Endoglucanase mutant TrepCel4-Aa and its application

By screening and optimizing the endoglucanase TrepCel4-Aa from the metagenomic genome of buffalo rumen microorganisms, the problem of insufficient hydrolysis capacity in existing technologies has been solved, achieving efficient cellulose hydrolysis and feed conversion.

CN115927259BActive Publication Date: 2026-07-03NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NANJING AGRICULTURAL UNIVERSITY
Filing Date
2022-08-18
Publication Date
2026-07-03

AI Technical Summary

Technical Problem

Existing endoglucanases have insufficient hydrolytic capacity during cellulose hydrolysis, making it difficult to effectively improve the utilization efficiency of cellulase and affecting the economic benefits of the biorefining industry.

Method used

The endoglucanase TrepCel4 was screened from the metagenomic genome of buffalo rumen microorganisms, and the mutant TrepCel4-Aa was obtained through codon optimization and site-directed mutagenesis. Its substrate binding pocket was optimized to improve the enzyme's stability and hydrolytic ability.

Benefits of technology

The mutant TrepCel4-Aa was successfully expressed and purified in Escherichia coli, showing high cellulose hydrolysis capacity, and is suitable for the preparation of enzyme preparations and animal feed additives, improving the digestibility of feed fiber and animal production performance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115927259B_ABST
    Figure CN115927259B_ABST
Patent Text Reader

Abstract

This invention discloses an endoglucanase mutant, TrepCel4-Aa, and its applications. The amino acid sequence of the TrepCel4-Aa mutant is shown in SEQ ID No. 4. It is obtained by mutating histidine at position 201 to tryptophan and glutamic acid at position 252 to tyrosine from the endoglucanase with the amino acid sequence SEQ ID No. 1. The nucleotide sequence of the gene encoding this mutant is shown in SEQ ID No. 5. The TrepCel4-Aa mutant contains only one module region of glycoside hydrolase family 5 and has been successfully expressed in *E. coli*. The purified enzyme solution exhibits good activity and excellent hydrolytic ability against natural lignocellulose. This not only enriches the strain sources of endoglucanase but also has theoretical guiding significance for improving the digestibility of feed fiber and enhancing animal production performance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bioengineering, specifically relating to the endoglucanase mutant TrepCel4-Aa and its applications. Background Technology

[0002] Lignocellulosic biomass is the most abundant, inexpensive, and recyclable raw material on Earth for industrial biorefining. It can be converted into paper products, textiles, and bioethanol through industrial biorefining. Currently, over 200 chemicals and polymers are extracted from lignocellulosic biomass through biorefining. Furthermore, crop straw is an important source of lignocellulosic acid, primarily composed of cellulose, hemicellulose, and lignin. The synergistic action of endoglucanases, exoglucanases, and β-glucosidases can efficiently hydrolyze cellulose. Endoglucanases have a higher capacity for hydrolyzing cellulose because they can randomly break the β-1,4-glycosidic bonds of the cellulose backbone from the inside. Endoglucanases are now widely used in industrial biorefining and as animal feed additives.

[0003] With the widespread use of metagenomic screening methods, various endoglucanases have been obtained from the rumen of herbivores such as moose, sheep, buffalo, dairy cows, and camels. However, most candidate cellulases have not been cloned and characterized. Cellulases with high hydrolytic capacity are essential for the biorefining industry, thereby reducing the amount of cellulase used and improving economic efficiency. Endoglucanases are anchored to their substrates through substrate-binding pockets and are further catalyzed by active catalytic sites. Therefore, the stability of the substrate-binding pocket determines the final catalytic efficiency of the hydrolytic enzyme. Thus, mining endoglucanases from the metagenomic genome of rumen microorganisms can provide new research ideas for the development of endoglucanases. At the same time, appropriate site-directed mutagenesis of the substrate-binding pocket can improve the enzyme-substrate binding stability, making them suitable for use as feed enzyme preparations, which can improve feed conversion rate and increase production efficiency. Summary of the Invention

[0004] This invention provides an endoglucanase mutant, TrepCel4-Aa, and its applications. This invention obtains an endoglucanase from the genome of buffalo rumen microorganisms, and mutates it to obtain the endoglucanase mutant TrepCel4-Aa. Then, it is expressed and purified. The obtained enzyme solution is helpful in separating cellulose and improving its application in feed, enzyme preparations, and other fields.

[0005] To achieve the above-mentioned objectives, the present invention employs the following technical solution:

[0006] The present invention provides an endoglucanase mutant TrepCel4-Aa, the amino acid sequence of which is shown in SEQ ID No.4.

[0007] Furthermore, the endoglucanase mutant TrepCel4-Aa is obtained by mutating histidine at position 201 to tryptophan and glutamic acid at position 252 to tyrosine from the endoglucanase with the amino acid sequence SEQ ID No. 1.

