Recombinant expression plasmids, recombinant cells, and construction methods for extracellular expression of human Ly6d protein

Abstract

This invention belongs to the field of human Ly6d protein secretion expression technology, and particularly relates to a recombinant expression plasmid, recombinant cells, and construction method for extracellular expression of human Ly6d protein. The recombinant expression plasmid includes a basic plasmid pcDNA3.1 and a target sequence for expressing recombinant human Ly6d protein inserted at the restriction enzyme sites of the basic plasmid. When this recombinant expression plasmid is transformed into EXPI293F cells to construct recombinant cells, it can highly express human Ly6d extracellularly, reaching an expression level of 255.67 mg / 1000 mLCells, which is highly beneficial for the purification and collection of this recombinant protein, providing assistance for subsequent research and production.

Description

[0001] This application is a divisional application of Chinese invention patent application filed on December 28, 2021: A method and application for the secretory expression of human Ly6d recombinant protein in cells (application number CN202111629570.3). Technical Field

[0002] This invention belongs to the field of human Ly6d protein secretion expression technology, and particularly relates to a method and application of human Ly6d recombinant protein cell secretion expression. Background Technology

[0003] Lymphocyte antigen-6 (LY6) complex is a group of allogeneic antigens first discovered in mouse lymphocytes 40 years ago. Its main members are LY6A / D / E / K / H, and the evolution of the LY6 family members is highly conserved. It has been reported that members of the LY6 family play an important role in cancer; LY6K can induce breast cancer cell metastasis, and clinical analysis shows that LY6K is associated with tumor differentiation, lymph node metastasis, and TNM staging in non-small cell lung cancer patients. LY6D, as one of the most important members of the LY6 family, is frequently used in the development of novel therapeutics for various cancer types.

[0004] The LY6D gene is increased in multiple types of cancer and is associated with cell adhesion. It has also been found to be a prognostic factor for advanced prostate cancer and is positively correlated with poor patient survival outcomes. This suggests that LY6D will be used as a biomarker for poor prognosis.

[0005] LY6D is not only crucial in cancer, but related studies have shown that it makes significant contributions to the phenotype and transcriptomic heterogeneity of B lymphocyte differentiation, playing a pivotal role in the proliferation and differentiation of B lymphocytes. However, research on the secretory expression of LY6D protein is currently scarce. The expression of membrane proteins is a challenge in in vitro expression techniques because problems such as non-expression or insoluble expressed proteins can occur. There are also difficulties in achieving intracellular secretion, or obtaining only very small amounts of protein, insufficient for subsequent experimental needs, and hindering the realization of its biological functions. Summary of the Invention

[0006] In view of the problems existing in the prior art, the present invention provides a method and application for the secretory expression of human Ly6d recombinant protein in cells, aiming to solve some of the problems in the prior art or at least alleviate some of the problems in the prior art.

[0007] In a first aspect, embodiments of the present invention disclose a recombinant expression plasmid for extracellular expression of human Ly6d protein in EXPI293F cells. The recombinant expression plasmid comprises a basal plasmid pcDNA3.1 and a target sequence for expressing human Ly6d recombinant protein inserted at an enzyme restriction site in the basal plasmid; the nucleotide sequence of the target sequence includes:

[0008] atggaaaccgacacactgctgctgtgggtgctgttgttgtgggtgccaggctctaccggcctgcgctgccacgtgtgcaccagctccagcaactgcaagcattctgtggtctgcccggccagctctcgcttctgcaagaccacgaac acagtggagcctctgagggggaatctggtgaagaaggactgtgcggagtcgtgcacacccagctacaccctgcaaggccaggtcagcagcggcaccagctccacccagtgctgccaggaggacctgtgcaatgagaagctgcacaac.

