Isolated circular rnas and uses thereof
By isolating and regulating circular CYTB RNA (CircCYB), and knocking down CircCYB expression using shRNA, siRNA, or CRISPR/Cas9 technology, the problem of insufficient targeting in early lung cancer treatment has been solved, achieving specific apoptosis and death of cancer cells, and providing an effective cancer prevention and treatment strategy.
Patent Information
- Application Number
- CN202211657706.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-22
- Publication Date
- 2026-03-27
- Estimated Expiration
- 2042-12-22
AI Technical Summary
The lack of targeted and specific treatments for early-stage lung cancer in existing technologies makes early treatment difficult, and the early symptoms of lung cancer are not obvious and are easily overlooked, leading to the loss of surgical opportunities.
By isolating and regulating the highly expressed circular CYTB RNA (CircCYB) in human cells, and using shRNA, siRNA, or CRISPR/Cas9 technology to knock down CircCYB expression, cancer cell apoptosis can be promoted, and drug compositions can be developed for the prevention and treatment of cancer.
It effectively promotes apoptosis in cancer cells, especially lung cancer cells, providing a specific and effective early treatment for lung cancer and reducing the risk of cancer death.
Smart Images

Figure CN116004643B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of bioengineering, in particular, the present application relates to an isolated circular RNA and uses thereof, more particularly, the present application relates to an isolated circular nucleic acid molecule, an isolated protein or polypeptide, a construct, a recombinant cell, uses of the isolated circular nucleic acid molecule, the isolated protein or polypeptide, the construct, the recombinant cell in the preparation of a medicament, a pharmaceutical composition and uses thereof. BACKGROUND
[0002] Cancer has become the first death inducement (mortality rate: 130.7 people die of cancer per 100,000 people). The cancer mortality rate from high to low is lung cancer, gastric cancer, liver cancer, colorectal cancer and pancreatic cancer, and the mortality rate of these five cancers accounts for about 70% of the total cancer mortality. Among men, the number of deaths from the four major cancers of lung cancer, gastric cancer, liver cancer and colorectal cancer accounts for 70% of the total number of male cancer deaths. Among women, the number of deaths from the five major cancers of gastric cancer, lung cancer, liver cancer, colorectal cancer and pancreatic cancer accounts for 60% of the total number of female cancer deaths.
[0003] Lung cancer is a malignant tumor originating from the bronchial mucosa or glands of the lungs, and has the fastest growing incidence and mortality rate, and is one of the malignant tumors that pose the greatest threat to human health and life. Lung cancer has no obvious symptoms in the early stage and is often ignored. By the time clinical symptoms appear, it is already in the middle or late stage, at which point surgical opportunities have often been lost, which makes early treatment of lung cancer particularly important. However, current early treatment for lung cancer lacks specificity and specificity. Therefore, if a specific method for treating lung cancer can be found, it will be of great significance for the early treatment of lung cancer. SUMMARY
[0004] The present application aims to at least partially solve at least one of the technical problems existing in the prior art. To this end, the present application provides an isolated CircCYB and uses thereof, which is highly expressed in cancer cells and can promote apoptosis of cancer cells when CircCYB is knocked down.
[0005] The present application is based on the following findings of the inventors:
[0006] The human CYTB gene is located on the mitochondrial genome (position: 14737...15877), which encodes the respiratory chain protein CYTB protein. The inventors have found for the first time through experiments that in multiple cells of the human body (such as embryonic stem cells, induced pluripotent stem cells and cancer cells), the CYTB gene can form a 1083bp long circular RNA connected head to tail through transcription, i.e. a circular CYTB (also known as CircCYB). The inventors have also surprisingly found through experiments that knocking down the expression level of CircCYB in cancer cells (especially lung cancer cells) does not change the level of linear CYTB mRNA, promotes lung cancer cell apoptosis and death, and has no pro-apoptotic effect on normal cells; therefore, by adjusting the expression level of CircCYB in cancer cells, the apoptosis of cancer cells can be specifically regulated. The human CYTB gene sequence has a nucleotide sequence as shown in SEQ ID NO: 4, wherein the underlined part is the CircCYB sequence.
[0007] ATGACCCCAATACGCAA AACTAACCCCCTAATAAAATTAATTAACCACTCATTCATCGACCTCCCCAC CCCATCCAACATCTCCGCATGATGAAACTTCGGCTCACTCCTTGGCGCCTGCCTGATCCTCCAAATCACCACAGGA CTATTCCTAGCC ATGCACTACTCACCAGACGCCTCAACCGCCTTT TCATCAATCGCCCACATCACTCGAGACGTAA ATTATGGCTGAATCATCCGCTACCTTCACGCCAATGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGG GCGAGGCCTATATTACGGATCATTTCTCTACTCAGAAACCTGAAACATCGGCATTATCCTCCTGCTTGCAACTATA GCAACAGCCTTCATAGGCTATGTCCTCCCGTGAGGCCAAATATCATTCTGAGGGGCCACAGTAATTACAAACTTAC TATCCGCCATCCCATACATTGGGACAGACCTAGTTCAATGAATCTGAGGAGGCTACTCAGTAGACAGTCCCACCCT CACACGATTCTTTACCTTTCACTTCATCTTGCCCTTCATTATTGCAGCCCTAGCAACACTCCACCTCCTATTCTTG CACGAAACGGGATCAAACAACCCCCTAGGAATCACCTCCCATTCCGATAAAATCACCTTCCACCCTTACTACACAA TCAAAGACGCCCTCGGCTTACTTCTCTTCCTTCTCTCCTTAATGACATTAACACTATTCTCACCAGACCTCCTAGG CGACCCAGACAATTATACCCTAGCCAACCCCTTAAACACCCCTCCCCACATCAAGCCCGAATGATATTTCCTATTC GCCTACACAATTCTCCGATCCGTCCCTAACAAACTAGGAGGCGTCCTTGCCCTATTACTATCCATCCTCATCCTAG CAATAATCCCCATCCTCCATATATCCAAACAACAAAGCATAATATTTCGCCCACTAAGCCAATCACTTTATTGACT CCTAGCCGCAGACCTCCTCATTCTAACCTGAATCGGAGGACAACCAGTAAGCTACCCTTTTACCATCATTGGACAA GAGTATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATG AACTATCTCCCTAATTGAAAACAAAATACTCAAATGGGCCT (SEQ ID NO: 4).
