A recombinant plasmid for expressing the resistance marker gene *Bacillus subtilis*, its construction method, and its application.

By constructing a recombinant plasmid for expressing the Bacillus subtilis gene without resistance markers in Bacillus subtilis, and using AID fusion with Cas9n protein for site-directed base editing, the problems of contamination and low expression levels caused by resistance markers in microbial fermentation production were solved, achieving efficient and stable heterologous protein expression and meeting the production requirements for food safety levels.

CN115976082BActive Publication Date: 2026-05-26SOUTH CHINA UNIV OF TECH
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SOUTH CHINA UNIV OF TECH
Filing Date
2022-07-12
Publication Date
2026-05-26

Smart Images

  • Figure CN115976082B_ABST
    Figure CN115976082B_ABST
Patent Text Reader

Abstract

This invention provides a recombinant plasmid for expressing the Bacillus subtilis resistance marker gene without antibiotic resistance, its construction method, and its application. This invention utilizes Bacillus subtilis SCK6 supercompetent cells to directly construct a Bsggt recombinant expression plasmid that does not contain the Ori replication origin site of Escherichia coli or the ampicillin resistance gene. This results in a smaller free plasmid expression system, providing a stable expression tool for heterologous proteins in production applications. The use of Cas9n-AID base editing technology in this invention simplifies the strain screening process. The constructed resistance marker-free expression plasmid is smaller than traditional shuttle plasmids, and no inducing agent is needed during expression. Because the expression plasmid is free of antibiotic resistance markers, the growth rate is significantly increased during culture due to the absence of antibiotic pressure. High expression without antibiotic introduction is more suitable for food safety-grade production applications.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and specifically relates to a recombinant plasmid for expressing the antibiotic resistance marker gene Bacillus subtilis, its construction method, and its application. Background Technology

[0002] There is an increasingly urgent demand for enzyme preparations in pharmaceuticals, food, and skincare products. Currently, microbial fermentation is the mainstream production method due to the advantages of microorganisms, such as their ability to reproduce on inexpensive culture media, express heterologous proteins extracellularly, and their wide adaptability and high stability. However, some problems have gradually been discovered during the production process. For example, the construction of recombinant strains expressed using free plasmids during microbial fermentation always requires the introduction of resistance marker genes for screening, which can lead to antibiotic contamination in food-grade production and thus restrict its use. Some studies have used methods such as deleting resistance marker genes and directly ligating the remaining fragments for transformation to obtain resistance marker-free expression plasmids, but this requires blind screening on antibiotic-free culture media, which is not only labor-intensive, time-consuming, and inefficient. Many studies have also achieved the goal of producing antibiotic-free proteins by integrating the operon of heterologous protein expression into the genome. However, this method suffers from problems such as low integration copy number, which is far less than the replication of free plasmids, and low protein expression levels. Studies have shown that when the copy number exceeds a certain value, the two are negatively correlated, which can burden host growth. Furthermore, due to the low integration efficiency of traditional homologous recombination, the excessive size of Cas9 site-directed integration plasmids, and the cumbersome process of multi-copy integration, there is an urgent need for new solutions for antibiotic-free protein expression.

[0003] Currently, most bacterial protein expression, especially in Bacillus subtilis spores, uses plasmids. However, these plasmids often carry resistance genes, which are unacceptable for food-grade protein expression. While integration expression can remove resistance, it results in low copy numbers and low expression levels. Plasmids, on the other hand, have high copy numbers and high protein yields. The resistance genes on plasmids not only facilitate screening but also provide stability. Therefore, the primary goal of current transgenic research is to directly knock out multiple copies of resistance genes on plasmids in transformed bacteria while maintaining plasmid stability and high yield, achieving current food safety standards. This is of great significance for achieving efficient expression of food-grade heterologous proteins. Summary of the Invention

[0004] In order to overcome the shortcomings and deficiencies of the prior art, the primary objective of this invention is to provide a method for constructing a recombinant plasmid expressing the antibiotic resistance marker gene Bacillus subtilis.

