator) was amplified by PCR using primers (SEQ ID NO. 57 and 58). The PCR products were purified using the Wizard SV Gel and PCR Clean-Up System. The purified PCR product was incorporated into and ligated to the pUC plasmid provided with the In-Fusion HD Cloning Kit. E. coli JM109 strain was transformed with the reactants, and colonies were formed by overnight incubation on LB agar (containing 100 mg / L ampicillin) at 37°C. Using the Wizard Plus Miniprep System, the pUC-pep4::hyg plasmid containing the pep4 gene disruption DNA fragment was obtained from the transformed organisms. Using the pUC-pep4::hyg plasmid as a template, the pep4 gene disruption DNA fragment was amplified by PCR using primers (SEQ ID NO. 27 and 30), and then concentrated and purified by ethanol precipitation.
[0206] Next, the trastuzumab-expressing strain from strain F09ΔyscB was cultured using the same method as in (1), protoplastized, and transformed with purified pep4 gene-destroying DNA fragments as in (1). The protoplasts recovered by centrifugation (2000 rpm, 10 min) were inoculated into minimum essential medium containing 1 M sucrose and cultured at 30°C for 1 day. Then, medium containing 0.5 g / L hygromycin B, 24 g / L Potato Dextrose Broth, and 7 g / L Bacto Agar was added for covering, and the culture was further incubated at 30°C for 3 days. Hygromycin-resistant strains were then selected. The resulting colonies were inoculated into minimum essential medium containing 0.5 g / L hygromycin B and cultured at 30°C for 4 days to confirm that the pep4 gene had been replaced by the hygromycin resistance gene, thus obtaining the pep4 gene-destroying strain of the trastuzumab-expressing strain from strain F09ΔyscB.
[0207] Trastuzumab-expressing strains derived from strain F09ΔyscB and their pep4 gene-destroyed strains were inoculated into a medium containing 12 g / L Potato Dextrose Broth (Difco) and 20 g / L Bacto Agar (Difco) and cultured at 30°C. A single agar dish, obtained by punching a hole near the end of a colony formed on agar medium using a pipette, was inoculated into a medium containing 30 g / L glucose, 20 g / L yeast extract, 1 g / L uracil, and 1 g / L uridine. After incubating at 30°C and 120 rpm for 2 days with shaking, 2 ml of this pre-culture solution was inoculated into 20 mL of a medium containing 40 g / L Solka Floc, 10 g / L Pharmamedia (Archer Daniels Midland Company), 24 g / L KH2PO4, 5 g / L (NH4)2SO4, 4 g / L urea, 4.7 g / L Potassium sodium(+)-tartrate tetrahydrate, 1 g / L Tween 80, 1.2 g / L MgSO4·7H2O, 0.01 g / L ZnSO4·7H2O, 0.01 g / L MnSO4·5H2O, and 0.01 g / L uridine. The liquid medium, CuSO4·5H2O, was incubated at 30°C and 220 rpm for 7 days. The resulting culture solution was then passed through a 0.22 μm filter to obtain the culture supernatant.
[0208] To confirm the secretion production of trastuzumab and trastuzumab degradation products in trastuzumab-expressing strains derived from strain F09ΔyscB and strains with disrupted pep4 gene, Western blotting was performed using the same method as in (4).
[0209] The results are shown in Figure 2 Compared to trastuzumab-expressing strains derived from strain F09ΔyscB, the proportion of trastuzumab degradation products to full-length trastuzumab was reduced in pep4-destroyed strains of trastuzumab-expressing strains derived from strain F09ΔyscB. This indicates that trastuzumab degradation is inhibited by disrupting the pep4 gene. These results suggest that the Pep4 protease is an important protease that should be deleted when *T. cellulolyticus* secretes and expresses heterologous proteins (e.g., trastuzumab and other IgG) as a host.
[0210] Industrial applicability
[0211] This invention enables the efficient and effective production of proteins.
[0212] <Description of the sequence list>
[0213] SEQ ID NO.1~58: Primers
[0214] SEQ ID NO.59: Base sequence of the sC gene of *Talaromyces cellulolyticus* S6-25 strain
[0215] SEQ ID NO.60: Base sequence of the yscB gene in *Talaromyces cellulolyticus* S6-25 strain
[0216] SEQ ID NO.61: Base sequence of sC gene marker
[0217] SEQ ID NO.62: Base sequence of the pyrF gene marker
[0218] SEQ ID NO.63: Base sequence of the cbh2 promoter of *Talaromyces cellulolyticus*
[0219] SEQ ID NO. 64: Base sequence encoding the Cbh1 signal peptide of Talamoyces cellulolyticus
[0220] SEQ ID NO.65: Base sequence of trastuzumab heavy chain gene
[0221] SEQ ID NO.66: Base sequence of the cbh1 terminator
[0222] SEQ ID NO.67: Base sequence of the trastuzumab light chain gene
[0223] SEQ ID NO.68: Base sequence of the cbh2 terminator
[0224] SEQ ID NO.69: Base sequence of hygromycin resistance gene marker
[0225] SEQ ID NO.70: Base sequence of the pep4 gene of *Talaromyces cellulolyticus* Y-94 strain
[0226] SEQ ID NO.71: Amino acid sequence of Pep4 protein from *Talaromyces cellulolyticus* Y-94 strain
[0227] SEQ ID NO.72: Amino acid sequence of the Cbh1 signal peptide of *Talaromyces cellulolyticus*
[0228] SEQ ID NO.73: Amino acid sequence of YscB protein from *Talaromyces cellulolyticus* S6-25 strain