[0008] In one aspect of the present application, the present application provides an isolated circular nucleic acid molecule. According to an embodiment of the present application, the isolated circular nucleic acid molecule has a nucleotide sequence as shown in SEQ ID NO: 1. The inventors have found through experiments that the above-mentioned isolated circular nucleic acid molecule (i.e. CircCYB) plays an important role in regulating the development of cancer.
[0009] In another aspect of the present application, the present application provides an isolated protein or polypeptide. According to an embodiment of the present application, the isolated protein or polypeptide is encoded by the aforementioned isolated circular nucleic acid molecule. Thus, the aforementioned isolated circular nucleic acid molecule can be used to encode the isolated protein or polypeptide.
[0010] In yet another aspect of the present application, the present application provides a construct. According to embodiments of the present application, the construct carries the aforementioned isolated circular nucleic acid molecule. The construct can be effectively used to express the aforementioned isolated protein or polypeptide, especially in prokaryotic or lower eukaryotic expression systems.
[0011] In yet another aspect of the present application, the present application provides a recombinant cell. According to embodiments of the present application, the recombinant cell carries the aforementioned isolated circular nucleic acid molecule, the aforementioned construct; or expresses the aforementioned isolated protein or polypeptide. The recombinant cell according to embodiments of the present application can be used for in vitro expression and large-scale acquisition of the aforementioned protein or polypeptide.
[0012] In yet another aspect of the present application, the present application provides a use of a reagent for inhibiting the expression or activity of a circular nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO: 1 in the preparation of a medicament for preventing and / or treating cancer or tumor. The inventors have found through experiments that the aforementioned reagent can promote the apoptosis and death of cancer cells, and can effectively treat or prevent cancer or tumor.
[0013] In yet another aspect of the present application, the present application provides a use of a reagent for detecting a circular nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO: 1 in the preparation of a kit for detecting cancer or tumor. The inventors have found through experiments that the aforementioned circular nucleic acid molecule can be highly expressed in cancer cells, and thus the aforementioned reagent can be used to detect cancer or tumor by detecting the expression amount of the circular nucleic acid molecule in cancer cells.
[0014] In yet another aspect of the present application, the present application provides a pharmaceutical composition. According to embodiments of the present application, the pharmaceutical composition comprises a reagent for inhibiting the expression or activity of a circular nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO: 1. The inventors have found through a large number of experiments that the aforementioned pharmaceutical composition can effectively promote the apoptosis and death of lung cancer cells, for example, cancer; or, when culturing cells in vitro, the aforementioned pharmaceutical composition can be used to promote the apoptosis of cancer cells.
[0015] In yet another aspect of the present application, the present application provides a use of a pharmaceutical composition in the preparation of a medicament for preventing and / or treating cancer or tumor. As known from the foregoing, the CircCYB gene plays an important role in regulating the development of cancer. Thus, the aforementioned pharmaceutical composition comprises a reagent that can knock down the CircCYB gene in cancer cells, and thus can effectively treat or prevent cancer or tumor.
[0016] In yet another aspect of the present application, the present application provides a method for promoting apoptosis of cancer cells. According to an embodiment of the present application, the method comprises contacting the cancer cells with an agent for inhibiting expression or activity of a circular nucleic acid molecule, the cancer cells expressing the circular nucleic acid molecule having the nucleotide sequence set forth in SEQ ID NO: 1. The inventors have found through experiments that contacting the cancer cells with the agent described above can promote apoptosis of the cancer cells when the cancer cells are cultured in vitro.
[0017] In yet another aspect of the present application, the present application provides a method for screening a drug for treating or preventing cancer, the method comprising contacting the drug to be screened with cancer cells; and determining the target drug based on changes in the circular nucleic acid molecule having the nucleotide sequence set forth in SEQ ID NO: 1 in the cancer cells before and after the contacting. As known from the foregoing, the circular nucleic acid molecule described above can be highly expressed in cancer cells, and thus the method can be used for screening drugs by detecting the expression amount of the circular nucleic acid molecule in cancer cells and according to changes in the circular nucleic acid molecule.