[0009] In some embodiments, the nucleotide sequence of the target sequence includes: atggaaaccgacacactgctgctgtgggtgctgttgttgtgggtgccaggctctaccggcctgcgctgccacgtgtgcaccagctccagcaactgcaagcattctgtggtctgcccggccagctctcgcttctgcaagaccacgaacacagtggagcctctgagggggaatctggtgaagaaggactgtgcggagtcgtgcacacccagctacaccctgcaaggccaggtcagcagcggcaccagctccacccagtgctgccaggaggacctgtgcaatgagaagctgcacaacgcaccaagcacctgtagcaagcccatgtgccccccccccgagctgcccggcggccccagcgtgttcatcttcccccccaagcccaaggacaccctgatgatcagccgcacccccgaggtgacctgcgtggtggtggacgtgagccaggacgaccccgaggtgcagttcacctggtacatcaacaacgagcaggtgcgcaccgcccgcccccccctgcgcgagcagcagttcaacagcaccatccgcgtggtgagcaccctgcccatcgcccaccaggactggctgcgcggcaaggagttcaagtgcaaggtgcacaacaaggccctgcccgcccccatcgagaagaccatcagcaaggcccgcggccagcccctggagcccaaggtgtacaccatgggccccccccgcgaggagctgagcagccgcagcgtgagcctgacctgcatgatcaacggcttctaccccagcgacatcagcgtggagtgggagaagaacggcaaggccgaggacaactacaagaccacccccaccgtgctggacagcgacggcagctacttcctgtacagcaagctgagcgtgcccaccagcgagtggcagcgcggcgacgtgttcacctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagagcatcagccgcagccccggcaa。

[0010] Secondly, embodiments of the present invention disclose a method for constructing the recombinant expression plasmid described in the first aspect, comprising:

[0011] Obtain the DNA with the target sequence;

[0012] The DNA was subjected to PCR amplification, and the amplification product was recovered.

[0013] The amplification product and the basic plasmid are simultaneously digested with enzymes and then homologously ligated to obtain the recombinant expression plasmid. The molar ratio of the amplification product to the basic plasmid in the ligation reaction is 3:1 to 10:1.

[0014] The PCR amplification reaction system, in 50 μL volumes, comprises: 25 μL Gloria High-Fidelity PCRMaster Mix with GC Buffer, 17 μL ddH2O, 1.5 μL LDMSO, 1.5 μL template, 2.5 μL upstream primer, and 2.5 μL downstream primer; the nucleotide sequence of the upstream primer includes ggttcccggtagcaccggtgctagcCTGCGCTGCCACGTGT, and the nucleotide sequence of the downstream primer includes...

[0015] gctacaggtgcttggtgcgctagcGTTTGTGCAGCTTCTCATTGCACAGG.

[0016] In some embodiments, the PCR amplification reaction includes the following steps: denaturation at 94°C for 4 min; denaturation and melting at 94°C for 40 s, annealing at 58°C for 30 s to achieve primer and template binding, extension at 72°C for 1 min; treatment at 72°C for 10 min; and cooling at 16°C; wherein the denaturation and melting at 94°C for 40 s, annealing at 58°C for 30 s to achieve primer and template binding, and extension at 72°C for 1 min constitute 35 cycles.

[0017] Thirdly, embodiments of the present invention disclose a recombinant cell for extracellular expression of human Ly6d protein, wherein the recombinant cell is obtained by transferring the recombinant expression plasmid of the first aspect or the recombinant expression plasmid constructed by the construction method described in the second aspect into the host EXPI293F cell.

[0018] In some embodiments, the recombinant cells express 255.67 mg / 1000 mL of recombinant human Ly6d protein extracellularly, the recombinant human Ly6d protein having a size of 34.3 kDa.