[0229] SEQ ID NO.74: Base sequence of the creA gene in *Talaromyces cellulolyticus* S6-25 strain sequence list <110> Ajinomoto Co., Ltd. <120> Methods of protein manufacturing <130> H051-210461 <150> JP2020-101310 <151> 2020-06-11 <160> 74 <170> PatentIn version 3.5 <210> 1 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 1 cggtacccgg ggatcccctt cttgccagca cactgctccg 40 <210> 2 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 2 agctgcgagg tcaacggcta agcgccagtt tggtgaatcc 40 <210> 3 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 3 aactggcgct tagccgttga cctcgcagct ggcacggggat 40 <210> 4 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 4 cgactctaga ggatccgcca agggatccgt gagatcgcat 40 <210> 5 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 5 cggtacccgg ggatcttggg gcacagagac aacagggtca 40 <210> 6 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 6 acctgactcg accggagata gcgtgagcac actgagcagg 40 <210> 7 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 7 gcttgttgac ctcgccaaca cgctacctct tccacagtag 40 <210> 8 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 8 cgactctaga ggatcgagct gattgagcat gctaacgcag 40 <210> 9 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 9 ccggtcgagt caggtattca tatca 25 <210> 10 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 10 gcgaggtcaa caagcctcaa accct 25 <210> 11 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 11 cggtacccgg ggatcagcaa ccccaccgta atctcaaggt 40 <210> 12 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 12 ccgatctgaa ttgacattcggatggactttttgaaggcca 40 <210> 13 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 13 tcggcgttca cttatgaggt tgacttgata gtcgatcgct 40 <210> 14 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 14 cgactctaga ggatcgttat tgctgttgct gttgtggttg 40 <210> 15 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 15 cggtacccgg ggatccatag cctcatgacc aatgaccggt 40 <210> 16 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 16 ccgatctgaa ttgacgtcga tgaagtcgtc gggggtatgt 40 <210> 17 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 17 tcggcgttca cttatcggct caatatgcaa taggtgttcc 40 <210> 18 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 18 cgactctaga ggatctaggg ctaaccagca gggtaccgcc 40 <210> 19 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 19 cggtacccgg ggatctagac gttagaactc tccccactgt 40 <210> 20 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 20 ccgatctgaa ttgaccttgc cgcttgaagt tgtatgaaat 40 <210> twenty one <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> twenty one tcggcgttca cttatgtgtt gcattcaaag atggctgcct 40 <210> twenty two <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> twenty two cgactctaga ggatccggcg tttgagctcc tggagtaaga 40 <210> twenty three <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> twenty three cggtacccgg ggatcaattc cgacagtgtc gtgctccagc 40 <210> twenty four <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> twenty four ccgatctgaa ttgacggcgg gcgattgata atgatgttgt 40 <210> 25 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 25 tcggcgttca cttatctagc gacgaggtca cgattatgag 40 <210> 26 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 26 cgactctaga ggatcacaag accttcaatc tctccaggag 40 <210> 27 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 27 cggtacccgg ggatctacac gcaagggaag aagtaagagc 40 <210> 28 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 28 ccgatctgaa ttgacgatgg ccaaccaacg ctaatgtatc 40 <210> 29 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 29 tcggcgttca cttatatcgg ttgacgggtt gctgaaatgc 40 <210> 30 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 30 cgactctaga ggatctagtc gcaggacgga atcgaacag 39 <210> 31 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 31 gtcaattcag atcggctgcc gcctg 25 <210> 32 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 32 ataagtgaac gccgagtcag tacta 25 <210> 33 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 33 cccagtcacg acgttgtaaa acgacg 26 <210> 34 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 34 caggaaacag ctatgaccat gattac 26 <210> 35 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 35 ccgatctgaa ttgacagata gcgtgagcac actgagcagg 40 <210> 36 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 36 tcggcgttca cttatcaaca cgctacctct tccacagtag 40 <210> 37 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 37 cggtacccgg ggatcagcgc agaccaatgc cagaggagaa 40 <210> 38 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 38 gcgcgagttg cgcgatgaaa tttat 25 <210> 39 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 39 tcgcgcaact cgcgctgcta tgcagttgat gctactgtgt 40 <210> 40 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 40 agttgctaaa tgatcaagaa gcttcacttt 30 <210> 41 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 41 gttgaagctc agcaaattgg tacttatacc gctgaaaccc 40 <210> 42 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 42 gacgagctgg acttcctgag caccagctgt tgccagcaag 40 <210> 43 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 43 taaattttca cttctttctt cgcctattga 30 <210> 44 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 44 ccgatctgaa ttgacccgaa aacggtaagg cgtagttata gaaat 45 <210> 45 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 45 tcggcgttca cttattgcta tgcagttgat gctactgtgt 40 <210> 46 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 46 tgtcatctgg atgtcctgag caccagctgt tgccagcaag 40 <210> 47 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 47 tagatcagctttgagtgcagcaaaa 25 <210> 48 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 48 gcttgtttga gaatacatga ggttgcc 27 <210> 49 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 49 tattctcaaa caagccctct ttctcgccct ttcttctcaa 40 <210> 50 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 50 cgactctaga ggatcaaccg tcgatcagaa ggagcgcaat 40 <210> 51 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 51 gaagtccagc tcgtcgagtc tggtg 25 <210> 52 <211> 37 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 52 agaagtgaaa atttatttac caggagacaa ggacaga 37 <210> 53 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 53 gacatccaga tgacacagtcccctt 25 <210> 54 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 54 ctcaaagctg atctaacact caccacggtt gaaggactta 40 <210> 55 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 55 agatagggtt gagtggatgg ccaaccaacg ctaatgtatc 40 <210> 56 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 56 tagctagagc ttggcatcgg ttgacgggtt gctgaaatgc 40 <210> 57 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 57 cactcaaccc tatctcggtc t 21 <210> 58 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 58 gccaagctct agctagaggt cgacg 25 <210> 59 <211> 1988 <212> DNA <213> Talaromyces cellulolyticus <400> 59 atggcaaacc ctcctcacgg tggtatcctc aaggacttgg tggcccgcga tgcccctcgt 60 catgccgagc tcgaggctga agctgccacc ctacctgcta