[0018] Additional aspects and advantages of the present application will be in part apparent and in part pointed out hereinafter. BRIEF DESCRIPTION OF DRAWINGS
[0019] The above and / or additional aspects and advantages of the present application will become apparent and be readily appreciated from the following description, including the accompanying drawings, wherein:
[0020] is a column chart showing the presence of CircCYB in human H1 cells, GZF2-ipsc cells, and A549 and H1299 cells, as verified in Example 1 of the present application;
[0021] is a rectangular chart showing the presence of CircCYB, as verified by RNase R experiment in Example 2 of the present application;
[0022] is a column chart showing the relative RNA expression amount of human lung adenocarcinoma cancer and paracancerous tissue, and lung cancer cells and normal lung epithelial cells, as detected in Example 3 of the present application;
[0023] is a column chart showing the relative RNA expression amount of human lung adenocarcinoma A549 and H1299 cells constructed to knock down CircCYB, as detected in Example 4 of the present application;
[0024] is a graph showing the apoptosis detection result of human lung adenocarcinoma A549 and H1299 cells in which CircCYB is knocked down, as detected in Example 5 of the present application;
[0025] FIG. 7 is a graph showing the results of detecting apoptosis of human normal lung epithelial BEAS-2B cells after knocking down CircCYB according to an embodiment of the present application;
[0026] FIG. 8 is a graph showing the results of detecting the number of human lung adenocarcinoma A549 and H1299 cells after knocking down CircCYB according to an embodiment of the present application. DETAILED DESCRIPTION
[0027] Embodiments of the present application are described in detail below. The embodiments described below are exemplary only and are not to be construed as limiting the present application.
[0028] It should be noted that the terms "first", "second", etc. are used only for descriptive purposes and are not to be construed as indicating or implying relative importance or a specific order of the technical features indicated. Thus, features defined with "first", "second" etc. can explicitly or implicitly include one or more of the features. Further, in the description of the present application, the meaning of "a plurality of" is two or more unless otherwise specified.
[0029] In this document, the terms "comprising" or "including" are open-ended, that is, the inclusion of other elements is not precluded.
[0030] In this document, the terms "optionally", "optional" or "optional" generally mean that the subsequently described event or circumstance can or can not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.
[0031] In this document, the term "pharmaceutical composition" can refer to the treatment of a disease, but also to the in vitro culture experiment of cells. When used for the treatment of a disease, the term "pharmaceutical composition" generally refers to a unit dosage form and can be prepared by any one of the methods well known in the pharmaceutical art. All methods include the step of bringing the active ingredient into association with the auxiliary ingredient or ingredients that make up the carrier or carriers. In general, the compositions are prepared by uniformly and intimately bringing the active compound into association with a liquid auxiliary ingredient, a finely divided solid auxiliary ingredient, or both.
[0032] In this document, the term "pharmaceutically acceptable" means that the substance or composition must be chemically and / or toxicologically compatible with the other ingredients of the formulation and / or the mammal being treated therewith. Preferably, the "pharmaceutically acceptable" of the present application means approved by a federal regulatory agency or national government or listed in the U.S. Pharmacopoeia or other generally recognized pharmacopoeia for use in animals, especially humans.
[0033] In the present context, the term "pharmaceutically acceptable excipient" or "pharmaceutically acceptable carrier" can include any solvent, solid or other liquid excipient, etc., suitable for the particular target dosage form. Except insofar as any conventional excipient is incompatible with the compounds of the application, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of a pharmaceutically acceptable composition, its use is contemplated to be within the scope of this application.
[0034] Further pharmaceutically acceptable excipients mentioned herein and processes thereof can be found in the extensive literature on this subject, in particular in the Handbook of Pharmaceutical Excipients, 3rdedition, Arthur H. Kibbe, ed., American Pharmaceutical Association, Washington, USA and Pharmaceutical Press, London; and in the Lexikon der Hilfsstoffe fur Pharmazie, Kosmetik und angrenzende Gebiete, H.P. Fiedler, ed., 4thedition, Cantor, Aulendorf and earlier editions.
[0035] In the present context, the term "cancer" or "tumor" can be any unregulated cell growth. Exemplarily, it can be non-small cell lung cancer, papillary thyroid carcinoma, glioblastoma multiforme, colon cancer, rectal cancer, lung cancer, head and neck cancer, kidney cancer, bladder cancer, breast cancer, ovarian cancer, liver cancer, cholangiocarcinoma or sarcoma, acute myeloid leukemia, large cell neuroendocrine carcinoma, neuroblastoma, prostate cancer, neuroblastoma, pancreatic cancer, melanoma, head and neck squamous cell carcinoma, cervical cancer, skin cancer, glioma, esophageal cancer, oral squamous cell carcinoma or gastric cancer, etc.
[0036] In the present context, the term "treatment" refers to obtaining a desired pharmacological and / or physiologic effect. The effect can be prophylactic in terms of completely or partially preventing a disease or symptom thereof and / or can be therapeutic in terms of a partial or complete cure of a disease and / or adverse effect attributable to the disease. "Treatment" as used herein covers the treatment of a disease in a mammal, particularly in a human, and includes: (a) preventing the disease or condition from occurring in an individual which can be predisposed to the disease but has not yet developed the disease; (b) inhibiting the disease, i.e., arresting its development; or (c) relieving the disease, i.e., causing the partial or complete regression of the disease. "Treatment" as used herein covers any use of a drug or compound to treat, cure, relieve, alleviate, alter, improve, decrease, or inhibit a disease in an individual, including that of administering a drug containing a compound described herein to an individual in need thereof.
[0037] The present application provides an isolated circular nucleic acid molecule, an isolated protein or polypeptide, a construct, a recombinant cell, use of the isolated circular nucleic acid molecule, the isolated protein or polypeptide, the construct, the recombinant cell in the preparation of a medicament, a pharmaceutical composition and use thereof.
[0038] Isolated circular nucleic acid molecule, isolated protein or polypeptide, construct and recombinant cell
[0039] In one aspect of the present application, the present application provides an isolated circular nucleic acid molecule. According to an embodiment of the present application, the isolated circular nucleic acid molecule has the nucleotide sequence shown in SEQ ID NO: 1. The inventors have found through experiments that the isolated circular nucleic acid molecule (i.e. CircCYB) plays an important role in regulating the development of cancer.