[0005] Another objective of this invention is to provide a recombinant plasmid for expressing the antibiotic resistance marker gene *Bacillus subtilis* constructed using the above-described method.

[0006] Another object of the present invention is to provide the application of the above-mentioned recombinant plasmid for expressing the resistance-free marker gene Bacillus subtilis.

[0007] A method for constructing a recombinant plasmid expressing the antibiotic resistance marker gene *Bacillus subtilis*, comprising the following steps:

[0008] (1) Remove the E. coli replication origin site Ori and the ampicillin resistance gene Amp from the pBE-Pcd-P43-SBsGGT-SamyQ-BsGGT plasmid to obtain the pBE-BsggtΔOriΔAmp plasmid.

[0009] (2) Using plasmid pWSCas9n-AID-sgRNA-pyrF as the starting plasmid, the kanamycin resistance gene Kana was replaced with the chloramphenicol resistance gene Cm, and the sgRNA of pyrF was replaced with the sgRNA of the kanamycin resistance gene Kana, to obtain the pWSCas9n-AID-KansgRNA-Cm editing plasmid.

[0010] (3) The pBE-BsggtΔOriΔAmp plasmid prepared in step (1) and the pWSCas9n-AID-KansgRNA-Cm editing plasmid prepared in step (2) were transferred into the strain. After induction of expression, the Kana gene was site-directedly edited to mutate it into a stop codon and thus inactivate it. The pWSCas9n-AID-KansgRNA-Cm plasmid was lost by raising the temperature and culturing. The plasmid was extracted to obtain a recombinant plasmid pBE-BsggtΔOriΔAmpΔK that expresses the anti-resistance marker gene Bacillus subtilis.

[0011] The specific steps for removal described in step (1) are as follows:

[0012] To obtain a GGT recombinant expression plasmid fragment with the Ori replication origin and Amp resistance genes removed after template PCR amplification, the fragment was ligated to obtain the ligation product.

[0013] The specific steps of step (2) are as follows:

[0014] Using pWSCas9n-AID-sgRNA-pyrF plasmid as a template, a fragment without the kanamycin resistance gene was amplified using primers. Then, using pHT43 plasmid as a template, a chloramphenicol resistance gene fragment was amplified using primers. The sgRNA of the kanamycin resistance gene was added to the primer in the form of an overlap with the ligation fragment. The amplified fragments were ligated, and the resulting ligation product was transformed into E. coli for screening and verification, resulting in the pWSCas9n-AID-KansgRNA-Cm editing plasmid.

[0015] The sgRNA sequence of the above-mentioned kanamycin resistance gene is shown in SEQ ID: NO.11.

[0016] The aforementioned Escherichia coli is Escherichia coli Mach1 T1.

[0017] The connection method described above is the In-fusion method.

[0018] The strain mentioned in step (3) is a competent Bacillus subtilis cell.

[0019] The induced expression in step (3) is the induction of Cas9n expression using IPTG liquid.

[0020] The temperature rise and culture in step (3) is 35-39℃ for 14-18 hours, preferably 37℃ for 16 hours.

[0021] A recombinant plasmid for expressing Bacillus subtilis without resistance marker genes was obtained by removing the E. coli replication origin Ori and the ampicillin resistance gene Amp from the plasmid pBE-Pcd-P43-SBsGGT-SamyQ-BsGGT, and inactivating the kanamycin resistance gene Kana.

[0022] Application of the above-mentioned recombinant plasmid expressing the resistance marker gene *Bacillus subtilis* in the expression of glutamine transpeptidase (GGT or γ-GT).

[0023] A recombinant engineered cell line is a cell line obtained by transforming or transducing host cells with the above-mentioned recombinant plasmid expressing the non-resistance marker gene *Kapok*.

[0024] The Bacillus subtilis is further described as Bacillus subtilis ATCC6051Δ5.