ttcttctcac agaacgccaa 120 ttgtgtgatt tggagttgat tatgaatggt ggtttcagtc ctcttgaagg taagtctttt 180 tgtcgcacgc gatcgagaag attattagct aacatttttc ttctataggt ttcatgaacg 240 together cgatgggtat gcaacatatc ttgcgcgcgc agtgaaagga acaattttct gactgactta gtgttgtcgc cgaatctcgc ctcgccgatg gcaacctttt ctccatgccc 360 attactctcg atgcctctgg cgaaaccatt aaagaccttg gcttgaaggc tggatctcgt 420 gtcacattac gcgatttccg tgacgaccgc aaccttgcta ttttgaccat tgatgatatc 480 taccgccctg acaagtgagt cctgcaatca gcttgtgcga cgaaacatgc tgaccccttt 540 taccaggacg aaagaagccc agctcgtctt tggaggtgac gaagagcacc ccgctatcgt atatctcaat accaaggttc aggagttcta cattggagga aaggtcgaag ctgttaacaa acttgcccac acttgcttg tcgctctccg atgtgagtta ctattcaaca gagacaatag tacatagact aaccatgtag acactcccgc tgaattgcgc acacacttcg acaagctcgg ctggacccga gttgttgctt tccagaccag gtatgctaaa agcagacgat aggagttatt 840 tgaatgtcac tgacactagt agaaacccca tgcatcgtgc tcaccgtgaa ttgaccgtcc gcgctgcccg tgctcgtcaa gccaatgtgc tcatccaccc cgtcgtcggt ctcaccaagc 960. ccggtgacat tgaccacttc acccgtgtcc gtgtctacca agcccttctt cctcgttacc 1020 ccaacggcat ggctgtcctc ggtcttttgc ctcttgctat gcgtatgggt ggtcctcgtg 1080 aggccatctg gcacgccatt atccgtaaga accacggtgc cacccacttc attgtcggac 1140 gtgaccacgc cggtcccgga aagaactcca agggtgtcga attttacggt ccttacgatg 1200 ctcagcatgc tgttgagaag tacaggtctg agttgggtat tgaggtggtt gaattccagc 1260 aggttaccta cctgcctgat accgacgagt acaagcctgt taatgaggtt tctgccggtg 1320 taaagactct tgatatctct ggtactgagc tcaggagacg tcttcgctcg ggtgctcaca 1380 tcccagagtg gttctcttac cctgaggtca tcaaggttct ccgcgagtcc aacccccctc 1440 gcaatgctca aggtttcacc gtcttcctca ctggatacca gaactctggc aaggacgcca 1500 ttgcccgcgc tcttcaagtg actctcaacc agcaaggtgg ccggtccgtc tcgctcttgt 1560 tgggagagac cgtccgtcac gagctttcct cagagcttgg tttcagccgc gaagaccgcg 1620 acaaaaacat tcaacgtatt gcctttgtcg ctgccgagct caccaaggcc ggtgctgccg 1680 ttatcgctgc acccatcgct ccttacgaat catcccgaaa ggctgccaaa gacaccatct 1740 ccgcagtcgg cacattcatt ctcgtccacg tcgccacccc tcttgagtac tgcgagaaga 1800 ccgacaagcg cggaatctac gcgaaggccc gccgcggcga gatcaagggc ttcactggtg 1860 tcgatgaccc atacgaggct cccgccaagg ccgacctcgt ggtcgacgtt gagaagcaga 1920 gtgtccgcag tatcgtgcac gagattgtct tgattctcga gagccaggga ttcctcgatc 1980 ggtcttag 1988 <210> 60 <211> 1589 <212> DNA <213> Talaromyces cellulolyticus <400> 60 atgaagggcg tcctcagcct ttcgctgctg ccgttgttga cggttgcgtc accggtgatg 60 ccgcgcacca tccacaacga cgctgctccc attctctctt cgtccaacgc cgttgaggtc 120 ccagattcat atatcattgt ctttaaagac catgtagatt ctgcttctgc cgcagcccat 180 cataactggg tgcaagacat tcacagccaa cacaccgagc tccgaaagcg gtctcaattc 240 ccattcgctg acaatgcctt tgccggtctc aaacacactt ttgacattgc cggcagcttc 300 cttggttact caggacactt cgaagagaat gtcattgagg ccattcgccg acaccccgat 360 gtgagttatc cgcacgtgcc ctactcctaa ggcaatgact aatacgcatc tccacctata 420 ggttgattac atcgagaagg attctcttgt ccacaccatg gaagatcccg cccttgagaa 480 gaacgcccca tggggtttgg ctcgtatttc gcaccgtgag agcttgagct tcggaagctt 540 caacaagtac ttgtacgctg ccgacggcgg tgaaggtgtt gacgtttatg tcattgacac 600 tggtaccaac atcgaccacg tcgacttcga gggtcgtgct tcctggggca agaccatccc 660 cactgacgat gaggatgttg atggcaatgg tcacggtact cactgctccg gaactattgc 720 gggcaagaag tacggtgttg ccaagaaggc caatgtctac gctgtcaagg tcttgaagtc 780 taacggttct ggaaccatgt ccgatgtcgt tcagggtgtc gaatgggctg ctactcagca 840 catcaagaag gtcaaggacg ccaaggccgg aaaagccaag ggcttcaagg gtagcgctgc 900 gaacatgagt ctcggtggtg gcaagtccgt cactcttgac aaggctgtca atgctgctgt 960 tgatgctggt atccacttcg ctgtcgctgc tggcaacgac aacgccgact cctgcaacta 1020 ctcccctgcc gccgctgaga aggccgtcac cgtcggagcc tcgaccttgg ccgatgagcg 1080 tgcttacttc tccaactacg gcaagtgcaa cgacatcttt gctcctggtc tgaacattct 1140 ctctacctgg atcggcagca agtacgccgt caacaccatc tccggtacct ccatggcttc 1200 tcctcacatt gctggtcttt tggcctactt cctctctctc cagcctgcca gtgactccgc 1260 cttcgctgtt gccgagatta ctcccaagaa gttgaaggag aacctcattg ctattggtac 1320 ccagggcgct cttactgatg ttccctctga caccactaac gtaagttgac tctgttagtc 1380 tttcaatgca ttatcaacta acaactgtgt catagattct cgcctggaac ggtggtggct 1440 cagccaacta caccgacatc attgcccaag gtggttacaa gaccaagaca ctcagcaacg 1500 aagttgacga attgatcaac aagttggagg tcgtgaacga ggaactcggt gccatctaca 1560 gccacatcaa ggatgccatt gccgcataa 1589 <210> 61 <211> 3534 <212> DNA <213> Talaromyces cellulolyticus <400> 61 ccggtcgagt caggtattca tatcatccat tcatggattg ttatctgtga acacaacgcc 60 aacgttgcaa aatccggcca tttgatggca cggtttaaat gtcccttgct cattggggat 120 gaaaatattc aacgtaagtt ctacatcctt ggctatcaat gtcgcttgcc gggtcaaatc 180 attcaatact gtcctggaca gtcctctttc caaccggtgg agtaatctag gcaaggttca 240 ttcggcaagt ttcctaggca tcatggttcc aaaaagtgaa aaaagagact gggagaatca 300 tatatccatc tcagcctata tggctacgtc ttgaacagtg accttgccat aaatggcgac 360 atgaagtagg gttagggcta gggcttttct caggttatgg catcataagt cttggcaggg 420 acgttaatgt tagcatgcaa tcacgcaagc cgccaagccg atgtcgtgat tgcttttctg 480 tctggaactg gcagccgcta aactgtaatg ggattcacca aactggcgct tagccagata 540 tagtctagtg tctgatctct tgtttaaaaa tttcgcaatg tattgattgt attcaaatgt 600 agtaagtgta ttgcgattgt atacagattc gaagtaataa attgcgccag tcgactgaat 660 tgttacacat tttcttaaag gcaaaatag ttgaattggc attacttggc gagattgaaa 720 gagacgtttg agctgatgtg gcagtcgtca tggtgtaatt ttgggcgtat tccacgtaat 780 caattccctt ggtcaatgca tatctggcca ataaattaa cgcgtccacc acggatagtt 840 gattacctta tcgataaaag tgggatgtaa gtaatttaag gaaccgtacc acagtgatac 900 atacagcaac caccatctct tccgacatca gctccgatta tttcttcttc attcctttta 960 ttttgaactc attctttttc tctttcttct tccttgatat atttgtttgt taattctctc 1020 ttcatatcaa taaaaatggc aaaccctcct cacggtggta tcctcaagga cttggtggcc 1080 cgcgatgccc ctcgtcatgc cgagctcgag gctgaagctg ccaccctacc tgctattctt 1140 ctcacagaac gccaattgtg tgatttggag ttgattatga atggtggttt cagtcctctt 1200 gaaggtaagt cttttgtcg cacgcgatcg agaagattat tagctaacat ttttcttcta 1260 taggtttcat gaacgagaaaa gattacgatg ggtatgcaac atactcttgcg cgcgcagtga 1320 aaggaacaat tttctgactg acttagtgtt gtcgccgaat ctcgcctcgc cgatggcaac 1380 cttttctcca tgcccattac tctcgatgcc tctggcgaaa ccattaaaga cttggcttg 1440 aaggctggat ctcgtgtcac attacgcgat ttccgtgacg accgcaacct tgctattttg 