[0040] It should be noted that the structure of the isolated circular nucleic acid molecule is a circular structure with the first end connected to the tail after transcription of the nucleotide sequence shown in SEQ ID NO: 1 and splicing.
[0041]
[0042] It should be noted that, for the nucleic acid molecules mentioned herein, the skilled person will understand that either one of the complementary double strands, or both, are actually included. For convenience, in the description and claims, although only one strand is given in most cases, the other complementary strand is actually disclosed. In addition, the nucleic acid sequences in the present application include DNA forms or RNA forms, and the disclosure of one means the disclosure of the other.
[0043] In another aspect of the present application, the present application provides an isolated protein or polypeptide. According to embodiments of the present application, the isolated protein or polypeptide is encoded by the aforementioned isolated circular nucleic acid molecule. Thus, the aforementioned isolated circular nucleic acid molecule can be used to encode the isolated protein or polypeptide.
[0044] In yet another aspect of the present application, the present application provides a construct. According to embodiments of the present application, the construct carries the aforementioned isolated circular nucleic acid molecule. The construct can be effectively used to express the aforementioned isolated protein or polypeptide, especially in prokaryotic or lower eukaryotic expression systems.
[0045] According to embodiments of the present application, the vector of the construct is a non-pathogenic viral vector.
[0046] According to embodiments of the present application, the vector of the construct is an adenoviral vector, a lentiviral vector, or a retroviral vector.
[0047] In yet another aspect of the present application, the present application provides a recombinant cell. According to embodiments of the present application, the recombinant cell carries the aforementioned isolated circular nucleic acid molecule, the aforementioned construct; or expresses the aforementioned isolated protein or polypeptide. The recombinant cell according to embodiments of the present application can be used for in vitro expression and large-scale acquisition of the aforementioned protein or polypeptide.
[0048] Use
[0049] In yet another aspect of the present application, the present application provides a use of an agent for the preparation of a medicament for preventing and / or treating cancer or tumor, wherein the agent is used to inhibit the expression or activity of a circular nucleic acid molecule having the nucleotide sequence as shown in SEQ ID NO: 1. The inventors have found through experiments that the use of the aforementioned agent can promote the apoptosis and death of cancer cells, and can effectively treat or prevent cancer or tumor.
[0050] According to embodiments of the present application, the agent comprises at least one of shRNA, siRNA, and CRISPR / Cas9 for knocking down the circular nucleic acid molecule. As known from the foregoing, the CircCYB gene plays an important role in regulating cancer development. Thus, the CircCYB gene in cancer cells can be knocked down by using the above-mentioned agent, thereby effectively treating or preventing cancer or tumor.
[0051] In the present application, the terms "siRNA", "Small interfering RNA", "short interfering RNA", and "silencing RNA" all refer to a double-stranded RNA that mainly participates in the phenomenon of RNA interference (RNAi) to regulate the expression of genes in a specific manner. It should be noted that, in the case of knowing the CircCYB gene of the present application, siRNA can be obtained by using conventional methods in the art. The obtained siRNA is cloned into an expression vector, and by introducing the expression vector into a host cell, the CircCYB gene can be knocked down.
[0052] In the present application, the terms "shRNA" and "short hairpin RNA" both refer to a hairpin structure composed of two short inverted repeat sequences separated by a loop sequence, which is controlled by a pol III promoter, followed by 5-6 T as a transcription terminator of RNA polymerase III. It should be noted that, in the case of knowing the CircCYB gene of the present application, shRNA can be obtained by using conventional methods in the art. The obtained shRNA is cloned into an expression vector, and by introducing the expression vector into a host cell, the CircCYB gene can be knocked down.
[0053] In the present application, the term "CRISPR / Cas9 vector" comprises a gene encoding Cas9 protein and a gene encoding gRNA (or sgRNA), which can be located on the same vector or on two vectors respectively. By introducing the CRISPR / Cas9 vector into a host cell, the CircCYB gene can be knocked down. It should be noted that, in the case of knowing the CircCYB gene of the present application, gRNA (or sgRNA) can be obtained by using conventional methods in the art.
[0054] Exemplarily, the host cell can be a cancer cell or a cancer cell line, for example, the cancer cell line is A549 and H1299 cells.
[0055] According to embodiments of the present application, the agent comprises a nucleotide sequence as shown in SEQ ID NO: 2.
[0056] ACCAACTAACCCCCTAATA (SEQ ID NO: 2).
[0057] According to embodiments of the present application, the cancer includes lung cancer, non-small cell lung cancer, papillary thyroid cancer, glioblastoma multiforme, colon cancer, rectal cancer, head and neck cancer, kidney cancer, bladder cancer, breast cancer, ovarian cancer, liver cancer, cholangiocarcinoma or sarcoma, acute myeloid leukemia, large cell neuroendocrine carcinoma, neuroblastoma, prostate cancer, neuroblastoma, pancreatic cancer, melanoma, head and neck squamous cell carcinoma, cervical cancer, skin cancer, glioma, esophageal cancer, oral squamous cell carcinoma, or gastric cancer.
[0058] In yet another aspect of the present application, the present application provides a use of a reagent in the preparation of a kit, the reagent being used for detecting a circular nucleic acid molecule having a nucleotide sequence as set forth in SEQ ID NO: 1, the kit being used for detecting a cancer or a tumor. The inventors have found through experiments that the circular nucleic acid molecule described above can be highly expressed in cancer cells, and thus the reagent described above can be used for detecting a cancer or a tumor by detecting the expression amount of the circular nucleic acid molecule in the cancer cells.
