Recombinant virus-like nanoparticles for immunotherapy of gastric cancer and uses thereof
By preparing recombinant virus-like nanoparticles and combining them with a fusion protein of hepatitis B virus core protein and CLDN18.2 tight junction protein, the immunotherapy effect of gastric cancer was enhanced, solving the problem of poor immunotherapy effect in existing technologies and achieving strong anti-tumor effect and immune memory.
Patent Information
- Application Number
- CN202310313030.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-28
- Publication Date
- 2026-02-17
- Estimated Expiration
- 2043-03-28
AI Technical Summary
Existing immunotherapy methods have limited effectiveness in treating gastric cancer, especially in terms of recurrence and drug resistance, and lack effective tumor-specific antigen targets and means to enhance immune responses.
Recombinant virus-like nanoparticles were prepared using genetic engineering technology. Chimeric recombinant protein nanoparticles were formed by the self-assembly of the fusion protein HBC-CLDN18.2, which is a fusion protein of hepatitis B virus core protein and CLDN18.2 tight linker. These nanoparticles enhanced humoral and cellular immune responses against gastric cancer. The original T1 and T2 epitopes were replaced by mouse-derived T1 and T2 to enhance the immune effect.
Animal studies have shown strong anti-tumor and immune memory effects, enhanced immune responses to gastric cancer, and provided a new immunotherapy approach.
Smart Images

Figure BDA0004149981490000201 
Figure BDA0004149981490000202 
Figure HDA0004149981500000011
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a kind of recombinant virus-like nanoparticles and its application, in particular to a kind of recombinant protein nanoparticles for immunotherapy of gastric cancer and its application.The present application belongs to the field of medicine. BACKGROUND
[0002] Gastric cancer is an adenocarcinoma, about 1 million new cases of gastric cancer worldwide each year, despite the progress of treatment, but gastric cancer recurrence and treatment resistance still often occur.Gastric cancer 5-year survival rate is about 5-20%, and the overall survival of patients with advanced gastric cancer is about 10 months.This cancer needs to be treated with a variety of immunotherapy methods, one of which is immunotherapy, including tumor vaccine, immune checkpoint inhibitors, chimeric antigen receptor T cells.
[0003] Tumor-specific antigens are targeted for oncology, with limited low expression in normal tissues, CLDN 18.2 is a tight junction protein molecule, which is a potential tumor-associated antigen, and is a tight junction protein gene family encoding a four-transmembrane protein, at least 27 tight junction members have been found, showing complex tissue-specific expression.CLDN18.2 is not expressed in normal stomach, and is strictly limited to differentiated epithelial cells in gastric mucosa, so human CLDN18.2 is significantly expressed in primary gastric cancer and its metastatic lesions, pancreatic adenoma and esophageal adenoma.Hepatitis B virus surface antigen HBcAg can self-assemble into virus-like particles, and hepatitis B core antigen can be used as a delivery carrier for some short peptides to deliver Th and B cell epitopes to the immune system.Virus-like particles contain 180 or 240 copies of polypeptide, with a diameter of about 27 nm.Structural studies show that amino acid residues 68-90 protrude on the surface of the particle as e1 ring, which can be inserted into the extracellular domain of the first loop of tight junction protein CLDN 18.2, enhancing the antibody production of virus-like nanoparticles against gastric cancer.Naturally, the core antigen contains a repeated arginine sequence at the C-terminus, which often contains nucleic acid impurities.The use of genetic engineering methods to delete the C-terminus causes instability of the particle structure.In order to maintain the stability of the particle and overcome the particle encapsulation of nucleic acid impurities, the present application generates a clone that deletes arginine while retaining the C-terminal cysteine, to enhance the formation and stability of assembled virus-like particles.Meanwhile, homologous recombination is performed on the T epitope of the core antigen to replace the original T1 and T2 epitopes with murine T1 and T2, to enhance the cellular immune response against gastric cancer. SUMMARY
[0004] The present application aims to provide a kind of recombinant virus-like nanoparticles for immunotherapy of gastric cancer and its application.
[0005] In order to achieve the above-mentioned purpose, the present application adopts the following technical means:
[0006] The application discloses a recombinant virus-like nanoparticle for immunotherapy of gastric cancer, wherein the recombinant virus-like nanoparticle is a chimeric recombinant protein nanoparticle self-assembled by a fusion protein HBC-CLDN18.2 of hepatitis B virus core protein and CLDN18.2 tight junction protein, and an amino acid sequence of the HBC-CLD18.2 fusion protein is shown as SEQ ID NO. 2.
[0007] Preferably, the diameter of the nanoparticle is 25-40 nm, preferably 30 nm or 35 nm.