1500 accattgatg atatctaccg ccctgacaag tgagtcctgc aatcagcttg tgcgacgaaa 1560 catgctgacc ccttttacca ggacgaaaga agcccagctc gtctttggag gtgacgaaga 1620 gcaccccgct atcgtatatc tcaataccaa ggttcaggag ttctacattg gaggaaaggt 1680 cgaagctgtt aacaaacttg cccactacga ctatgtcgct ctccgatgtg agttactatt 1740 caacagagac aatagtacat agactaacca tgtagacact cccgctgaat tgcgcacaca 1800 cttcgacaag ctcggctgga cccgagttgt tgctttccag accaggtatg ctaaaagcag 1860 acgataggag ttatttgaat gtcactgaca ctagtagaaa ccccatgcat cgtgctcacc 1920 gtgaattgac cgtccgcgct gcccgtgctc gtcaagccaa tgtgctcatc caccccgtcg 1980 tcggtctcac caagcccggt gacattgacc acttcacccg tgtccgtgtc taccaagccc 2040 ttcttcctcg ttaccccaac ggcatggctg tcctcggtct tttgcctctt gctatgcgta 2100 tgggtggtcc tcgtgaggcc atctggcacg ccattatccg taagaaccac ggtgccaccc 2160 acttcattgt cggacgtgac cacgccggtc ccggaaagaa ctccaagggt gtcgaatttt 2220 acggtcctta cgatgctcag catgctgttg agaagtacag gtctgagttg ggtattgagg 2280 tggttgaatt ccagcaggtt acctacctgc ctgataccga cgagtacaag cctgttaatg 2340 aggtttctgc cggtgtaaag actcttgata tctctggtac tgagctcagg agacgtcttc 2400 gctcgggtgc tcacatccca gagtggttct cttaccctga ggtcatcaag gttctccgcg 2460 agtccaaccc ccctcgcaat gctcaaggtt tcaccgtctt cctcactgga taccagaact 2520 ctggcaagga cgccattgcc cgcgctcttc aagtgactct caaccagcaa ggtggccggt 2580 ccgtctcgct cttgttggga gagaccgtcc gtcacgagct ttcctcagag cttggtttca 2640 gccgcgaaga ccgcgacaaa aacattcaac gtattgcctt tgtcgctgcc gagctcacca 2700 aggccggtgc tgccgttatc gctgcaccca tcgctcctta cgaatcatcc cgaaaggctg 2760 ccaaagacac catctccgca gtcggcacat tcattctcgt ccacgtcgcc acccctcttg 2820 agtactgcga gaagaccgac aagcgcggaa tctacgcgaa ggcccgccgc ggcgagatca 2880 agggcttcac tggtgtcgat gacccatacg aggctcccgc caaggccgac ctcgtggtcg 2940 acgttgagaa gcagagtgtc cgcagtatcg tgcacgagat tgtcttgatt ctcgagagcc 3000 agggattcct cgatcggtct taggtttgct tgtgaacaaa accaaaagaa atgagttatg 3060 caattggttt agggtaatga atgtgcttga tatggaagca atgtgcatac agattaggag 3120 ctacatagag gcgttaatct agttatttgc atccctttc gccctgtaga tatagtttgt 3180 ggagtatgat caacgtgggg ttgatctgat aaagtcgtcc atatcggaga tttatccgat 3240 atccaatatc cgattatcgc aattggccat tgaactagag tattcgtcat ctactgacga 3300 tttgtacata tgtacttagt ttcaatcccc cttcttcctc caatccatct ggtgcaatta 3360 tagataga ggaaagaaaa tgacccaatc aatccaccac atagcccaaa ccggcttctc 3420 agacgcctca tcctacgaca aacacagacc aacctacacc gcgcacgaaa cagatctgat 3480 tctaaaccgc acgaatgtcg cgaaccgtaa gggtttgagg cttgttgacc tcgc 3534 <210> 62 <211> 2858 <212> DNA <213> Talaromyces cellulolyticus <400> 62 gtcaattcag atcggctgcc gcctgcgccc caggtgacgt cgatgaaagc tgggcctagg 60 tcgtgcatgc ggtccatacg gtcgtataag ttctggacac cttgggcggt ctttgggggg 120 aagtattcga aggaaattcc aggtcggccg gtggccgcct gttcttggag cttttgcccg 180 acatgcatgt tgataggtcg gtcaattgtc tgctttttca atatcttctc ggtatgatgt 240 agcttgcaga acccaagtta tgtagttcaa ttgcaaaatc aagtctgatc aagaccgaaa 300 ctcaatcccg gagcactgag gttcgcacta attgatcaag ggtacaagaa tgaggggcac 360 aatgaaagca gtcttgaaaa tgacaggcag agaaattgaa agaaaggaga agagaggacc 420 tccgggacag gagaaatgaa agcaacaaaa ccccgaacaa gctggagaga agttaaaggg 480 agcagcttgg tcaccggcaa tggatgctca tcataaaaaa ggaccctaaa cccgttatcg 540 gagtccggag aaatgacgct aattcggatt tggaagtccc cgccaatcgt gggaaattct 600 cgaagcagac aatttgctcg tgacaatcag ccagcaatga gagggagact gaaaaatatg 660 tatttacact caaagaatcc gatactgcta ttaggatcag tgtttttctt ataagcaaat 720 gagcgttgga cgtggaaaat gaggaatcct cagtccctat actcggtcag cgacggaggg 780 gtgcgtgatc ggccaatcac agcctattat tttatcaaca tctgattggc tacttccgat 840 aagagcgaaa tatgcccctc cttgcaattt ttaccatcaa cgctaacagc aacactcaac 900 aaaccattca atcttgatac tcgctcccat tagtcaccac gcaggacaac acaacacgac 960 atcgcatctc agctttgacc attcccgccg caagcgattc gctgtcacaa acgccagata 1020 ccccaacatg gctgcccctc cctccgccga tcaggactac aagaccaatc tgttgtcttt 1080 gctgatagcc aacgatgcgc tcgcatttgg cacgttcaca ttgaaatctg gtcgccagtc 1140 gccgtatttt ttgacctcga gtcgtcttta tactgcgcct ctgctgcgcc aggtgtcggc 1200 cgcgttcgcg aataccatct cgtccccgcc ttttgtgaat atagctgcag atggcagcat 1260 taccccgaac tttgacattg tttttgggta tgttacccta ttattcgtgc gcctgatatg 1320 cgtgtactga tttacttcaa atagccccgc ctacaaagga atccccgaat gcgtcggtgt 1380 tgtcaacgag ctcgctaccc gggatgcgct cgccggtacc aagacatggg acaacatcag 1440 ctactccttc aaccgcaaag aagccaaaga ccacggcgaa gggggtaaca tcgtcggtgc 1500 gcctctcaag ggaaaacgtg ttttgatcgt tgacgacgtc atcaccgctg gtaccgcgct 1560 gcgtgaagct gtcggcatta ttcaaaagga aggcggaacc gttgccggtg ttgtgttgct 1620 gttcgatcgt caggaacggg tcagtgatac ggagcagaag agtgccattg gagccgcgga 1680 gagggacctt ggaggcgata ttcctatccg tgcggtgttg gtattccagg atttgattga 1740 taagcttgga gataagattg gtcaggagga ggtgcgcagg ttggaagagt accggaacac 1800 gtacaaggct caataaatgg ctgctgtggg atgaaatggg tatattaacg attatgcta 1860 aaaatggctg ggtggaatac tgcgaaataa atataaatca gcttgaagga tgtattttta 1920 gcgcaaagtg atagaatttt ctatgtaaat agtttgtaca ataggattac tactttatat 1980 gcgttatgcg tatacatttc taaagtgtaa ccagtttagc tgggagtaca attttaacac 2040 tcttccatca atcaggttcc agatcagttt tctatctaca atcatgactc cccagtctct 2100 actcctttca agaatgacgc gttatgttcc aagctcccct ggttgatggc ggtaacccga 2160 tatattctag ccaggtcagg tcctagtgtg aggactaaca caggcacgtc cagtatcgta 2220 gcaatagaa tatcagcata tataagtccc ctttcccgga ccttgctcga gtcagtgact 2280 agcaggtacg tacgtaccca tcagactatc tactatctac tatgtacgga gtatatagtc 2340 ggtacttgac gcaaggcgag tctgatagag ggacaatatg cagttctgta gccaatcaat 2400 cgcggatggc agaccctcga tcgtcattgt ggatctttag cttccttatg ggcggggcgg 2460 tggttattc agagccattt agccaatcat acatcgtagt ccgaaagtct aggattatat 2520 aggctagacc aatctactgt caaccggtaa agcgggtctc tagtctttat cccgacctcc 2580 tctctttctc tttctccgat tcgaatgtga cacatacatc tgatcaattg ataagaatac 2640 ggattgccgt gtacgtgggc tgacagagct gagataaaat atcctggatg tgatatgtgg 2700 cgcatccagt accgacactg tgacaggatc cgtgtactac aattcattca tcgatcgttg 2760 gctaggcaaa aagtaggcaa ggtttgcaga tcgatatccc ggtacctggc taaaatcgag 2820 acccatac atatagtact gactcggcgt tcacttat 2858 <210> 63 <211> 1100 <212> DNA <213> Thalaromyces cellulolyticus <400> 63 60. tgctatgcag ttgatgctac tgtgttctaa