[0059] According to embodiments of the present application, the reagent includes a probe, a primer or an antibody selected from binding to the circular nucleic acid molecule.
[0060] According to embodiments of the present application, the cancer includes lung cancer, non-small cell lung cancer, papillary thyroid cancer, glioblastoma multiforme, colon cancer, rectal cancer, head and neck cancer, kidney cancer, bladder cancer, breast cancer, ovarian cancer, liver cancer, cholangiocarcinoma or sarcoma, acute myeloid leukemia, large cell neuroendocrine carcinoma, neuroblastoma, prostate cancer, neuroblastoma, pancreatic cancer, melanoma, head and neck squamous cell carcinoma, cervical cancer, skin cancer, glioma, esophageal cancer, oral squamous cell carcinoma, or gastric cancer.
[0061] Pharmaceutical composition and use thereof
[0062] In yet another aspect of the present application, the present application provides a pharmaceutical composition. According to embodiments of the present application, the pharmaceutical composition includes a reagent inhibiting the expression or activity of a circular nucleic acid molecule having a nucleotide sequence as set forth in SEQ ID NO: 1. The inventors have found through a large number of experiments that the pharmaceutical composition described above can effectively promote the apoptosis and death of lung cancer cells, for example, cancer; or, when culturing cells in vitro, the pharmaceutical composition described above is used to promote the apoptosis of cancer cells.
[0063] According to embodiments of the present application, the pharmaceutical composition further includes a pharmaceutically acceptable excipient.
[0064] According to an embodiment of the present application, the agent comprises at least one of shRNA, siRNA and CRISPR / Cas9 for knocking down the circular nucleic acid molecule.
[0065] According to an embodiment of the present application, the agent comprises a nucleotide sequence as shown in SEQ ID NO: 2.
[0066] In another aspect of the present application, the present application provides a use of a pharmaceutical composition in the preparation of a medicament for preventing and / or treating cancer or tumor. As known from the foregoing, the CircCYB gene plays an important role in regulating the development of cancer. Therefore, the above-mentioned pharmaceutical composition comprises an agent capable of knocking down the CircCYB gene in cancer cells, thereby effectively treating or preventing cancer or tumor.
[0067] According to an embodiment of the present application, the cancer comprises lung cancer, non-small cell lung cancer, papillary thyroid cancer, glioblastoma multiforme, colon cancer, rectal cancer, head and neck cancer, kidney cancer, bladder cancer, breast cancer, ovarian cancer, liver cancer, cholangiocarcinoma or sarcoma, acute myeloid leukemia, large cell neuroendocrine carcinoma, neuroblastoma, prostate cancer, neuroblastoma, pancreatic cancer, melanoma, head and neck squamous cell carcinoma, cervical cancer, skin cancer, glioma, esophageal cancer, oral squamous cell carcinoma or gastric cancer.
[0068] Method
[0069] In another aspect of the present application, the present application provides a method for promoting apoptosis of cancer cells. According to an embodiment of the present application, the method comprises: contacting the cancer cells with an agent for inhibiting the expression or activity of a circular nucleic acid molecule, the cancer cells expressing the circular nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO: 1. The inventors have found through experiments that when culturing cancer cells in vitro, contacting the cancer cells with the above-mentioned agent can promote apoptosis of the cancer cells.
[0070] According to an embodiment of the present application, the agent comprises at least one of shRNA, siRNA and CRISPR / Cas9 for knocking down the circular nucleic acid molecule.
[0071] According to an embodiment of the present application, the agent comprises a nucleotide sequence as shown in SEQ ID NO: 2.
[0072] It should be noted that the cancer cells in the present application include cancer cells in the body and can also include cancer cell lines, and the specific type is not limited.
[0073] Exemplarily, the cancer cell line is A549 and H1299 cells.
[0074] In yet another aspect of the present application, the present application provides a method for preventing and / or treating cancer or tumor. According to embodiments of the present application, the method comprises administering to a subject a pharmaceutically acceptable amount of the aforementioned pharmaceutical composition. The method of the present application can be effective in preventing and / or treating cancer or tumor.
[0075] The effective amount of the pharmaceutical composition of the present application can vary depending on the mode of administration and the severity of the disease to be treated, etc. The selection of the preferred effective amount can be determined by one of ordinary skill in the art (e.g., through clinical trials) according to various factors. The factors include, but are not limited to, the pharmacokinetic parameters of the active ingredient, such as bioavailability, metabolism, half-life, etc.; the severity of the disease to be treated in the patient, the weight of the patient, the immune status of the patient, the route of administration, etc. For example, several divided doses can be administered daily, or the dose can be proportionally reduced as indicated by the exigencies of the therapeutic situation.
[0076] The pharmaceutical composition of the present application can be incorporated into a medicament suitable for parenteral administration (e.g., intravenous, subcutaneous, intraperitoneal, intramuscular). These medicaments can be prepared in various forms. For example, liquid, semi-solid, and solid dosage forms, etc., including but not limited to liquid solutions (e.g., injection solutions and infusion solutions) or lyophilized powders. The typical medicament is in the form of an injection solution or an infusion solution. The aforementioned pharmaceutical composition can be administered by intravenous infusion or injection or intramuscular or subcutaneous injection.