[0025] This invention relates to a method for constructing recombinant plasmids for expressing antibiotic resistance marker genes using site-directed base editing technology with AID fusion of Cas9n protein to insert stop codons, and its application in meeting food safety standards. In particular, it relates to a method for constructing smaller and more stable recombinant pBE plasmids that replicate in Bacillus subtilis using Bacillus subtilis SCK6 supercompetent cells and removes the Ori replication origin site of Escherichia coli and the ampicillin and kanamycin resistance genes, and its application in the production of glutamine transpeptidase (GGT or γ-GT).

[0026] This invention addresses the current situation where existing heterologous protein high-expression plasmids, despite high copy numbers and expression levels in free plasmids, fail to meet food safety standards due to the presence of resistance markers, and also the problem that stable expression without resistance after integration into the genome results in low expression levels due to low copy numbers. To address this, a method for constructing a recombinant plasmid for expression without resistance markers is provided: A Bsggt recombinant expression plasmid without the E. coli replication origin site Ori and the ampicillin resistance gene is directly constructed using Bacillus subtilis SCK6 supercompetent cells, resulting in a smaller free plasmid expression system. Then, using AID base editing technology, a C→T mutation is performed on the Kana marker gene under Cas9n site-directed cleavage to insert a stop codon, thereby disabling the Kana marker gene. Heating and culturing at elevated temperatures causes the loss of the temperature-sensitive pWSCas9n-AID-KansgRNA-Cm edit plasmid, yielding recombinant Bacillus subtilis containing the resistance-free plasmid.

[0027] The present invention has the following advantages and effects compared with the prior art:

[0028] (1) This invention utilizes Bacillus subtilis SCK6 supercompetent cells to directly construct Bsggt recombinant expression plasmids that do not contain the Escherichia coli replication origin site Ori and ampicillin resistance gene, which can obtain smaller free plasmid expression systems and provide smaller plasmid stable expression tools for heterologous proteins in production and application.

[0029] (2) In this invention, the AID fusion Cas9n protein is used to perform site-specific base editing of the Kana marker gene in the pBE-BsggtΔOriΔAmp expression plasmid. A stop codon is inserted through a C→T mutation, thereby disabling the Kana marker gene. The temperature-sensitive pWSCas9n-AID-KansgRNA-Cm edited plasmid can be lost through elevated temperature culture, resulting in recombinant Bacillus containing the antibiotic-free plasmid. The effect is significantly improved by 22.76% compared to the unmutated form.

[0030] (3) The construction of the antibiotic resistance marker-free expression plasmid of the present invention simplifies the strain screening process. The traditional construction method, which involves deleting all antibiotic resistance marker gene sequences, directly ligating, transforming, and then blindly screening, is not only labor-intensive but also introduces wild-type strains that compete for growth, making it time-consuming and labor-intensive. The Cas9n-AID site-directed base editing system is highly efficient, capable of completely editing all multi-copy plasmids within a host, and the success of the editing can be verified simply by placing the transformants on a plate.

[0031] (4) The expression plasmid without resistance marker constructed in this invention is smaller than the traditional shuttle plasmid, and no inducer is needed to induce protein expression during the expression process. Since the expression plasmid is without resistance marker, the growth rate can be significantly improved during the culture process due to the absence of antibiotic pressure. At the same time, it provides a new solution to the problems of free plasmids carrying resistance marker genes that cannot meet food safety standards and low expression levels due to low genome integration expression copy number during food production. Attached Figure Description

[0032] Figure 1 This is an electrophoresis diagram of the expression plasmid pBE-BsggtΔOriΔAmp; lane M is the DNA marker, and lanes 1-3 are the pBE-BsggtΔOriΔAmp plasmid.

[0033] Figure 2 This is a schematic diagram and a schematic diagram of the construction process of the expression plasmid pBE-BsggtΔOriΔAmp.