[0019] Compared with the prior art, the present invention has at least the following beneficial effects:

[0020] This invention uses pcDNA3.1 as a base plasmid and inserts a target sequence into its restriction enzyme sites. The target sequence includes the nucleotide sequence of the signal peptide, the target gene sequence, and the tag sequence. By transforming this recombinant expression plasmid into recombinant cells constructed from EXPI293F cells, human Ly6d can be highly expressed extracellularly at an expression level of 255.67 mg / 1000 mL Cells. This greatly facilitates the purification and collection of the recombinant protein, providing assistance for its subsequent research and production. Attached Figure Description

[0021] Figure 1 This is a diagram showing the amplification effect of the target fragment of the expression plasmid;

[0022] Figure 2 This is the result of Western blot analysis of the recombinant expression plasmid;

[0023] Figure 3 This is a diagram showing the protein purification effect of recombinant cells that have been transferred into recombinant expression plasmids. Detailed Implementation

[0024] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified, the equipment and reagents used in the embodiments and experimental examples are commercially available. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0025] Based on the information contained in this application, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims. It should be understood that the scope of the invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to embodiments of the invention that will be apparent to those skilled in the art or related fields are covered within the scope of the appended claims.

[0026] To better understand the invention and not to limit its scope, all figures indicating amounts, percentages, and other numerical values ​​used in this application should, in all cases, be understood to be modified by the word "about". Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods. In this invention, "about" means within 10%, preferably within 5%, of a given value or range.

[0027] Unless otherwise specified, the following embodiments of the present invention are all under normal temperature conditions. Normal temperature refers to the natural room temperature conditions in all four seasons, without additional cooling or heating treatment. Generally, the normal temperature is controlled between 10 and 30°C, preferably between 15 and 25°C.

[0028] The genes, proteins, or fragments thereof involved in this invention may be naturally purified products, chemically synthesized products, or produced from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, plants) using recombinant technology.

[0029] This invention discloses a method for cellular secretory expression of human Ly6d recombinant protein and its application. The technical solution of this invention will be clearly and completely described below with reference to embodiments thereof.

[0030] Example 1 Plasmid Construction

[0031] 1. Target gene

[0032] The target gene sequence provided in this application is as follows, as shown in SEQ ID NO.1:

[0033] atggaaaccgacacactgctgctgtgggtgctgttgttgtgggtgccaggctctaccggc ctgcgctgccacgtgtgcaccagctccagcaactgcaagcattctgtggtctgcccggccagctctcgcttctgcaagaccacgaacacagtggagcctctgagggggaatctggtgaagaag gactgtgcggagtcgtgcacacccagctacaccctgcaaggccaggtcagcagcggcaccagctccacccagtgctgccaggaggacctgtgcaatgagaagctgcacaac; where the underline is the signal peptide.

[0034] Alternatively, the target gene sequence provided in this application is as follows, as shown in SEQ ID NO.2:

[0035] atggaaaccgacacactgctgctgtgggtgctgttgttgtgggtgccaggctctaccggc ctgcgctgccacgtgtgcaccagctccagcaactgcaagcattctgtggtctgcccggccagctctcgcttctgcaagaccacgaacacagtggagcctctgagggggaatctggtg aagaaggactgtgcggagtcgtgcacacccagctacaccctgcaaggccaggtcagcagcggcaccagctccacccagtgctgccaggaggacctgtgcaatgagaagctgcacaacgc accaagcacctgtagcaagcccatgtgccccccccccgagctgcccggcggccccagcgtgttcatcttccccccc aagcccaaggacaccctgatgatcagccgcacccccgaggtgacctgcgtggtggtggacgtgagccaggacgacc ccgaggtgcagttcacctggtacatcaacaacgagcaggtgcgcaccgcccgcccccccctgcgcgagcagcagtt caacagcaccatccgcgtggtgagcaccctgcccatcgcccaccaggactggctgcgcggcaaggagttcaagtgc aaggtgcacaacaaggccctgcccgcccccatcgagaagaccatcagcaaggcccgcggccagcccctggagccca aggtgtacaccatgggccccccccgcgaggagctgagcagccgcagcgtgagcctgacctgcatgatcaacggctt ctaccccagcgacatcagcgtggagtgggagaagaacggcaaggccgaggacaactacaagaccacccccaccgtg ctggacagcgacggcagctacttcctgtacagcaagctgagcgtgcccaccagcgagtggcagcgcggcgacgtgt tcacctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagagcatcagccgcagccccggcaa; The first underlined part represents the signal peptide, and the second underlined part represents the tag.