[0077] According to embodiments of the present application, the cancer includes lung cancer, non-small cell lung cancer, papillary thyroid cancer, glioblastoma multiforme, colon cancer, rectal cancer, head and neck cancer, kidney cancer, bladder cancer, breast cancer, ovarian cancer, liver cancer, cholangiocarcinoma or sarcoma, acute myeloid leukemia, large cell neuroendocrine carcinoma, neuroblastoma, prostate cancer, neuroblastoma, pancreatic cancer, melanoma, head and neck squamous cell carcinoma, cervical cancer, skin cancer, glioma, esophageal cancer, oral squamous cell carcinoma, or gastric cancer.
[0078] In yet another aspect of the present application, the present application provides a method for screening a drug for treating or preventing cancer, the method comprising: contacting a drug to be screened with a cancer cell; and determining a target drug based on the change in the expression or activity of the circular nucleic acid molecule having the nucleotide sequence set forth in SEQ ID NO: 1 in the cancer cell before and after the contacting. As known from the foregoing, the aforementioned circular nucleic acid molecule can be highly expressed in cancer cells, and thus the method can be used for screening drugs by detecting the expression amount of the circular nucleic acid molecule in cancer cells, and according to the change in the circular nucleic acid molecule.
[0079] According to embodiments of the present application, the decrease in the expression or activity of the circular nucleic acid molecule in the cancer cell after the contacting is an indication that the drug to be screened is the target drug.
[0080] The solutions of the present application will be explained below in connection with examples. Those skilled in the art will understand that the examples below are only for illustrating the present application and should not be considered as limiting the scope of the present application. If a specific technique or condition is not mentioned in the examples, it is performed according to the technique or condition described in the literature in the art or according to the product manual. If the manufacturer of a reagent or instrument is not mentioned, it is a conventional product that can be obtained commercially.
[0081] Example 1: PCR experiment and Sanger sequencing to verify the presence of CircCYB
[0082] In this example, the inventors selected human H1 cells (human embryonic stem cells), GZF2-ipsc cells (human induced pluripotent stem cells), A549 and H1299 cells (human lung adenocarcinoma cells, also known as human lung adenocarcinoma A549 and H1299 cells) for verification. The inventors extracted the RNA of the above three cell lines, performed reverse transcription using the Promega Reverse Transcription System kit, and finally obtained cDNA. Reverse-splicing PCR primers were designed at the interface sequence of CircCYB (forward primer: AGCATTGGACAGTAGCAT (SEQ ID NO: 5); reverse primer: GAGCCGAAGTTTCATCAT (SEQ ID NO: 6)), and PCR experiments were performed (according to the KOD DNA polymerase kit, the PCR reaction conditions were 94°C, 2 min→ 94°C, 15 sec→ 58°C, 30 sec→ 68°C, 20 s→ 68°C, 5 min, 35 cycles) to obtain the PCR product. The PCR product was subjected to agarose gel electrophoresis, and the band of about 250 bp was cut and subjected to Sanger sequencing to verify the presence of the reverse-splicing sequence of CircCYB, and the results are shown in The results show that CircCYB exists in the above three cells.
[0083] Example 2: RNase R experiment to verify the presence of CircCYB
[0084] RNase R is a kind of RNA enzyme that can specifically degrade linear RNA. RNase R can digest most linear RNA under the condition of constant temperature 37℃ for 30 min, while circular RNA can resist the digestion of RNase R. Therefore, the inventors selected human H1 cells (human embryonic stem cells), GZF2-ipsc cells (human induced pluripotent stem cells), A549 and H1299 cells (human lung adenocarcinoma cells) in Example 1 to perform RNase R digestion experiment to verify the presence of CircCYB in the cells. The specific steps are as follows:
[0085] After extracting the RNA of the above cell strains (the specific extraction method is the same as that of Example 1), the inventors took two 2 μg RNAs, one of which was treated with RNase R (i.e. the experimental group), and the other was added with the same volume of nuclease-free water as the control (i.e. the control group). After treatment at constant temperature 37℃ for 30 min, the two groups of RNA were reverse transcribed using random primers (the specific extraction method is the same as that of Example 1). The cDNA was obtained. β-actin was used as a representative of linear RNA, and the quantitative real-time PCR primers of β-actin and CircCYB were designed (β-actin-F: TGACGTGGACATCCGCAAAG (SEQ ID NO: 7), β-actin-R: CTGGAAGGTGGACAGCGAGG (SEQ ID NO: 8);
[0086] CircCYB-F: TCACAACAATCCTAATCCTAATAC (SEQ ID NO: 9), CircCYB-R: CATGCGGAGATGTTGGAT (SEQ ID NO: 10)). Finally, the presence or absence of RNase R and the digestion of RNase R on β-actin and CircCYB were detected by quantitative real-time PCR experiment. The experimental system was 20 μL total volume, and the kit was qPCR and RT-qPCR Systems (qPCR). The results are shown in It was found that CircCYB could resist the digestion of RNase R, further proving the existence of CircCYB.