[0034] Figure 3 This is an electrophoresis image of the pWSCas9n-AID-KansgRNA-Cm plasmid; lane M is the DNA marker, and lane 1 is the pWSCas9n-AID-KansgRNA-Cm plasmid.

[0035] Figure 4 This is a schematic diagram of the edited plasmid pWSCas9n-AID-KansgRNA-Cm.

[0036] Figure 5 This is a graph showing the growth status of recombinant Bacillus subtilis with two plasmids; the boxes indicate colonies that cannot grow on LB solid plates containing kanamycin.

[0037] Figure 6 The sequence alignment results are obtained by inoculating colonies that cannot grow on LB solid plates containing kanamycin into liquid LB medium, extracting plasmids, and then sequencing them.

[0038] Figure 7 This is a schematic diagram of the pBE-BsggtΔOriΔAmpΔK expression plasmid.

[0039] Figure 8This is a bar chart comparing the transpeptidase activity of BsGGT enzymes after 48 hours of fermentation by recombinant engineered bacteria containing pBE-Bsggt, pBE-BsggtΔOriΔAmp, and pBE-BsggtΔOriΔAmpΔK. pBE-Bsggt refers to recombinant Bacillus subtilis containing the E. coli replication origin site Ori, the Amp resistance gene, and the Kana resistance gene; pBE-BsggtΔOriΔAmp refers to recombinant Bacillus subtilis lacking the E. coli replication origin site Ori and the Amp resistance gene fragment sequence but possessing the Kana resistance gene; pBE-BsggtΔOriΔAmpΔK refers to recombinant Bacillus subtilis lacking the E. coli replication origin site Ori and the Amp resistance gene fragment sequence, possessing the Kana resistance gene but with it encoded into a stop codon. Detailed Implementation

[0040] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0041] Unless otherwise specified, the test methods in the following examples are generally performed under standard experimental conditions or as recommended by the manufacturer. Unless otherwise specified, the materials and reagents used are commercially available.

[0042] The molecular biology experimental techniques used in the following examples include PCR amplification, plasmid extraction, DNA fragment ligation, gel electrophoresis, etc. For details, please refer to "Molecular Cloning: A Laboratory Manual" (3rd edition) (translated by Sambrook J, Russell DW, Janssen K, Argentine J, Huang Peitang et al., 2002, Beijing: Science Press).

[0043] SEQ ID:NO.1(ΔOriΔAmp-F):aatattgaaaaaggaagagtcggagcctatggaaaaacgcc

[0044] SEQ ID:NO.2(ΔOriΔAmp-R):gcgtttttccataggctccgactcttcctttttcaatattattgaag

[0045] SEQ ID:NO.3(Cm-F):ttataaaagccagtcattaggcc

[0046] SEQ ID:NO.4(Cm-Cas-R):atagctgaataagaacggtgctcgaaaaggatttttcgctacgctc

[0047] SEQ ID:NO.5(Cas9-Cm-F):gagcaccgttcttattcagctat

[0048] SEQ ID:NO.6(P43-kansg-R):aactatttatccaatattcgttcctataatggtaccgctatcacttt

[0049] SEQ ID:NO.7(gRNA-kansg-F):aggaacgaatattggataaatagttttagagctagaaatagcaagttSEQ ID:NO.8(Cas9-R):atggatcagctgcataaaattgcg

[0050] SEQ ID:NO.9(Cas9-F):cgcaattttatgcagctgatccat

[0051] SEQ ID:NO.10(AID-Cm-R):ggcctaatgactggcttttataaacgatgacctcgagctctgaga

[0052] SEQ ID:NO.11(Kana sgRNA):gaacgaatattggataaata

[0053] Example 1: Construction of the GGT recombinant expression plasmid pBE-BsggtΔOriΔAmp with the Ori and Amp resistance genes deleted from the coli replication origin site:

[0054] (1) Design primers (the underlined part is the overlapping part with the connecting fragment)

[0055] ΔOriΔAmp-F: 5'-aatattgaaaaaggaagagtcggagcctatggaaaaacgcc-3'