[0036] 2. Gene Cloning and Construction

[0037] (1) Primers

[0038] Primers were designed using Primer5 to amplify the target sequence. The nucleotide sequence of the upstream primer included ggttcccggtagcaccggtgctagcCTGCGCTGCCACGTGT (as shown in SEQ ID NO.3), and the nucleotide sequence of the downstream primer included gctacaggtgcttggtgcgctagcGTTGTGCAGCTTCTCATTGCACAGG (as shown in SEQ ID NO.4).

[0039] (2) Amplification of the target fragment

[0040] 1) PCR system (50 μL) (RK20705: Wuhan Aiboteke Biotechnology Co., Ltd.):

[0041] Gloria High-Fidelity PCR Master Mix with GC Buffer 25μL ddH2O 17μL DMSO 1.5μL Template 1.5μL Forward / Reverse Primer 2.5 + 2.5μL

[0042] PCR amplification reaction procedure:

[0043]

[0044] PCR electrophoresis results are shown below Figure 1 As shown. PCR product recovery was performed according to the Kangwei Century Agarose Gel DNA Recovery Kit.

[0045] (3) Homologous recombination and transformation

[0046] 1) Homologous recombination (Catalog No.: RM20523, Wuhan Aibote Biotechnology Co., Ltd.)

[0047]

[0048] The insertion site of the tag in the vector is NheI, which can be prepared by conventional existing technology or by commissioning a third-party company.

[0049] Vector digestion in 50 μL volume: (Restriction sites: EcoRI / XhoI)

[0050] Target fragment 20μL

[0051] ddH2O 20μL

[0052] Buffer 5μL

[0053] EcoRI 2.5μL

[0054] XhoI 2.5μL

[0055] The reaction conditions were 37℃ for 3 hours.

[0056] Note: The ratio of target fragment to carrier is determined based on the concentration after recovery, with a molar ratio range of 3:1 to 10:1.

[0057] 2) Transformed competent cells

[0058] a. Take a pre-chilled 1.5ml EP tube and place it on an ice box. Dispense 100μL-120μL of LDH5α competent cells into each tube (the competent cells should be taken from a -80℃ freezer and thawed in ice). Add 10μL of recombinant product (pre-chilling is better) and gently stir with a suction pipette. After adding, place on ice for 30 minutes. (This process is performed in a clean bench.)

[0059] b. 42℃ hot water bath for 90 seconds (time strictly controlled)

[0060] c. 5 minutes on ice

[0061] d. Add 800 μL of antibiotic-free LB / SOB medium (this process is performed in a clean bench).

[0062] e. Resuscitate at 37℃, 220 rpm in a shaker for 45 minutes (time strictly controlled).

[0063] Centrifuge at 5000 rpm for 3 minutes to collect bacteria.

[0064] g. Discard the supernatant, leaving approximately 200 μL of bacterial culture. Mix thoroughly with a pipette and add to a plate containing the appropriate antibiotic. Add 4-6 glass beads, gently shake the plate to spread the bacterial culture evenly, discard the glass beads, and invert the plate to incubate overnight at 37°C. (This process is performed in a clean bench).

[0065] (4) Identification by bacterial culture PCR

[0066] 1) Colony PCR identification: 20 μL system (RK20604, Wuhan Aiboteke Biotechnology Co., Ltd.)

[0067]

[0068] The universal sequencing primers for the first and last digits in the table include: F: GACCTCCATAGAAGACACCG (as shown in SEQ ID NO.5), R: aaaggagcaacatagttaag (as shown in SEQ ID NO.6).

[0069] PCR amplification reaction program: 95℃ / 5min, (95℃ / 30S, 58℃ / 30S, 68℃ / 1min) 35 cycles, 68℃ / 5min→4℃∞.

[0070] (5) Sequencing

[0071] Correct positive clones were selected and sequenced using universal vector primers for verification. Recombinant expression plasmids with correct sequencing results were then used for subsequent protein expression.