aataattgat agggttaggg tcgggtata ggcgatgcaa tgtatcaatt atcacgaga atatgcaga aaaacacaat tccccgtatc tgttgattct taacaatct gatcaccat ttgtagaaag aaacgattat aaggtgccat ggtaatgctg gagtttacac aggatactac ttgttctgtt cattacaatg aaccgtaatt gcattctgtt ttgaccactc aacaaatcct acacaaaagt aagtggactt cagtgctcgc tctacgcaag taaatacttg gcatatatgg cctcgtatat tcttacaatg aggtaaattc cgatagatta ctgcccaact agtcaatctt aaatccttaa gagatacagg gggaggcgga agtacctgaa accacgtaat aagacgttca gggtcatgtg aatgtatgta gtatccatgt ccaatacaat tgataatagt atccagtatt atatctcatt caggtaagcg ccacgcgatt cttcagatct acttaactgc cgactcgcca aacgaaacaa cgtttattcg tgaccccaga aaatcaccgc ggagttgcgg aggaccagtt tgtacaatgc accgaaccaa gcgttggtca tttttctgga aatgggccaa acgttagaag tgattggtca gagctacatc tgaaggtgaa 720 gcaatttccg gtatgcatac atgacagcaa gcttacctac caagaccaag ttattcccca 780 gcatttgccc catacttggc tttaatattg tgggatagca aacaatatcc acaacactga 840 tgataactaa actacaaatc tgacgttact tcagactact cacgtgtcaa aagcagttag 900 cgaggatcaa gtcttttagt ctggtcatta acaaacgcaa tttcgcaacc cgataatccg 960 cgatgataat atagcgactc caaggtcgta tttatattca atcaattccc cccaatttgg 1020 aatggatttt tggaatcatc gcatgccagg acaatcagtg aaacagtgac aaagtgaagc 1080 [[ID=,15]]ttcttgatca tttagcaact 1100 <210> 64 <211> 78 <212> DNA <213> Talaromyces cellulolyticus <400> 64 atgtctgcct tgaactcttt caatatgtac aagagcgccc tcatcttggg ctccttgctg 60 gcaacagctg gtgctcag 78 <210> 65 <211> 1356 <212> DNA <213> Homo sapiens <400> 65 gaagtccagc tcgtcgagtc tggtggtggc ttggtccaac ccggtggatc cttacgtctc 60 tcttgtgcag ctagcggttt caacatcaag gacacctaca tccattgggt tcgtcaagct 120 cctggcaaag gtttggaatg ggttgcgcgt atctacccta cgaacggtta cacccgttat 180 gccgacagcg ttaagggccg tttcaccatt tctgccgaca cttccaagaa caccgcctac 240 ttgcagatga actccttgag agccgaggat actgccgtct actactgcag ccgttgggga 300 ggtgatgggt tctacgccat ggactactgg ggtcaaggca cccttgttac cgttagctcc 360 gccagcacaa agggtccctc cgtcttccct ttggctccct cctccaagtc tacttccggt 420 ggtaccgctg cactgggttg cttggtcaag gactacttcc ctgagcccgt cactgtcagc 480 tggaattctg gcgcattgac ttctggtgtc cacacttttc ccgctgttct ccaatcttcc 540 ggcttgtaca gcctaagcag cgttgtcact gtgccctctt cctccttggg cactcagacc 600 tacatctgca acgtcaacca caagccctcc aacacgaagg ttgacaagaa ggtggaacct 660 cccaagtcct gcgataagac ccacacctgt cctccctgtc ctgctcctga actgttgggt 720 ggaccctcag tgttcttgtt ccctcccaag cccaaggaca ctctcatgat cagccgtact 780 cctgaggtta catgcgtcgt cgtcgatgtc tcccatgagg atcctgaggt caagttcaac 840 tggtacgtcg acggtgtcga ggtccacaat gccaagacca agcctcgtga agaacagtac 900 aactccacct accgcgttgt ttcagtcttg accgtgttgc accaggattg gctgaacggc 960 aaggagtca agtgcaaggt ctccaacaag gccctgcctg ctcccatcga gaaaccatc 1020 agtaaggcca aaggtcaacc tcgcgaaccc caggtttaca ccctccctcc ttctcgggac 1080 gaactcacca agaaccaggt ctcgttgact tgccttgtta agggattcta ccctagcgat 1140 attgccgttg agtgggagtc caatggtcag cccgagaaca actacaagac tacccctcct 1200 gttctcgact ctgacggatc tttcttctc tacagcaagt tgaccgtcga caaaagccgt 1260 tggcagcaag gcaacgtttt ctcctgctct gtcatgcacg aggctctcca caaccactac 1320 acacagaagt ctctgtcctt gtctcctggt aataa 1356 <210> 66 <211> 1680 <212> DNA <213> Talaromyces cellulolyticus <400> 66 attttcactt ctttcttcgc ctattgattg ggctatgaca aattaggag agataggttg 60 gacgttgtca agtcaaatg taccgaacac gatgcgttga tatgctgcac atgtgcctag 120 tatccattcg ttcctattta tattaaattg aaatttctt atccaattac tgagctaaaa 180 catacttcag cactgtaagc gccagcctaa gttatgctat gttagactgt ccggattcgg 240 ctggcactgg cttttgtgat ccccagtatc atgtaaggt atccgcctgt tgttagggg 300 gtcttaaatg ttgtataaag tttctgcta ggctgtttat gcttgataga gatatatat 360 atatatctag ctgctattaa tatccttgtt tcaatgtctt agacttccaa ggttacctac 420 ccgcgtgcgt ggactaatac aaacaatctc acccagaca atcttataca aactcggatt 480 ctggtcaatc cgttccttgg ttatattgct aaaaaacta ggtagcccaa aattccatct 540 caagccgtat aagaactttc aaattcacca tggtactctc acggcgaag catctccgtc 600 ttccatctgc caaatccat taccaaatc ggaagtaccc gatgtagca atgaacaat 660 aactttcgca ccatctagcg gatccttttgt gccacgatag tgttgaacg cagttttgca 720 atacccagga ctactgctt ggatgataac acctcattc gccgggtctt tcccatattc 780 gaccgtgagc atgttaaggg ccgtctttga ggcgcagtac gcgatagtaa cagttggagg 840 cagcttgcca gatgatgata ggcccaaaga accccgtgtg gatgatacgt ttattatgtg 900 gcctcgaggc gactgacgca aaagtgtag gatagatct atggtcattg cgaccgatgt 960 gatatcaca tcaaagttc ggttgtaagt agaccgcatt tcggaaatg aagtctggggt 1020 gaaggcaacg gcagcattgt ttcagaac tagacatctg tagagaatt tctaaagccc 1080 gctcactcga gatgaaata ggcttaccat ccagtctacc atatgttgtc tcgaccgcct 1140 tagcaaagc atgaggcta tcgtcgcgag tcacatcaac ctcataacg tcgatcttgg 1200 attgaacagc gagctctc aaccgcttaa gtgcctgat tccgtctcc ttattccggc 1260 atcctaagat gaagtgatcg gatggactat gcagacttaa agcctggagg gtaccaacc 1320 cgatgcctga cattattag tgatcatata gatgagtat catggccatc gcaatctac 1380 ctctgtttgc tccagttata agaattagcc ttgatgacat ctgtgagag aagtaaaga 1440 taatagcaga tgaatttcga tcgtatactg gttgtattgg caatcttgac gagaatggtt 1500 tcattgtcag accatcagtt ccctttatat acctgccatt ctctccttta taaataatta 1560 ttcggtttta acacggagat actcggattt catcacacaa attgcatttc ttccgatagt 1620 tgttgaagat cggaagtcct tcgaatgatc atttctataa ctacgcctta ccgttttcgg 1680 <210> 67 <211> 645 <212> DNA <213> Homo sapiens <400> 67 gacatccaga tgacacagtc cccttctagc ctttctgcct ctgttggaga tcgtgtcacc 60[[ID=!9]] atcacttgtc gtgcttctca agacgtcaac acagccgttg cctggtatca gcagaaaccc 120 ggcaaagctc ccaagttgct gatctacagc gctagcttcc tgtacagcgg tgtcccttct 180 cgcttctcag gttcccgttc tggtaccgac ttcaccttga ccatttccag cttgcaaccc 240 gaggatttcg ccacgtacta ctgccagcaa cactacacca ctcctcccac ctttggccaa 300 ggtaccaagg tcgagatcaa gcggactgtt gccgcacctt ccgtcttcat cttccctccc 360 tcggatgagc agctcaagtc tggaactgcg tctgtcgttt gcttgctcaa caacttctac 420 cctcgtgaag ccaaggtcca gtggaaggtc gandacgctt tgcagtccgg caatagccaa 480 gagtccgtta ccgaacagga cagcaggac tccacttact ccttgagttc cactctcacc 540 ttgtccaagg ccgattacga gagcacaag gtctacgctt gcgaagtgac ccatcaggt 600 ctctctagcc ctgttactaa gtccttcaac cgtggtgagt gttag 645 <210> 68 <211> 497 <212> DNA <213> Talaromyces cellulolyticus <400> 68 atcagctttg agtgcagcaa aaatgcttcc