[0056] ΔOriΔAmp-R: 5'-gcgtttttccataggctccgactcttcctttttcaatattattgaag-3'

[0057] Using the primers described above, PCR amplification was performed using the pBE-Pcd-P43-SBsGGT-SamyQ-BsGGT plasmid (constructed in the laboratory, with construction method referring to patent: CN202111161871.8 A combined DNA fragment with dual promoter and dual secretion signal functions and its application) as a template to obtain a 6265bp GGT recombinant expression plasmid fragment with the Ori and Amp resistance genes removed from the coli replication initiation site. This fragment was then ligated using the in-fusion method (specific operation methods are detailed in the NEBuilder Hi Fi DNA Assembly Master Mix kit manual) to obtain the ligation product.

[0058] (2) Preparation of supercompetent cells of Bacillus subtilis SCK6 (strain provided by Haitian Co., Ltd., construction method referred to Zhang XZ, Zhang YHP. Simple, fast and high-efficiency transformation system for directed evolution of cellulase in Bacillus subtilis. Microb Biotechnol, 2011, 4(1): 98-105.) (method reference: Zhang XZ, Zhang YHP. Simple, fast and high-efficiency transformation system for directed evolution of cellulase in Bacillus subtilis. Microb Biotechnol, 2011, 4(1): 98-105.) (method reference: Zhang XZ, Zhang YHP. Simple, fast and high-efficiency transformation system for directed evolution of cellulase in Bacillus subtilis. Microb Biotechnol, 2011, 4(1): 98-105.) Biotechnol, 2011, 4(1): 98-105. and Li Xinzhi, Lu Zhenghui, Zhou Yuling, Li Shiyu, Zhang Guimin. Preparation and optimization of transformation conditions of supercompetent cells of Bacillus subtilis SCK6[J]. Chinese Journal of Biotechnology, 2017, 33(04): 692-698.): Bacillus subtilis SCK6 glycerol tubes stored at -80℃ were streaked on LB plates for activation. Single colonies were inoculated into 10 mL of LB medium and cultured overnight at 37℃ and 220 rpm for 12 h. Then, the cells were transferred to LB medium containing 1.5% xylose. The initial OD600 was 1.0. The cells were cultured at 37℃ and 220 rpm for 4 h. Glycerol was added to a final concentration of 10%. The resulting bacterial solution was the competent cells. The prepared competent cells were aliquoted into 200 μL tubes and stored at -80℃.

[0059] (3) Transformation and plasmid cloning:

[0060] 10 μL of the ligation product prepared in step (1) was added to 200 μL of Bacillus subtilis SCK6 competent cells and mixed thoroughly. The mixture was incubated at 37°C and 220 rpm for 1.5–2 h. After centrifugation, the remaining supernatant was used to resuspend the bacterial cells. All cells were then spread onto LB medium containing kanamycin and incubated overnight at 37°C (inverted) for 16 h. Screening was performed using LB medium containing kanamycin, and electrophoresis confirmed the presence of corresponding bands of the correct size (see...). Figure 1 The sample was sent to Sangon Biotech for sequencing verification, and transformants containing the correct sequence plasmid were obtained. The pBE-BsggtΔOriΔAmp plasmid was extracted from the transformed sample (see...). Figure 2 ).

[0061] Example 2: Construction of pWSCas9n-AID-KansgRNA-Cm editing plasmid:

[0062] (1) Using plasmid pWSCas9n-AID-sgRNA-pyrF (constructed in the laboratory, construction method referred to the literature: Xin Q, Chen Y, Chen Q, Wang B, Pan L. Development and application of a fast and efficient CRISPR-based genetic toolkit in Bacillus amyloliquefaciensLB1ba02. Microb Cell Fact. 2022 May 28; 21(1):99. doi:10.1186 / s12934-022-01832-2.PMID:35643496;PMCID:PMC9148480.) and pHT43 vector as templates, the DNA fragments were amplified with primers to carry homologous fragments of about 20 bp with the adjacent fragments. The Cm resistance gene fragment was amplified from the pHT43 vector using primers Cm-F and Cm-Cas-R, yielding a fragment of 903 bp. Fragment 1 was amplified from pWSCas9n-AID-sgRNA-pyrF using primers Cas9-Cm-F and P43-kansg-R, resulting in a fragment of 1376 bp. Fragment 2 was amplified from pWSCas9n-AID-sgRNA-pyrF using primers gRNA-kansg-F and Cas9-R, resulting in a fragment of 3735 bp. Fragment 3 was amplified from pWSCas9n-AID-sgRNA-pyrF using primers Cas9-F and AID-Cm-R, resulting in a fragment of 3652 bp, consistent with the size of the target product. PCR products with impurities were recovered using agarose gel electrophoresis, while the remaining products were recovered using other columns.

[0063] The sgRNA of Kana was predicted using the website http: / / www.rgenome.net / be-designer / , and gaacgaatattggataaata was selected as the N20 cleavage site of the sgRNA. It was added to primers P43-kansg-R and gRNA-kansg-F in the form of an overlap with the linker fragment.

[0064] The primer sequences used are as follows: (underlined parts are the overlapping parts with the ligation fragment)

[0065] Cm-F:5'-ttataaaagccagtcattaggcc-3'

[0066] Cm-Cas-R: 5'-atagctgaataagaacggtgctcgaaaaggatttttcgctacgctc-3'

[0067] Cas9-Cm-F:5'-gagcaccgttcttattcagctat-3'

[0068] P43-kansg-R:5'-aactatttatccaatattcgttcctataatggtaccgctatcacttt-3'

[0069] gRNA-kansg-F: 5'-aggaacgaatattggataaatagttttagagctagaaatagcaagtt-3'

[0070] Cas9-R: 5'-atggatcagctgcataaaattgcg-3'

[0071] Cas9-F: 5'-cgcaattttatgcagctgatccat-3'

[0072] AID-Cm-R: 5'-ggcctaatgactggcttttataaacgatgacctcgagctctgaga-3'

[0073] (2) Fragment ligation, transformation, and plasmid cloning:

[0074] The Cm resistance gene fragment, vector fragment 1, vector fragment 2, and vector fragment 3 were ligated using the in-fusion method (see the NEBuilder Hi Fi DNA AssemblyMaster Mix kit manual for detailed instructions). The in-fusion products were then transformed into *E. coli* Mach1T1 competent cells using a heat shock method. After culturing in LB medium containing chloramphenicol, the cells were screened, and the corresponding bands of the correct size were verified by bacterial electrophoresis (see [link to instructions]). Figure 3 The samples were sent to Sangon Biotech for sequencing to obtain transformants containing the correct sequence plasmid. The pWSCas9n-AID-KansgRNA-Cm plasmid was then extracted (see...). Figure 4 ).

[0075] Example 3: Using AID base editing technology, a GGT recombinant expression plasmid pBE-BsggtΔOriΔAmpΔK without the resistance marker gene was constructed.

[0076] (1) The pBE-BsggtΔOriΔAmp plasmid was transformed into Bacillus subtilis ATCC6051Δ5 competent cells by electroporation (2500V, 4.2-5.6ms) (this strain was constructed in the laboratory, and the construction method is referenced in Liu, X., H. Wang, B. Wang, and L. Pan*. (2018) Efficient Production of Extracellular Pullulanase in Bacillus Subtilis Atcc6051 Using the Host Strain Construction and Promoter Optimization Expression System. Microb Cell Fact 17, no. 1: 163.). The pBE-BsggtΔOriΔAmp recombinant Bacillus subtilis was obtained by screening on LB solid plates containing kanamycin.