[0072] Example 2 Protein Expression

[0073] Eukaryotic HEK293F cells can be transfected transiently or stably. In transient transfection, the plasmid DNA enters the cell and is not integrated into the chromosome, expressing the foreign gene in a free state. Transient transfection has a short cycle, enabling rapid acquisition of the target protein, and can be used for exploratory research and large-scale high-throughput protein screening. EXPI293F (human kidney embryonic epithelial cells), as a high-density expression system in mammalian cells, is widely used in the research, development, and large-scale production of biopharmaceuticals expressing recombinant DNA proteins.

[0074] I. Instantaneous transfection

[0075] Recombinant expression plasmids were extracted from the positive clone bacterial culture provided in the above examples to obtain a suspension with a concentration of 1510 ng / μL, and cell transfection was performed according to the following steps:

[0076] (1) Cells were isolated at 1.3E6 cells / ml one day before transfection in the culture medium, with a cell volume of 27mL;

[0077] (2) Before transfection, place all reagents at room temperature;

[0078] (3) Before transfection, adjust the cell density to 2.6E6 / mL;

[0079] (4) Dilute the total plasmid DNA (ug) to 30ug in a sterile test tube with 1.5mL Opti-MEM;

[0080] (5) Add 90 μL of PEI (1 mg / ml, pH 7.1) to 1.5 mL of diluted Opti-MEM, mix well and let stand for 5 min;

[0081] (6) Add the PEI mixture to the DNA mixture and mix by inverting or pipetting (the mixing process should be carried out slowly);

[0082] (7) Incubate at room temperature for 20 minutes (do not exceed this time);

[0083] (8) Add the DNA / PEI mixture to the cells and mix them thoroughly by gently rotating. The total volume of the cells after mixing is 30 ml.

[0084] (9) 16-20 hours after transfection, 1.5 mL of feed was added for the first time, and the viability and density were measured 96 hours later;

[0085] (10) Harvest the transfected cells, collect the supernatant and add 10mM AEBSF for affinity purification.

[0086] II. WB Validation of Expression

[0087] 1. Sample preparation:

[0088] (1) Take 100 μL of HEK293F transfected cells and centrifuge at 3000 r / min for 10 min;

[0089] (2) After centrifugation, take 20 μL of the supernatant and add 20 μL of 2*loading buffer to prepare the sample. Heat at 97℃ for 10 min and name it supernatant.

[0090] (3) After resuspending the precipitate in 100 μL PBS, add 20 μL of 2*loading buffer to prepare the sample, heat at 97℃ for 10 min, and name it as cell.

[0091] 2. WB detection

[0092] (1) Take 5 μL of sample for SDS-PAGE electrophoresis: Select an appropriate separating gel concentration according to the molecular weight of the target protein. Electrophoresis is performed in constant voltage mode, with a 5% stacking gel at 80V. When the marker starts to separate for about 25 minutes, adjust to 120V and stop electrophoresis when bromophenol blue reaches the bottom of the separating gel;

[0093] (2) Transfer: Assembly sequence: Transfer clamp black side (negative electrode) - sponge pad - 3 layers of filter paper - adhesive - membrane - 3 layers of filter paper - sponge pad - red side (positive electrode). Transfer time: 200mA, 90-180min;

[0094] (3) Blocking: After the transfer is completed, mark and wash off the transfer solution (TBST, 5 min x 2 times); place the cleaned membrane in a container containing 3% skim milk (prepared with TBST) and block at room temperature for 60-90 min;

[0095] (4) 6His-tag primary antibody incubation: After blocking, discard the blocking solution. Add the primary antibody solution diluted 1:7000 with 3% skim milk (prepared with TBST), gently shake on a shaker, and incubate at room temperature for 2 hours or overnight at 4°C (after incubation at 4°C, incubate at room temperature for another 15-30 minutes). After primary antibody incubation, discard the primary antibody solution; rinse the membrane 4 times with TBST, 5 minutes each time;