[0008] Furthermore, the endoglucanase mutant contains only glycoside hydrolases from the 5th family; it is capable of hydrolyzing the cellulose backbone from within, with an optimal temperature of 50°C and an optimal pH of 6.0.

[0009] The present invention also provides a gene encoding the described endoglucanase mutant TrepCel4-Aa, the nucleotide sequence of which is shown in SEQ ID No. 5.

[0010] The present invention also provides a recombinant expression vector comprising the aforementioned coding gene.

[0011] The present invention also provides a recombinant strain containing the aforementioned coding gene, wherein the strain is *Escherichia coli*.

[0012] The present invention also provides the application of the described endoglucanase mutant TrepCel4-Aa in the preparation of enzyme preparations for degrading cellulose.

[0013] Furthermore, the cellulose is natural lignocellulose; the natural lignocellulose is rice straw, wheat straw, sheep grass, or beet pulp.

[0014] Furthermore, in the enzyme preparation, the concentration of the endoglucanase mutant TrepCel4-Aa is 0.2 mg / mL to 0.8 mg / mL.

[0015] The present invention also provides the application of the aforementioned endoglucanase mutant TrepCel4-Aa in the preparation of animal feed additives.

[0016] Compared with the prior art, the advantages and beneficial technical effects of the present invention are:

[0017] This invention utilizes metagenomics technology to successfully screen an endoglucanase, TrepCel4, from the metagenomic genome of buffalo rumen microorganisms. Then, based on the codon usage preferences of the prokaryotic system and the GC content and mRNA secondary structure of the endoglucanase gene, codon optimization was performed to obtain an optimized gene sequence. Site-directed mutagenesis was then performed on the active site in the substrate-binding pocket of the endoglucanase, resulting in the TrepCel4-Aa mutant enzyme, which was expressed in *E. coli*. After isolation and purification, the TrepCel4-Aa mutant enzyme was successfully expressed in *E. coli*, exhibiting good activity. This invention also demonstrated that the TrepCel4-Aa mutant enzyme possesses high hydrolytic capacity using natural lignocellulose as a substrate, providing theoretical guidance for improving the digestibility of feed fiber and enhancing animal production performance. Attached Figure Description

[0018] Figure 1 Figure showing the results of routine enzymatic properties of the endoglucanase mutant;

[0019] Figure 2 This is an SDS-PAGE image of the endoglucanase mutant;

[0020] Figure 3 The figure shows the results of the degradation of four natural substrates by the endoglucanase mutant. Detailed Implementation

[0021] The following will describe the concept, specific structure, and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features, and effects of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0022] Example 1: Screening, mutation, and purification expression of endoglucanase

[0023] I. Screening of Endoglucanases

[0024] This invention utilizes genomics technology to screen an endoglucanase, TrepCel4, from the metagenomic genome of buffalo rumen microorganisms. Its amino acid sequence is shown in SEQ ID No. 1, and the nucleotide sequence of its encoding gene is shown in SEQ ID No. 2.

[0025] Screening steps: 1) Rinse the wheat straw thoroughly three times with deionized water to remove soluble polysaccharides adhering to the surface of the straw; 2) Dry the wheat straw at 65℃ for 24 hours, then pulverize it into 0.5 mm lengths using a pulverizer, weigh it, and pack it into individual nylon bags (2.5 g / bag); 3) Insert the nylon bags into the rumen of a buffalo through a rumen fistula; 4) After 24 hours, remove the nylon bags and rinse them with phosphate buffer (pH 10). 7.4) Gently wash the surface of the nylon bag to remove rumen contents adhering to the bag surface; 5) Open the nylon bag and weigh approximately 1g of sample into a 5mL centrifuge tube, add 3mL of phosphate buffer, shake up and down for 30 seconds, centrifuge at 350rpm for 15min, remove the suspension, invert on gauze for about 1min to obtain tightly confluent microorganisms; 6) Extract total microbial DNA and perform metagenomic sequencing; 7) After quality control using FastQC software, assemble using MEGAHIT software, and select contigs ≥300bp as the final assembly result; 8) Perform ORF prediction on the contigs using MetaGene to obtain the prokaryotic gene sequence using the NCBI online tool ORF Finder (… http: / / www.ncbi.nlm.nih.gov / gorf / gorg.html Further verification was performed. Genes with sequences greater than or equal to 100 bp were selected and translated into amino acid sequences; 9) CD-HIT was used ( http: / / www.bioinformatics.org / cd-hit / Version 4.6.1) clusters the predicted gene nucleic acid sequences (parameters: 90% identity and coverage), selects the longest gene as the representative sequence, and constructs a non-redundant gene set; 10) uses hmmscan ( http: / / hmmer.janelia.org / search / hmmscan The amino acid sequences of the non-redundant gene set were compared with the CAZy database, and the e-value threshold was set to 1e-5 to obtain the functional annotations of the carbohydrate active enzymes (CAZymes) corresponding to the genes, and gene sequences belonging to the glycoside hydrolase family 5 (GH5) were screened.