[0077] (2) The above-mentioned pBE-BsggtΔOriΔAmp recombinant Bacillus subtilis was prepared into competent cells (preparation method refers to: Liao Yuling. Transcriptomics of Bacillus amyloliquefaciens and its expression element mining and application [D]. South China University of Technology, 2016.). The pWSCas9n-AID-KansgRNA-Cm editing plasmid prepared in Example 2 was transformed into the recombinant Bacillus subtilis competent cells by electroporation (2500V, 4.2-5.6ms). After culturing and screening in LB medium containing chloramphenicol, recombinant Bacillus subtilis containing the two plasmids was obtained. Transformants were picked and Cas9n expression was induced by 100μM IPTG liquid at 30℃ and 220rpm. The transformed cells were then plated on antibiotic-free LB plates. The colonies that grew were spotted on LB solid plates containing kanamycin (see Figure 5 The colonies were selected, inoculated, and plasmids were extracted and verified by electrophoresis. Strains containing the pBE-BsggtΔOriΔAmp expression plasmid and unable to grow under kanamycin stress were identified as the desired mutant strains. The extracted plasmids were then sent to Sangon Biotech for sequencing (see [link to article]). Figure 6 It was confirmed that C→T was successfully edited in the Kana gene, and the CGA was mutated to the TGA stop codon, thus inactivating the Kana gene and obtaining the pBE-BsggtΔOriΔAmpΔK expression plasmid (see...). Figure 7 By incubating at 37℃ for 16 hours (overnight), the pWSCas9n-AID-KansgRNA-Cm editing plasmid was lost, resulting in recombinant Bacillus subtilis containing only the pBE-BsggtΔOriΔAmpΔK expression plasmid.

[0078] Example 4: Transformation and enzyme activity assay of GGT recombinant expression plasmid:

[0079] The pBE-Pcd-P43-SamyQ-SBsGGT-BsGGT and pBE-BsggtΔOriΔAmp plasmids prepared in Example 1 were transformed into Bacillus subtilis ATCC6051Δ5 competent cells by electroporation (2500V, 4.2-5.6ms). After screening on LB solid plates containing kanamycin, recombinant Bacillus subtilis pBE-Pcd-P43-SamyQ-SBsGGT-BsGGT and pBE-BsggtΔOriΔAmp were obtained. The obtained recombinant Bacillus subtilis and the recombinant Bacillus subtilis containing only the pBE-BsggtΔOriΔAmpΔK expression plasmid prepared in Example 3 were respectively inoculated into 100 mL LB liquid medium and fermented at 37 °C and 220 rpm for 48 h before enzyme activity was measured (the enzyme activity measurement method of GGT recombinant expression plasmid refers to patent: CN202111161871.8 A combined DNA fragment with dual promoter and dual secretion signal functions and its application).

[0080] The BsGGT enzyme activity expressed by the pBE-Pcd-P43-SamyQ-SBsGGT-BsGGT expression system was determined to be 48.03 U / mL, the BsGGT enzyme activity expressed by the pBE-BsggtΔOriΔAmp expression system was 40.37 U / mL, and the BsGGT enzyme activity expressed by the pBE-BsggtΔOriΔAmpΔK expression system was 49.56 U / mL (see...). Figure 8 ).

[0081] The results showed that the antibiotic-free free plasmid expression system could achieve efficient secretory expression of the BsGGT heterologous protein. This is because the technology can remove the Ori and Amp resistance genes from the *E. coli* replication initiation site, thereby reducing the number of bases in the plasmid. The plasmid is smaller and more stable after cloning with *E. coli*. Further base editing was performed on the original Kana resistance gene fragment on the plasmid using the AID base editor, resulting in a stop codon mutation in the Kana resistance gene fragment, thus inactivating the Kana resistance and preventing growth on resistance plates. Shake-flask fermentation and enzyme activity assays showed that the expression level of the antibiotic-free plasmid was comparable to that of the resistance-labeled plasmid, and the enzyme activity was increased by 22.76% compared to before the Kana mutation.