[0087] Example 3: Expression of CircCYB in cancer-adjacent tissues and human lung adenocarcinoma cells
[0088] 1. The inventors rapidly frozen human lung adenocarcinoma tissue and its adjacent normal tissue (adjacent normal tissue refers to tissue within 2 cm of the lesion, with the same cell type as lung cancer tissue, but without cancerous transformation) collected from the hospital in liquid nitrogen, and ground it in a mortar. The resulting tissue powder was transferred to a 1.5 mL centrifuge tube, followed by the addition of 1 mL of Trizol solution. The mixture was repeatedly pipetted until the powder was digested, then 400 μL of chloroform solution was added and mixed thoroughly. After standing at room temperature for 5 min, the mixture was centrifuged at 12000 × g and 4 °C for 15 min. After centrifugation, 400 μL of the colorless supernatant was carefully transferred to a new 1.5 mL centrifuge tube, and an equal volume of isopropanol solution was added and gently inverted several times to mix. After standing on ice for 10 min, the mixture was centrifuged at 12000 × g and 4 °C for 10 min, and the supernatant was removed. Add 1 mL of 70% ethanol solution prepared with nuclease-free water to the precipitate, shake to wash the precipitate, and then centrifuge at 12000×g, 4℃ for 5 min. After removing the supernatant, add 50 μL of nuclease-free water to dissolve the precipitate, take 2 μg of RNA for reverse transcription, and perform the detection of CircCYB content in human lung adenocarcinoma tissue and adjacent normal tissue (the specific method is the same as the qPCR detection of CircCYB in Example 2). The results are as follows. As shown in the left figure, the results showed that CircCYB was expressed at a higher level in human lung adenocarcinoma tissue compared to adjacent normal tissue.
[0089] 2. The inventors detected the content of CircCYB in normal lung epithelial cells (BEAS-2B) and human lung adenocarcinoma cell lines A549 and H1299, respectively. The specific detection method is described in step 1 of this embodiment. The results are as follows: As shown in the right figure, the results indicate that CircCYB is expressed at a higher level in human lung adenocarcinoma cells compared to normal lung epithelial cells.
[0090] Example 4: Construction of human lung adenocarcinoma cell lines A549 and H1299 with CircCYB knockdown
[0091] Using the pLKO.1-puro lentiviral vector backbone plasmid, shRNA expressing the target site sequence ACCAACTAACCCCCTAATA (SEQ ID NO:2) (named shCircCYB, used for CircCYB knockdown) and shRNA expressing the sequence CCTAAGGTTAAGTCGCCCTCG (SEQ ID NO:3) (used for Scramble knockdown) (named shScramble, used as a negative control) were constructed. These plasmids were then combined with two lentiviral packaging vectors, pMD2g and psPAX2, to package lentivirus in 293T cells. The specific steps are as follows:
[0092] In the experiment, the engineering cell line 293T cells were used for packaging retroviruses. First, a 293T cell was resuscitated in a 10 cm diameter dish, cultured with DMEM complete medium (DMEM high glucose medium + 10% NTC fetal bovine serum + 100 x MEM Non-Essential Amino Acid Solution + 100 x GlutMax additive), and then subcultured. When the 293T cells in the 100 mm cell culture dish grew to 80%, the fresh culture medium (i.e. DMEM complete medium, as below) was replaced. In 1 mL of Opti-MEM (GIBICO, Cat No: 31985070), 6 μg of psPAX2, 2 μg of PMD2g and 8 μg of pLKO.1 were added in the ratio of 6:2:8, incubated for 5 minutes, 4 times the volume of PEI transfection reagent was added, mixed and incubated for 12 minutes, and then added to the above 293T cells. After 12 hours of culture, the fresh culture medium was replaced, and after 36 hours, the entire culture medium was collected, filtered with a 0.45 μm filter to remove 293T cells in the virus solution, and the first batch of virus infection solution was supplemented with fresh DMEM complete medium to 10 mL. The 293T cells in the collected culture medium were supplemented with fresh culture medium, and after 12 hours, the same method was used to collect the second batch of 10 mL of virus infection solution. A total of 24 mL of virus infection solution was obtained and added with Polybrene (10 mg / mL, 10000 x, to promote virus infection of 293T cells). Then 4 mL of virus infection solution was used to infect A549 and H1299 cells, and fresh DMEM complete medium was replaced every day. After 72 hours of culture, the A549 cells and H1299 cells were collected and subjected to RNA extraction and reverse transcription (the specific steps are the same as in Example 1), and finally the knockdown efficiency of human lung adenocarcinoma A549 and H1299 cells was verified by quantitative real-time PCR (the specific steps are the same as in Example 2), and the results are shown in
[0093] The results show that, compared with the negative control shScramble, the shCircCYB can effectively knock down CircCYB in human lung adenocarcinoma cells A549 and H1299, without affecting the transcription of the linear parent gene MT-CYTB (i.e. LinCYTB) (qPCR forward primer: TTTCGCCCACTAAGCCAATC (SEQ ID NO: 11); reverse primer: GCCCATTTGAGTATTTTGTTT (SEQ ID NO: 12)), indicating that the human lung adenocarcinoma cells A549 and H1299 with knockdown of CircCYB have been constructed.
[0094] Example 5: Knockdown of CircCYB can significantly promote the apoptosis of human lung adenocarcinoma cells A549 and H1299
[0095] Apoptosis detection of the 4th day human lung adenocarcinoma cells A549 and H1299 with knockdown of CircCYB was performed by using the apoptosis kit product (product number C1062L) of Biyun Tian Company. According to the requirements of the kit, after the adherent cells were washed with DPBS solution, trypsin (0.25%) reagent without EDTA was added to digest the cells at room temperature. After 2 min, an equal amount of DMEM complete medium was added to terminate the digestion and transferred to a 15 mL centrifuge tube. After centrifugation at 300 x g for 3 min, the supernatant was removed, and the cells were gently resuspended and washed with an appropriate amount of DPBS. After centrifugation at 300 x g for 3 min again, the supernatant was removed to obtain the cell pellet. Annexin V-FITC staining working solution (containing 195 μL Annexin V-FITC binding solution and 5 μL Annexin V-FITC probe solution) was added to the cell pellet, and the cells were gently mixed and incubated at room temperature for 20 min in the dark. During the incubation process, the cells were resuspended twice to improve the staining effect. After the staining was completed, the centrifuge tube was placed in an ice bath and immediately subjected to flow cytometry detection. The detection results are shown in . The results showed that, compared with the control cells (A549 and H1299 constructed with shScramble), knockdown of CircCYB could significantly promote the apoptosis rate of human lung adenocarcinoma cells A549 and H1299.