[0026] Based on the codon usage preferences of the prokaryotic system and the GC content and mRNA secondary structure of the endonuclease gene, codon optimization was performed on the endonuclease gene (online codon optimization tool: https: / / novopro.cn / tools / ), resulting in the optimized endonuclease sequence, the nucleotide sequence of which is shown in SEQ ID No. 3.

[0027] II. Acquisition and Properties Study of Endoglucanase Mutants

[0028] 1. Predict the protein domain of endoglucanase, identify the substrate-binding pocket site that determines the endoglucanase through homology comparison, and mutate the active site to obtain an endoglucanase mutant named TrepCel4-Aa, whose amino acid sequence is shown in SEQ ID No.4 and the nucleotide sequence of the encoding gene is shown in SEQ ID No.5.

[0029] The mutation sites of the endoglucanase mutant TrepCel4-Aa are H201W and E252Y, that is, histidine at position 201 is mutated to tryptophan and glutamic acid at position 252 is mutated to tyrosine.

[0030] The primer sequences for its site-directed mutagenesis are as follows:

[0031] W201-F: 5'gctgctgtctacttgggcgtactct 3';

[0032] W201-R: 5'caagtagacagcagcagcttgtcgg 3';

[0033] Y252-F: 5'cgtagttatgggttacgcgagcgcc 3';

[0034] Y252-R: 5'taacccataactacgccgatacctt 3'.

[0035] Reaction conditions: 94℃ for 5 min, 94℃ for 20 s, 56℃ for 20 s, 72℃ for 30 s, 72℃ for 10 min.

[0036] Reaction system: 1 uL plasmid DNA (0.5-1 ng), 0.5 uL upstream primer, 0.5 uL downstream primer, 25 uL 2x SuperMix (TransGold, Beijing), 23 uL sterile water.

[0037] 2. Nature Study

[0038] Optimal experimental pH procedure: The optimal pH for enzyme activity is measured at room temperature for 5 minutes in 100mM buffer solutions, including citrate-Na2HPO4 buffer (pH 2.0–7.0), Tris-HCl buffer (pH 8.0–9.0), and glycine-NaOH buffer (pH 10.0–12.0).

[0039] The optimal temperature for enzyme activity was measured at different temperature ranges (30–60 °C) within the optimal pH value of 100 mM citrate-Na2HPO4 buffer.

[0040] like Figure 1As shown, the endoglucanase mutant TrepCel4-Aa contains only the 5th family of glycoside hydrolases; this enzyme can hydrolyze the cellulose backbone from within, and the optimal temperature and optimal pH of this mutant enzyme are 50℃ and 6.0, respectively.

[0041] Example 2: Study on the degradation characteristics of natural lignocellulose substrates by endoglucanase mutant enzyme

[0042] I. Recombinant bacteria

[0043] Recombinant expression was preferably performed using pET28a(+) as the expression vector and *E. coli* BL21(DE3) as the expression host. The plasmid construction steps were as follows: 1) The linearized pET28a(+) vector was obtained using reverse PCR primers pET-F (5-tgagatccggctgctaacaaag-3) and pET-R (5-gctttgttagcagccggat-3); 2) The linearized vector was incubated with DpnI to remove the original plasmid template; 3) The purified target PCR fragment and the linearized pET28a(+) vector were treated with T5 exonuclease, and the mixture was transformed into *E. coli* DH5α, then plated on LB medium containing 50 μg / mL kanamycin; 4) Positive clones were validated by colony PCR and further sequenced; 5) The correctly sequenced plasmid was transformed into *E. coli* BL21(DE3) cells.

[0044] II. Purification of enzyme solution

[0045] Escherichia coli (DE3) containing the endoglucanase mutant gene was activated and inoculated into 6 mL of LB liquid medium containing 50 μg / mL kanamycin, and cultured overnight at 37°C and 200 rpm / min. Subsequently, 6 mL of the bacterial culture was transferred to narrow-necked flasks containing 600 mL of LB liquid medium containing 50 μg / mL kanamycin, and cultured with shaking at 37°C and 200 rpm / min. When the OD600 value of the liquid medium in the narrow-necked flasks reached 0.5–0.6, IPTG (final concentration 0.5 mM) was added to each flask, and the culture was continued at 15°C and 150 rpm / min for 24 h. After centrifugation at 8000 rpm / min and 4°C for 20 min, the supernatant was removed, and the bacterial cells were resuspended in a specific buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0) to obtain the activated recombinant bacteria containing the endoglucanase mutant. The recombinant bacteria cell walls were disrupted, and the mixture was centrifuged at 12000g and 4℃ for 30 min. The supernatant was collected. The supernatant was then purified using an AKTA Pure protein purifier via a nickel column. The resulting purified solution contained the endoglucanase mutant.