gactgtctc ttatattgat atcatatttt 60 tcaattcact ttgtctcaag ttcaata tcgagaaaat agtatcaaag atgaactgta 120 ataatccga tatacctata caggtttata gtaaattact ctatttcata atgcgtccat 180 ccgagaagtc tggcggcctt atcagtagtc caaacgcct ggttttaga catgtcacct 240 ctaatctccg cttgaggaaa atgcgtccga gcaagttctt tcgacggggt gtcttgggtc 300 gtagttggag atatgatatt tattactcg aatcctttga tattctcact cttttcaacc 360 gccaaaagc aagctcttgc cactgcgcga ggattaaccc atccccagag ttgtcgaacc 420 ccagattcat accatttatc gtggtgtcttt tttctaacat ctctcaatgg ggcaacctca 480 tgtattctca aacaagc 497 <210> 69 <211> 1812 <212> DNA <213> Talaromyces cellulolyticus <400> 69 cactcaaccc tatctcggtc tattcttttg attataagg gattttgccg atttcggcct 60 attggttaaa aaatgagctg atttaacaaa aatttaacgc gaattaattc tgtggaatgt 120 gtgtcagtta gggtgtggaa agtccccagg ctccccagca ggcagaagta tgcaaagcat 180 gcatctcaat tagtcagcaa ccaggtgtgg aaagtcccca ggctccccag caggcagaag 240 tatgcaaagc atgcatctca attagtcagc aaccatagtc ccgcccctaa ctccgcccat 300 cccgcccta actccgccca gttccgccca ttctccgccc catggctgac taattttttt 360 tattatgca gaggccgagg ccgcctctgc ctctgagcta ttccagaagt agtgaggagg 420 cttttttgga ggcctaggct tttgcaaaaa gctcccgggga gcttgtatat ccattttcgg 480 atctgatcag cacgtgatga aaaagcctga actcaccgcg acgtctgtcg agaagtttct 540 gatcgaaaag ttcgacagcg tctccgacct gatgcagctc tcggagggcg aagaatctcg 600 tgctttcagc ttcgatgtag gagggcgtgg atatgtcctg cgggtaaata gctgcgccga 660 tggtttctac aaagatcgtt atgtttatcg gcactttgca tcggccgcgc tcccgattcc 720 ggaagtgctt gacattgggg aattcagcga gagcctgacc tattgcatct cccgccgtgc 780 acagggtgtc acgttgcaag acctgcctga aaccgaactg cccgctgttc tgcagccggt 840 cgcggaggcc atggatgcga tcgctgcggc cgatcttagc cagacgagcg ggttcggccc 900 attcggaccg caaggaatcg gtcaatacac tacatggcgt gatttcatat gcgcgattgc 960 tgatccccat gtgtatcact ggcaaactgt gatggacgac accgtcagtg cgtccgtcgc 1020 gcaggctctc gatgagctga tgctttgggc cgaggactgc cccgaagtcc ggcacctcgt 1080 gcacgcggat ttcggctcca acaatgtcct gacggacaat ggccgcataa cagcggtcat 1140 tgactggagc gaggcgatgt tcggggattc ccaatacgag gtcgccaaca tcttcttctg 1200 gaggccgtgg ttggcttgta tggagcagca gacgcgctac ttcgagcgga ggcatccgga 1260 gcttgcagga tcgccgcggc tccgggcgta tatgctccgc attggtcttg accaactcta 1320 tcagagcttg gttgacggca attcgatga tgcagcttgg gcgcagggtc gatgcgacgc 1380 aatcgtccga tccggagccg ggactgtcgg gcgtacacaa atcgcccgca gaagcgcggc 1440 cgtctggacc gatggctgtg tagaagtact cgccgatagt ggaaaccgac gccccagcac 1500 tcgtccgagg gcaaaggaat agcacgtgct acgagatttc gattccaccg ccgccttcta 1560 tgaaaggttg ggcttcggaa tcgttttccg ggacgccggc tggatgatcc tccagcgcgg 1620 ggatctcatg ctggagttct tcgcccaccc caacttgttt attgcagctt ataatggtta 1680 caaataaagc aatagcatca caaatttcac aaataaagca ttttttcac tgcattctag 1740 ttgtggttg tccaaactca tcaatgtatc ttatcatgtc tgtataccgt cgacctctag 1800 ctagagcttg gc 1812 <210> 70 <211> 1364 <212> DNA <213> Talaromyces cellulolyticus <400> 70 atgaagacta cctctgtgct cgcagccgcc gcgctggccg gcgctgctac cgccaaggtc 60 cacaagctca agctggacaa ggtgcctctc tctgagcaat ttgtatgaca ttctcaactc 120 ttcgctttaa tttgttcta tggtcttgaa ctgatgatga tttgttaaag gataaacgcg 180 gcatgaacga ccacatgcgg tctttgggtc agaagtacat gggcgttgtc cccgagggaa 240 tgtaccagga cacctccatc cgaccggagg gcggccacga tgtgctggtc gataactttt 300 tgaacgctca gtgtatgtga ataccatcgg atgatcttga tgatttgatg ctaactattc 360 gttctagact tctcagagat caccatcggt acacccccac agaacttcaa ggtcgtcctt 420 gataccggga gctcgaactt gtgggttcct tcatcctctt gcaactcgat tgcttgctac 480 ttgcacaaca agtatgactc gtcctcttcc tctacctaca agaagaacgg cagcgacttt 540 gccatccagt atggctcagg tagccttgag ggcttcgttt cccgcgacac tgtcacgatt 600 ggcgaccttt ccattaagga ccaagacttc gccgaagcca caaacgagcc tggcttggct 660 tttgccttg gccgctttga cggtattttg ggtcttggtt tcgacaccat ctcagtcaac 720 aagattgtcc ctccgttcta taacatgcta aaccagaagt ctcttgatga gcctgtcttt gccttctacc tcggcgatag cacao ggtgatgatt ctgaggctac ctttggtggt 840 attgacgaga gccactacac tggaagttg gtcaagatcc ctctccgccg caaggcctac tgggaggtgg actttgatgc cattgctttt ggcgacaacg ttgctgagct tgagaacacc ggagtcatcc ttgacactgg tacttccctc attgctcttc cttccactct tgccgagctc 1020 ttgtaagtca tctattactc gctacacata aaaatatatg ctaatatctt tttaggaaca aggagattgg tgcctccaag tcatggaacg gtcaatacac tgtcgactgt gccaagcgtg actctcttcc cgacctcacc gtcaccctga gcggatacaa cttctccatc agcgctttcg actacgtttt ggagtccag ggatcttgca tcagcgcttt catgggcatg gacttccctg agcctgtcgg ccctcttgct atccttggtg atgctttcct ccgcaagtgg tacagcgtct acgacttggg caacggtgcc gtcggtctcg ccaaggcca gtaa <210> 71 <211> 395 <212> PRT <213> Thalaromyces cellulolyticus <400> 71 Met Lys Thr Thr Ser Val Leu Ala Ala Ala Ala Leu Ala Gly Ala Ala 1 5 10 15 Thr Ala Lys Val His Lys Leu Lys Leu Asp Lys Val Pro Leu Ser Glu 20 25 30 Gln Phe Asp Lys Arg Gly Met Asn Asp His Met Arg Ser Leu Gly Gln 35 40 45 Lys Tyr Met Gly Val Val Pro Glu Gly Met Tyr Gln Asp Thr Ser Ile 50 55 60 Arg Pro Glu Gly Gly His Asp Val Leu Val Asp Asn Phe Leu Asn Ala 65 70 75 80 Gln Tyr Phe Ser Glu Ile Thr Ile Gly Thr Pro Pro Gln Asn Phe Lys 85 90 95 Val Val Leu Asp Thr Gly Ser Ser Asn Leu Trp Val Pro Ser Ser Ser 100 105 110 Cys Asn Ser Ile Ala Cys Tyr Leu His Asn Lys Tyr Asp Ser Ser Ser 115 120 125 Ser Ser Thr Tyr Lys Lys Asn Gly Ser Asp Phe Ala Ile Gln Tyr Gly 130 135 140 Ser Gly Ser Leu Glu Gly Phe Val Ser Arg Asp Thr Val Thr Ile Gly 145 150 155 160 Asp Leu Ser Ile Lys Asp Gln Asp Phe Ala Glu Ala Thr Asn Glu Pro 165 170 175 Gly Leu Ala Phe Ala Phe Gly Arg Phe Asp Gly Ile Leu Gly Leu Gly 180 185 190 Phe Asp Thr Ile Ser Val Asn Lys Ile Val Pro Pro Phe Tyr Asn Met 195 200 205 Leu Asn Gln Lys Ser Leu Asp Glu Pro Val Phe Ala Phe Tyr Leu Gly 210 215 220 Asp Ser Asn Lys Glu Gly Asp Asp Ser Glu Ala Thr Phe Gly Gly Ile 225 230 235 240 Asp Glu Ser His Tyr Thr Gly Lys Leu Val Lys Ile Pro Leu Arg Arg 245 250 255 Lys Ala Tyr Trp Glu Val Asp Phe Asp Ala Ile Ala Phe Gly Asp Asn 260 265 270 Val Ala Glu Leu Glu Asn Thr Gly Val Ile Leu Asp Thr Gly Thr Ser 275 280 285 Leu Ile Ala Leu Pro Ser Thr Leu Ala Glu Leu Leu Asn Lys Glu Ile 290 295 300 Gly Ala Ser Lys Ser Trp Asn Gly Gln Tyr Thr Val Asp Cys Ala Lys 305 310 315 320 Arg Asp