[0096] (5) Secondary antibody incubation: Before the primary antibody incubation is complete, dilute the enzyme-labeled secondary antibody of the corresponding primary antibody species 1:5000 to the required amount for the experiment (TBST dilution). Place the cleaned membrane into a container containing the secondary antibody solution, shake slowly on a shaker, and incubate at room temperature for 60-80 minutes. After the secondary antibody incubation is complete, discard the secondary antibody solution; rinse the membrane 4 times with TBST, 5 minutes each time;

[0097] (6) Exposure: Remove the membrane from the TBST with tweezers, allow it to dry slightly, and place it on a gel tray. Mix equal volumes of ECL Solution I and Solution II, and add the mixture evenly to the membrane to completely cover it. Allow the substrate to react with the membrane for approximately 30 seconds, then place it in a chemiluminescence imaging system. The exposure times were set to 3 seconds, 10 seconds, 30 seconds, 60 seconds, and 120 seconds.

[0098] The purposes of Western blot (WB) detection include: verifying the accuracy of protein expression levels; comparing with high-expression samples to obtain information on high / low protein expression levels; and for items without bands in WB, using strong exposure, if a band appears, it is determined to be low expression, and if no band appears, it is determined to be no expression.

[0099] The WB verification results are as follows: Figure 2 The protein introduced by the recombinant expression plasmid was expressed both inside and outside the cell.

[0100] III. Purification of Cell Supernatant

[0101] The cell supernatant from which the recombinant expression plasmid was verified to be secreted by Western blotting was purified using the following steps.

[0102] 1. Experimental Materials

[0103] Purification column Polv-Prep@Chromatography Columns: BIO-RAD731-1550; AT Protein ADiamond (Shanghai Bogelon).

[0104] 2. Operating Procedures

[0105] (1) Incubation

[0106] Remove the sterilized 10ml purification column and rinse it 1-2 times with endotoxin-free water. Take the Protein A matrix from the 4°C freezer and pipette 0.5ml of matrix into the purification column. After the ethanol has drained (commercial matrix is ​​stored with 20% ethanol), wash with endotoxin-free water for 6 column volumes. Column volume refers to the volume of matrix in the purification column, not the volume of the column itself. Equilibrate the packing material to 6 column volumes with Binding Buffer. Add the equilibrated matrix to the supernatant tube, seal with sealing film, and place on a rotary incubator at 20 rpm, 4°C, for 4 hours to overnight.

[0107] (2) Flowing through

[0108] After incubation, balance the centrifuge tubes and centrifuge at 600 rpm for 10 min at 4°C.

[0109] Pour the supernatant from centrifugation into a new centrifuge tube; this is flow-through. Simultaneously, reserve approximately 5 ml of supernatant for suspending the matrix. Transfer the matrix to a purification column tube and allow the flow-through to complete (this flow-through does not need to be collected).

[0110] (3) Washing and elution

[0111] a. Add 3 ml of Washing Buffer to the purification column to wash away impurities and proteins in the matrix. Use gravity flow, collecting the eluent in a sterile 5 ml EP tube, which should be kept on ice to maintain a low temperature. After eluent flow, use a G250 analyzer (add 100 μL of G250 to a 96-well plate and add 10 μL of the eluent currently being dispensed). If the G250 turns blue, continue adding 3 ml of Washing Buffer until the G250 no longer turns blue, ending the pre-elution with Washing Buffer.

[0112] b. Add 0.5 ml of Elution Buffer 1 to wash the column, eluting the proteins bound to the matrix. Use gravity flow, collecting the eluent in a 1.5 ml endotoxin-free EP tube. Keep the tube on an ice pack to maintain a low temperature, and pre-add 0.5 ml of 1 M Tris (pH 8.0) to adjust the pH of the protein solution. After eluent flow, use a G250 analyzer (add 100 μL of G250 to a 96-well plate and 10 μL of the eluent currently being dispensed). If the G250 turns blue, continue eluting until the G250 no longer turns blue, ending the Elution Buffer 1 pre-elution.