[0082] During the fermentation process, the strain can significantly increase its growth rate due to the absence of antibiotic pressure. At the same time, it provides a new solution to the problems of free plasmids carrying resistance marker genes and low expression levels caused by low copy number of integrated genome expression in food production. Therefore, the use of the technology of this invention is an important manifestation of achieving efficient secretory expression of γ-glutamyl transpeptidase in food safety production.

[0083] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of a recombinant plasmid expressing the antibiotic resistance marker gene *Bacillus subtilis* in glutamine transpeptidase expression, characterized in that: The aforementioned recombinant plasmid expressing the resistance marker gene Bacillus subtilis was obtained by removing the E. coli replication origin Ori and the ampicillin resistance gene Amp from the plasmid pBE-Pcd-P43-SBsGGT-SamyQ-BsGGT, and inactivating the kanamycin resistance gene Kana. The method for constructing the recombinant plasmid expressing the resistance-free marker gene *Bacillus subtilis* includes the following steps: (1) Remove the E. coli replication origin site Ori and the ampicillin resistance gene Amp from the pBE-Pcd-P43-SBsGGT-SamyQ-BsGGT plasmid to obtain the pBE-BsggtΔOriΔAmp plasmid; (2) Using plasmid pWSCas9n-AID-sgRNA-pyrF as the starting plasmid, the kanamycin resistance gene Kana was replaced with the chloramphenicol resistance gene Cm, and the sgRNA of pyrF was replaced with the sgRNA of the kanamycin resistance gene Kana, to obtain the pWSCas9n-AID-KansgRNA-Cm editing plasmid. (3) The pBE-BsggtΔOriΔAmp plasmid prepared in step (1) and the pWSCas9n-AID-KansgRNA-Cm editing plasmid prepared in step (2) were transferred into the strain. After induction of expression, the Kana gene was site-directedly edited to mutate it into a stop codon and thus inactivate it. The pWSCas9n-AID-KansgRNA-Cm plasmid was lost by raising the temperature and culturing. The plasmid was extracted to obtain a recombinant plasmid pBE-BsggtΔOriΔAmpΔK that expresses the anti-resistance marker gene Bacillus subtilis. The sgRNA sequence of the kanamycin resistance gene is shown in SEQ ID: NO.11; The application of the recombinant plasmid expressing the resistance-free marker gene *Bacillus subtilis* in glutamine transpeptidase expression was achieved by transforming the recombinant plasmid pBE-BsggtΔOriΔAmpΔK into *Bacillus subtilis* ATCC6051Δ5.

2. The application of the recombinant plasmid expressing the resistance marker gene *Bacillus subtilis* according to claim 1 in glutamine transpeptidase expression, characterized in that: The specific steps for removal described in step (1) are as follows: To obtain a GGT recombinant expression plasmid fragment with the Ori replication origin and Amp resistance genes removed after template PCR amplification, the fragment was ligated to obtain the ligation product. The specific steps of step (2) are as follows: Using pWSCas9n-AID-sgRNA-pyrF plasmid as a template, a fragment without the kanamycin resistance gene was amplified using primers. Then, using pHT43 plasmid as a template, a chloramphenicol resistance gene fragment was amplified using primers. The sgRNA of the kanamycin resistance gene was added to the primer in the form of an overlap with the ligation fragment. The amplified fragments were ligated, and the resulting ligation product was transformed into E. coli for screening and verification, resulting in the pWSCas9n-AID-KansgRNA-Cm editing plasmid. The Escherichia coli mentioned is Escherichia coli Mach1 T1; The connection method described is the In-fusion method; The strain mentioned in step (3) is a competent Bacillus subtilis cell; The induced expression described in step (3) is the induction of Cas9n expression using IPTG liquid; The temperature rise culture in step (3) is 35-39℃ for 14-18 hours.

Citation Information

Patent Citations

  • Combined DNA fragment with double promoters and double secretion signal functions and application of combined DNA fragment

    CN113957071A