Ser Leu Pro Asp Leu Thr Val Thr Leu Ser Gly Tyr Asn Phe 325 330 335 Ser Ile Ser Ala Phe Asp Tyr Val Leu Glu Val Gln Gly Ser Cys Ile 340 345 350 Ser Ala Phe Met Gly Met Asp Phe Pro Glu Pro Val Gly Pro Leu Ala 355 360 365 Ile Leu Gly Asp Ala Phe Leu Arg Lys Trp Tyr Ser Val Tyr Asp Leu 370 375 380 Gly Asn Gly Ala Val Gly Leu Ala Lys Ala Lys 385 390 395 <210> 72 <211> 26 <212> PRT <213> Talaromyces cellulolyticus <400> 72 Met Ser Ala Leu Asn Ser Phe Asn Met Tyr Lys Ser Ala Leu Ile Leu 1 5 10 15 Gly Ser Leu Leu Ala Thr Ala Gly Ala Gln 20 25 <210> 73 <211> 490 <212> PRT <213> Talaromyces cellulolyticus <400> 73 Met Lys Gly Val Leu Ser Leu Ser Leu Leu Pro Leu Leu Thr Val Ala 1 5 10 15 Ser Pro Val Met Pro Arg Thr Ile His Asn Asp Ala Ala Pro Ile Leu 20 25 30 Ser Ser Ser Asn Ala Val Glu Val Pro Asp Ser Tyr Ile Ile Val Phe 35 40 45 Lys Asp His Val Asp Ser Ala Ser Ala Ala Ala His His Asn Trp Val 50 55 60 Gln Asp Ile His Ser Gln His Thr Glu Leu Arg Lys Arg Ser Gln Phe 65 70 75 80 Pro Phe Ala Asp Asn Ala Phe Ala Gly Leu Lys His Thr Phe Asp Ile 85 90 95 Ala Gly Ser Phe Leu Gly Tyr Ser Gly His Phe Glu Glu Asn Val Ile 100 105 110 Glu Ala Ile Arg Arg His Pro Asp Val Asp Tyr Ile Glu Lys Asp Ser 115 120 125 Leu Val His Thr Met Glu Asp Pro Ala Leu Glu Lys Asn Ala Pro Trp 130 135 140 Gly Leu Ala Arg Ile Ser His Arg Glu Ser Leu Ser Phe Gly Ser Phe 145 150 155 160 Asn Lys Tyr Leu Tyr Ala Ala Asp Gly Gly Glu Gly Val Asp Val Tyr 165 170 175 Val Ile Asp Thr Gly Thr Asn Ile Asp His Val Asp Phe Glu Gly Arg 180 185 190 Ala Ser Trp Gly Lys Thr Ile Pro Thr Asp Asp Glu Asp Val Asp Gly 195 200 205 Asn Gly His Gly Thr His Cys Ser Gly Thr Ile Ala Gly Lys Lys Tyr 210 215 220 Gly Val Ala Lys Lys Ala Asn Val Tyr Ala Val Lys Val Leu Lys Ser 225 230 235 240 Asn Gly Ser Gly Thr Met Ser Asp Val Val Gln Gly Val Glu Trp Ala 245 250 255 Ala Thr Gln His Ile Lys Lys Val Lys Asp Ala Lys Ala Gly Lys Ala 260 265 270 Lys Gly Phe Lys Gly Ser Ala Ala Asn Met Ser Leu Gly Gly Gly Lys 275 280 285 Ser Val Thr Leu Asp Lys Ala Val Asn Ala Ala Val Asp Ala Gly Ile 290 295 300 His Phe Ala Val Ala Ala Gly Asn Asp Asn Ala Asp Ser Cys Asn Tyr 305 310 315 320 Ser Pro Ala Ala Ala Glu Lys Ala Val Thr Val Gly Ala Ser Thr Leu 325 330 335 Ala Asp Glu Arg Ala Tyr Phe Ser Asn Tyr Gly Lys Cys Asn Asp Ile 340 345 350 Phe Ala Pro Gly Leu Asn Ile Leu Ser Thr Trp Ile Gly Ser Lys Tyr 355 360 365 Ala Val Asn Thr Ile Ser Gly Thr Ser Met Ala Ser Pro His Ile Ala 370 375 380 Gly Leu Leu Ala Tyr Phe Leu Ser Leu Gln Pro Ala Ser Asp Ser Ala 385 390 395 400 Phe Ala Val Ala Glu Ile Thr Pro Lys Lys Leu Lys Glu Asn Leu Ile 405 410 415 Ala Ile Gly Thr Gln Gly Ala Leu Thr Asp Val Pro Ser Asp Thr Thr 420 425 430 Asn Ile Leu Ala Trp Asn Gly Gly Gly Ser Ala Asn Tyr Thr Asp Ile 435 440 445 Ile Ala Gln Gly Gly Tyr Lys Thr Lys Thr Leu Ser Asn Glu Val Asp 450 455 460 Glu Leu Ile Asn Lys Leu Glu Val Val Asn Glu Glu Leu Gly Ala Ile 465 470 475 480 Tyr Ser His Ile Lys Asp Ala Ile Ala Ala 485 490 <210> 74 <211> 4509 <212> DNA <213> Talaromyces cellulolyticus <400> 74 atgtcgagaa gaatacggaa ccctgattcc gcaggctcga gtcaaaccct aagtaattca 60 ccggtaccaa tagccgccga atccggcacg gaacctgtgt acctaggtcc gtatcgaata 120 gcgaagtttt ccgtctattc ttcgaatttt gtatacatgc ttaccttggc tcaaaggtac 180 tcacaaagtc cgaagaataa attatagaac cgatgtgaaa cggggacagt ttggcaaccc 240 cttgtactat gtacattgta tggatctcgt ctcgactctc gagacgaggg tttcgtacca 300 accaaagact caaaacttgg ggtactaag cgatcggctg cgtagtactc catactccat 360 aaataccccg gtgaattcgc ctcttgccca tggaatgagc gagaatttac ccttggagtc 420 atcgcggtaa atgactcaca tatcatgtct gccttcactc tcctcaacct ttgaaattcc 480 ggttaatgtt aaggcgaggt gtcctctacg gaatggcttt gtagatttga gataagacta 540 cgccgtaact taagggatcc acatactcca tattgatagt ctcaggaccg agatagtctg 600 gagtaacccc gtacccaatc aacgtccctca gactcgccac ctggttacaa tatttcggtg 660 cttgtgccga tatacctccg ttgcgtgagc cttgatagcc aacaagaat gattcaaat 720 taagatttga gaaaatccgg agtacgcagt gcctgcagtg taaaaaataa tgtatttacc 780 taatgccaat atgtcgatgc caactacta ctagchaaga cactagatat gcagcaact 840 cgatgtttag gtacatgtaa ccatatcctg gggtcaggta cgaacgccat cattaatct 900 cgtaaactag ctgtcacacg acagtatcat ttgatagttc caatgttcca tgctccccct 960 caaatgtcac tggatgatac gatttggct gtgacttgaa cagatagacg gaaacagtc 1020 cgatcattat ccggagtacg catgtacgag atagtctggg gatcctcggc tgccccgatt 1080 ggggttagtg cgggttctcct tatcttgata cgccgtctgg aggcgcaggt gattgttacg 1140 gtgtgttccg tgatagataa gttagacatc cgataataac ctactctcta gatagacggc 1200 aggtacgtat gtagatagat agatgacaca gtcataagac agttttatt accatacata 1260 gtatagtcat ttgacaaca cttgatgact atgagcagta agtccagaca agagcataga 1320 ctagaaatga tgtgatcatc aataggtacg gagtcgtacc accccccggat tatcttggct 1380 ggcttagtca cgcccaaaca gacggtgacg gatgagacac aagcaaagag cgacattccg 1440 aagaattctc gtgacggaaa cgagaatgcc gccggcgctg ataggggaa attttatctt 1500 ttccctttct gacattcagt gtttacaata caatacggaa ttacggaacc ccggttttcg 1560 caaccggtgg aattacctaa tgggtgacct gaatttatta gataacgatg aacaatttgt 1620 tggatcttcc gtagatcgat ttggacttga taggtgcttc caaggttgtt gctgctcaca 1680 tggtcgcttg cgttatctgc ctacagaatg aggaagatgt attccgcacg tactccggtc 1740 gcgacagata tgcgacgatt gcaatatgta ctacatagtt agtacataca actctagact 1800 agactctata ttatgtagag tgtaagagaa aaagaaagaa gataacggca gggtctattt 1860 gattgcgcta taatatgcgc cgctgtatgg ttccccagat ctgcgtgaga tatcacctca 1920 tcctatcatc attccaggtc aaagtctcgt catcatgaat tggtattat acccagtacg 1980 taaccacgt atcgaggcgt atcggtgtat taaagataga gctactgcat tggctctagt 2040 cctatctttg ccccggatc cggcccgtgg atgacgatat gatgctgttt gtccttcagc 2100. taacacgga cgatctctta cagggtgcgg ttaattatta aggatataat tctaatcaac gactctggct gtgctatatt aacaatgtct tctaagtggt catgatgtgt acgtacttcg tacacatgct acatgcaatc gagtacgtaa ctccagatct gcgccgtacc cgcgataccc gggccatcat gcaaatgtaa ccgcttggaa cacgcactgc agtgcataaa agccacagcc tcgcttccca atccggttta gacgcgtttt gtcttgctgt tttgggagca gccagacccc acattccact aacccactct ttttcagcgc ttattctcgt aagattcgta cgaaaaatac 2460 atctgcccac actatccacc agctcggcca ctcttcggtg agaacgctgc catgagaaaa aaatctgcga