[0113] c. Add 0.5 ml of Elution Buffer 2 to wash the column, eluting the proteins bound to the matrix. Use gravity flow, collecting the eluent in a 1.5 ml endotoxin-free EP tube. Keep the tube on an ice box to maintain a low temperature, and pre-add 0.5 ml of 1 M Tris (pH 8.0) to adjust the pH of the protein solution. After eluent flow, use a G250 analyzer (add 100 μL of G250 to a 96-well plate and 10 μL of the eluent currently being dispensed). If the G250 turns blue, continue eluting until the G250 no longer turns blue, then stop the Elution Buffer elution.

[0114] d. Add 0.5 ml of Elution Buffer 3 to wash the column, eluting the proteins bound to the matrix. Use gravity flow, collecting the eluent in a 1.5 ml endotoxin-free EP tube. Keep the collection tube on an ice box to maintain a low temperature, and pre-add 0.5 ml of 1 M Tris (pH 8.0) to adjust the pH of the protein solution. After eluent flow, use a G250 analyzer (add 100 μL of G250 to a 96-well plate and 10 μL of the eluent currently being dispensed). If the G250 turns blue, continue eluting until the G250 no longer turns blue, then stop the Elution Buffer elution.

[0115] e. Prepare a sample using the collected flow-through and elution buffer, typically using a 2* loading method (20 μL protein + 20 μL 2* loading), and perform SDS-PAGE electrophoresis.

[0116] (4) Buffer for Fc-Tag tag purification

[0117] Buffer Name Composition Binding Buffer PBS, pH7.4 Washing Buffer PBS, pH7.4 Elution Buffer 1 0.1M glycine, 150mM NaCl, pH 4.0 Elution Buffer 2 0.1M glycine, 150mM NaCl, pH 3.0 Elution Buffer 3 0.1M glycine, 150mM NaCl, pH 2.2

[0118] The results are as follows Figure 3 The target protein with a molecular weight of 34.4 KD was isolated and purified from the extracellular expression product of the recombinant cells after the recombinant expression plasmid was transformed into EXPI293F cells. After Western blot verification and affinity purification, it was successfully identified as Ly6d recombinant protein with high purity and an expression level of approximately 255.67 mg / 1000 mL Cells, which will help with its subsequent production work.

[0119] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for constructing a recombinant expression plasmid for extracellular expression of human Ly6d protein in EXPI293F cells, the recombinant expression plasmid comprising a base plasmid pcDNA3.1 and a sequence for expressing human Ly6d recombinant protein inserted at a restriction site of the base plasmid. The target sequence is shown as SEQ ID NO. 2, and the construction method comprises the following steps: obtaining the DNA of the target sequence; performing PCR amplification on the DNA and recovering the amplification product; performing enzyme cutting reaction on the amplification product and the basic plasmid simultaneously and then homologous connection to obtain the recombinant expression plasmid, and the molar ratio of the amplification product to the basic plasmid in the connection reaction is 3:1-10:1; The PCR amplification reaction system in 50 μL includes: 25 μL Gloria High-Fidelity PCR Master Mix with GC Buffer, 17 μL ddH2O, 1.5 μL DMSO, 1.5 μL template, 2.5 μL upstream primer and 2.5 μL downstream primer.

2. The construction method of claim 1, wherein, The steps of the PCR amplification reaction include: 94℃ denaturation for 4 min; 94℃ denaturation for 40 s, 58℃ annealing for 30 s to realize the combination of the primer and the template, and 72℃ extension for 1 min; 72℃ treatment for 10 min; and 16℃ cooling treatment; wherein, 94℃ denaturation for 40 s, 58℃ annealing for 30 s to realize the combination of the primer and the template and 72℃ extension for 1 min constitute 35 cycles of treatment.

3. A recombinant cell for extracellular expression of human Ly6d protein, wherein the recombinant cell is obtained by transforming the host EXPI293F cell with the recombinant expression plasmid constructed by the construction method of claim 1 or 2.

4. The recombinant cell of claim 3, wherein the recombinant cell extracellularly expresses 255.67 mg / 1000 mL Cells of recombinant human Ly6d protein, and the recombinant human Ly6d protein has a size of 34.3 kD.

Images