[0096] Example 6: Knockdown of CircCYB cannot induce apoptosis of normal lung epithelial cells
[0097] In order to further detect whether knockdown of CircCYB affects the survival of normal lung epithelial cells, the experimenters constructed a cell strain of normal lung epithelial cells BEAS-2B with knockdown of CircCYB (the specific steps are the same as those in Example 4), and further performed apoptosis detection (the specific steps are the same as those in Example 5). The results are shown in . The results showed that knockdown of CircCYB in normal lung epithelial cells did not induce apoptosis of normal lung epithelial cells, indicating that knockdown of CircCYB could target lung adenocarcinoma cells to undergo apoptosis without affecting the survival of normal lung epithelial cells. Therefore, it can be further indicated that CircCYB in the present application is expected to become a new target for treating lung adenocarcinoma.
[0098] Example 7: Knockdown of CircCYB can significantly inhibit the survival of human lung adenocarcinoma cells A549 and H1299
[0099] In order to further explore the survival rate of human lung adenocarcinoma cells A549 and H1299 after knocking down CircCYB, the inventors performed continuous cell survival detection and recording on human lung adenocarcinoma cells A549 and H1299 in which CircCYB was knocked down in Example 5. First, the cells infected with shScramble and shCircCYB viruses for 2.5 days were digested and counted, 50,000 cells were planted in a 12-well plate, and the number of cells was counted and the state of cells was recorded continuously for 3 days. The results are shown in The results show that knocking down CircCYB can significantly inhibit the survival of human lung adenocarcinoma cells A549 and H1299 over time, and achieve the effect of basically killing lung adenocarcinoma cells.
[0100] In the description of the present specification, the description of the terms "one embodiment", "some embodiments", "an example", "a specific example", or "some examples" and the like means that the specific features, structures, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present application. In the present specification, the illustrative description of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any appropriate manner in any one or more embodiments or examples. In addition, different embodiments or examples described in the present specification and the features of different embodiments or examples can be combined and combined by those skilled in the art without contradiction.
[0101] Although the embodiments of the present application have been shown and described above, it can be understood that the above embodiments are exemplary and cannot be understood as limiting the present application, and those skilled in the art can make changes, modifications, replacements and variations to the above embodiments within the scope of the present application.
Claims
1. Use of an agent for inhibiting expression or activity of a circular nucleic acid molecule having a nucleotide sequence as set forth in SEQ ID NO: 1 in the manufacture of a medicament for treating lung cancer. The nucleotide sequence of the agent is as set forth in SEQ ID NO:
2.
2. A pharmaceutical composition, characterized by, Comprising: An agent for inhibiting expression or activity of a circular nucleic acid molecule having a nucleotide sequence as set forth in SEQ ID NO:
1. The nucleotide sequence of the agent is as set forth in SEQ ID NO:
2.
3. The pharmaceutical composition of claim 2, wherein, Further comprising: A pharmaceutically acceptable excipient.
4. Use of the pharmaceutical composition of any one of claims 2-3 in the manufacture of a medicament for treating lung cancer.
5. A method for promoting apoptosis of cancer cells in vitro for non-diagnostic and therapeutic purposes, characterized by, Comprising: Contacting the cancer cell with an agent for inhibiting expression or activity of a circular nucleic acid molecule having a nucleotide sequence as set forth in SEQ ID NO: 1, the cancer cell expressing the circular nucleic acid molecule; The nucleotide sequence of the agent is as set forth in SEQ ID NO:
2.
6. A method of screening a medicament for treating lung cancer, comprising: Contacting the cancer cell with an agent for inhibiting expression or activity of a circular nucleic acid molecule having a nucleotide sequence as set forth in SEQ ID NO: 1, the cancer cell expressing the circular nucleic acid molecule; The nucleotide sequence of the agent is as set forth in SEQ ID NO:
2.
6. A method of screening a medicament for treating lung cancer, comprising: Contacting the cancer cell with an agent for inhibiting expression or activity of a circular nucleic acid molecule having a nucleotide sequence as set forth in SEQ ID NO: 1, the cancer cell expressing the circular nucleic acid molecule; The nucleotide sequence of the agent is as set forth in SEQ ID NO:
2.
6. A method of screening a medicament for treating lung cancer, comprising: Contacting the cancer cell with an agent for inhibiting expression or activity of a circular nucleic acid molecule having a nucleotide sequence as set forth in SEQ ID NO: 1, the cancer cell expressing the circular nucleic acid molecule; The nucleotide sequence of the agent is as set forth in SEQ ID NO:
2.
6. A method of screening a medicament for treating lung cancer, comprising: Contacting the cancer cell with an agent for inhibiting expression or activity of a circular nucleic acid molecule having a nucleotide sequence as set forth in SEQ ID NO: 1, the cancer cell expressing the circular nucleic acid molecule; The nucleotide sequence of the agent is as set forth in SEQ ID NO:
2.
6. A method of screening a medicament for treating lung cancer, comprising: Contacting the cancer cell with an agent for inhibiting expression or activity of a circular nucleic acid molecule having a nucleotide sequence as set forth in SEQ ID NO: 1, the cancer cell expressing the circular nucleic acid molecule; The nucleotide sequence of the agent is as set forth in SEQ ID NO: 2.