ctctgcaaca gagtgaggca cggctgaacc gagctgattg tcaccctttg cccaatgccc agacagccca gacagcccag acagcccaga cagcccagac agcccagaca 2640 gcccagacag ccagtgcttg gttaattttt actaagggta aaaacctaaa aaaaagaaac gaaaaaaaaa aaaaaaaact tttcttttttt gccccccaat cacttggccg acagtcaaag ggttccccca cacggtactc cgtacttgct acgtacacta actaaaa aaatctcctg 2820 attgagtctg tgtctgtctg tcgctgctaa actcggataa ccccccgttc ccgatcaccc 2880 gtcgaaaaga gcagcagcca tttaacattt ttcccctcca ttcctcttc ttggaacttt 2940 ccctccctcc ctcatcctta catctccctg cgtgcgcgcc tgcctgccta cttacactgc 3000 cactccccag attttctttc tcttgtttct tctccagact ttctttcctc ctccacctcg 3060 cctcaccaca ccaccaccac cactcaccac gccaacaaca ccgcactacc actactgctt 3120 caaagatcga tcaggccatt atcaaggagg atcgacgtct tattccatcg accaccctgt 3180 tgatcacctc ggctggagcg ctcgactccc tggcttcctt ccccagctta tttaaacccg 3240 tcacccgcca ggtctcttca catgtcaccg tcatcttcgt cagtgggttt ttccaatctg 3300 ctgaacccac agtcagactc tgtcgagcct acggataaca catcttcacc tgctaccacc 3360 actaccaccg gcacagactc caactcagac aaggaaatgg cgtcctctctgt cagtctgctc 3420 ccaccactca tgaagggtgc ccgccccgcc gcggaggaag tgcgacagga cctccctcgt 3480 ccatacaagt gtcctctttg cgatcgtgct ttccatcgtc tagagcacca aactcgtcac 3540 attcgtactc acaccggcga gaaaccccat gcctgccagt ttccaggctg cacgaaacgg 3600 ttcagtcgtt cagatgaatt gactcgtcac tcgcgcattc acaacaaccc caactcgaga 3660 agaagtaaca aagctcagca tattgctgcg gctgcggcgg ccggtcagga ttcgggtatg 3720 cttaacgctg ctgcctcgat gatgcctcct ccaagcaaac ccattactcg ctcggctcca 3780 gtgtctcagg tcggatctcc ggatgtgtct cctccgcact cttacaccaa ctacacctcg 3840 catttgcggg cgggtctggg tccttattca cgcaacagcg accgtgcttc atctggtatg 3900 gatattaatt tgctcgcgac tgctgcttca caagtcgagc gcgatcacta cggaggctcg 3960 tctcgtcatt accctttcag ctctcgatac tcgggtactc ctggacgtct accgtcgctt 4020 tccgcctatg ccatttctca gagcatgagc cggtcgcatt ctcacgagga tgaggacaac 4080 tacggacatc accgggttaa gcgctctcgt cctaactcac caaactcgac tgcgccatcc 4140 tcgcctacat tctctcacga ttcattgtcg cctacccccg atcacactcc tcttgcaacc 4200 ccagcacact cgcctcgttt gcgtccttat ggagccgcag atttgcaatt accttccatc 4260 cgtcatttgt cgttacacca cactcccgca ctcgcaccaa tggagcctca agccgaggga 4320 cctaatgttt acaaccccgg tcagcaccac ggtggaccca gcatcacgga catcatgagc 4380 aggcccgacg gcacccagcg taagcttcct gttccgcaag tacccaaaat cccggtgcag 4440 gacatgttgg caccgaacgg atattcctcc aacactccgt ccgtcaacgg ttccgtgatg 4500 gagttataa 4509
Claims
1. A method for manufacturing a target protein, comprising: Talamoyces cellulolyticus, capable of producing target proteins, was cultured in a culture medium. Compared to the unmodified strain, *Talaromyces cellulolyticus* was modified in a manner that reduces the activity of the Pep4 protein. The Pep4 protein is the protein described in (a) below: (a) A protein consisting of the amino acid sequence represented by SEQ ID NO.
71.
2. The method according to claim 1, wherein, The activity of the Pep4 protein is reduced by decreasing the expression of the pep4 gene or by disrupting the pep4 gene.
3. The method according to claim 1, wherein, The activity of the Pep4 protein is reduced by the deletion of the pep4 gene.
4. The method according to claim 1, wherein, Compared to the unmodified strain, the *Talaromyces cellulolyticus* strain is also modified in a manner that reduces the activity of the YscB protein and / or the CreA protein.
5. The method according to claim 4, wherein, The activity of the YscB protein and / or the CreA protein is reduced by decreasing the expression of the yscB gene and / or the creA gene or by disrupting the yscB gene and / or the creA gene.
6. The method according to claim 4, wherein, The activity of the YscB protein and / or the CreA protein is reduced by the deletion of the yscB gene and / or the creA gene.
7. The method according to claim 4, wherein, The YscB protein is the protein described in (a) below: (a) A protein consisting of the amino acid sequence represented by SEQ ID NO.
73.
8. The method according to claim 4, wherein, The CreA protein is the protein described in (a) below: (a) A protein consisting of an amino acid sequence encoded by the base sequence represented by SEQ ID NO.
74.
9. The method according to any one of claims 1 to 8, wherein, The Talamomyces cellulolyticus strain is a modified strain derived from Talamomyces cellulolyticus S6-25 (NITE BP-01685).
10. The method according to any one of claims 1 to 8, further comprising recovering the target protein.
11. The method according to any one of claims 1 to 8, wherein, Through the culture, the target protein accumulates in the culture medium.
12. The method according to any one of claims 1 to 8, wherein, The target protein is expressed as a fusion protein with a signal peptide that functions in Talamomyces cellulolyticus.
13. The method according to any one of claims 1 to 8, wherein, The target protein is a heterologous protein.
14. The method according to any one of claims 1 to 8, wherein, The target protein is a human-derived protein.
15. The method according to any one of claims 1 to 8, wherein, The target protein is an antibody-associated molecule.
16. The method according to claim 15, wherein, The antibody-related molecules are complete antibodies, Fab, F(ab'), F(ab')2, Fc, dimers containing heavy and light chains, Fc fusion proteins, heavy chains, light chains, single-chain Fv, sc(Fv)2, disulfide Fv, double-chain antibodies, or VHH fragments.
17. The method according to any one of claims 1 to 8, wherein, The *Talaromyces cellulolyticus* has a gene construct for expressing the target protein. The gene construct contains a promoter sequence and a base sequence encoding a target protein in the 5' to 3' direction.
Citation Information
Patent Citations
High frequency induction heat treatment
JP1989000685A
Method for hydrolyzing cellulose raw material
JP2003135052A
Method for producing cellulase
JP2008271826A
Method for producing high hydrolysis activity cellulase and hemicellulase
JP2008271927A
Method for searching alteration candidate gene
JP2011193773A