[0046] The steps for performing SDS-PAGE experiments on enzyme solutions are as follows: 1) Dissolve SDS-PAGE loading buffer (5X) in a water bath at room temperature or no more than 37°C. After dissolving in the water bath, immediately store at room temperature and avoid prolonged exposure to the water bath; 2) Mix the protein sample and protein loading buffer (5X) at a ratio of 1 μL of protein loading buffer (5X) for every 4 μL of protein sample; 3) Heat in a 100°C or boiling water bath for 3-5 minutes to fully denature the protein; 4) After cooling to room temperature, directly load the sample into the wells of the SDS-PAGE gel; 5) Electrophoresis is usually stopped when the blue dye reaches near the bottom of the gel; 6) After electrophoresis, place the gel in an appropriate amount of Coomassie Brilliant Blue staining solution, ensuring that the staining solution fully covers the gel; 7) Place on a horizontal shaker or a side-swinging shaker and slowly shake for 1 hour or longer at room temperature; 8) Pour out the staining solution. The staining solution can be recycled and reused at least 2-3 times; 9) Add an appropriate amount of destaining solution to ensure that the destaining solution can fully cover the gel; 10) Place on a horizontal shaker or a side-swing shaker and shake slowly at room temperature for 4-24 hours. Change the destaining solution 2-4 times during this period until the blue background is basically completely removed and the protein band staining effect reaches the expectation. Usually, the protein bands will appear 1-2 hours after destaining.

[0047] The results are as follows Figure 2 As shown, the mutant can be successfully expressed in Escherichia coli.

[0048] III. Degradation Experiment

[0049] Using four natural lignocellulose substrates (rice straw, wheat straw, sheepgrass, and beet pulp) as substrates, this study investigated the degradation of these substrates by the endoglucanase mutant TrepCel4-Aa, which released reducing sugars.

[0050] 1. Wash the four substrates thoroughly with deionized water three times to remove soluble sugars adhering to the surface of the substrates, and dry them in an oven at 55℃ to remove moisture.

[0051] 2. Cut rice straw, wheat straw and sheep grass into 2-3mm pieces, and crush beet pulp and pass it through a 50-mesh sieve;

[0052] 3. Add the substrate to a 20 mL centrifuge tube at a ratio of 2% (w / v). Add 50 μL (0.5 mg / mL) of enzyme to the treatment group and add an equal amount of inactivated enzyme to the control group. React at 45 °C for 168 h and observe the substrate degradation.

[0053] Results of degradation of natural lignocellulose substrates as follows Figure 3As shown, the mutant can hydrolyze four different natural lignocellulose substrates, and the yield of reducing sugars produced by degrading beet pulp is higher than that of rice straw, wheat straw and sheepgrass. This indicates that different substrates can affect the production of reducing sugars. Therefore, the mutant can be used in animal husbandry to improve the digestibility of feed fiber.

[0054] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.

Claims

1. An endoglucanase mutant TrepCel4-Aa, characterized in that, Its amino acid sequence is shown in SEQ ID No.

4.

2. The endoglucanase mutant TrepCel4-Aa according to claim 1, characterized in that, It is obtained by mutating histidine at position 201 to tryptophan and glutamic acid at position 252 to tyrosine in the endoglucanase with the amino acid sequence SEQ ID No.

1.

3. A gene encoding a gene, characterized in that, It is the gene encoding the endoglucanase mutant TrepCel4-Aa as described in claim 1, and its nucleotide sequence is shown in SEQ ID No.

5.

4. A recombinant expression vector comprising the encoding gene of claim 3.

5. A recombinant strain comprising the encoding gene of claim 3, characterized in that, The strain in question is Escherichia coli.

6. The use of the endoglucanase mutant TrepCel4-Aa according to claim 1 in the preparation of an enzyme preparation for degrading cellulose.

7. The application according to claim 6, characterized in that, The cellulose is natural lignocellulose; the natural lignocellulose is rice straw, wheat straw, sheep grass or beet pulp.

8. The application according to claim 6, characterized in that, The concentration of the endoglucanase mutant TrepCel4-Aa in the enzyme preparation is 0.2 mg / mL to 0.8 mg / mL.

9. The use of the endoglucanase mutant TrepCel4-Aa according to claim 1 in the preparation of animal feed additives.