[0008] Further, the application also provides a polynucleotide encoding the fusion protein HBC-CLDN18.2 for self-assembling the recombinant protein nanoparticle.
[0009] Further, the application also provides a cloning and expression vector containing the polynucleotide, and a host cell containing the expression vector.
[0010] Preferably, the host cell is an anti-gastric cancer recombinant protein nanoparticle engineering bacteria containing the expression vector, named as XL2021-520, classified as Escherichia coli, and preserved in the Institute of Microbiology, Chinese Academy of Sciences, No. 1, Yabian West Road, Chaoyang District, Beijing, with a microbial preservation number of CGMCC NO: 22586 and a preservation time of May 24, 2021.
[0011] Further, the application also provides an application of the recombinant protein nanoparticle in preparation of a gastric cancer immunotherapy drug.
[0012] Preferably, the drug is an injection drug.
[0013] Compared with the prior art, the application has the following beneficial effects:
[0014] The present application truncates the C-terminal of natural hepatitis B virus core antigen by genetic engineering technology, mutates the 48th and 107th cysteine residues to serine, so that it can self-assemble into stable virus-like nanoparticles, and uses the stable truncated virus-like nanoparticles as a carrier, inserts the B cell epitope peptide (tight junction protein CLDN18.2) of the tumor-specific antigen of gastric cancer into the immunodominant position of the carrier to enhance the humoral immune response against gastric cancer, and simultaneously performs homologous recombination substitution in the T epitope of the core antigen, replaces the original T1 and T2 epitopes with the T1 and T2 of the murine hepatitis B virus core antigen, and enhances the cellular immune response against gastric cancer. In animal experiments, it shows strong anti-tumor effect and immune memory effect. The present application provides a new technical means for immunotherapy of gastric cancer. BRIEF DESCRIPTION OF DRAWINGS
[0015] Figure 1 Vector map of plasmid pCBS220 for cloning;
[0016] Figure 2 Transmission electron microscopy of recombinant virus-like nanoparticles;
[0017] Figure 3 CLDN18.2 antibody induced by XL2021-520;
[0018] Figure 4 HBc antibody induced by XL2021-520;
[0019] Figure 5 Tumor-free mice;
[0020] Figure 6 Gastric cancer cell growth;
[0021] Figure 7 Immune memory of immunoprotected mice after tumor challenge again;
[0022] Figure 8 Tumor-free mice after tumor challenge again;
[0023] Figure 9 Concentration of XL2021-520 in blood. DETAILED DESCRIPTION
[0024] The present application will be further described below in conjunction with specific examples, and the advantages and characteristics of the present application will become clearer with the description. However, the examples are only exemplary and do not constitute any limitation on the scope of the present application. Those skilled in the art should understand that the details and forms of the technical solutions of the present application can be modified or replaced without departing from the spirit and scope of the present application, and such modifications and replacements all fall within the protection scope of the present application.
[0025] Example 1. Construction of recombinant protein nanocarrier with enhanced stability (construction of chimeric HBc149 and HBc149+C)
[0026] 1.1 Cloning of recombinant protein carrier
[0027] Human HBc cDNA (1-183) sequence was cloned from serum into plasmid pCBS220 (vector map as shown in Figure 1 p20 HBc (1-183) was named after the addition of Ncol restriction enzyme site at the multiple cloning site of the plasmid by PCR. The PCR reaction conditions for subsequent examples were as follows: Step 1, 94°C for 30 minutes; Step 2, 94°C for 1 minute; Step 3, 50°C for 30 minutes; Step 4, 72°C for 1 minute; Step 5, 94°C for 13 minutes; Step 6, 72°C for 5 minutes; Step 7, 4°C for 10 minutes. The template p2019-HBc (1-183) concentration was 0.1 microgram, the primers were synthesized by Jin Sui Company and used at a concentration of 1 μM, the polymerase and restriction enzyme were purchased from NEB Company, and the DNA sequence of each chimera was confirmed by sequencing instrument U2000, and the plasmid extraction used Qiagen Company's medium kit.
[0028] 1.2 Construction of recombinant protein carrier with improved stability
[0029] p20 HBc (1-183) was used as a template for PCR reaction with primer 1, 5'-GGT GCA TGC AAG GAG ATG-3', and primer 2, 5' GCG AAG CTT CGG ATC CCA TGG TTT TTT CCT CCT TAT-3'. The reaction product was digested with Sphl and Hindlll, purified by 1.25% agarose electrophoresis, extracted with QIAEX II gel system, and the PCR product was ligated with the large fragment of p20-HBc (1-183) digested with Sphl and Hindlll and transformed into HB101 to obtain a vector in which the multiple cloning site was deleted and only the primer 2 and Ncol-EcoRI-Hindlll sequence remained. This vector was named p20 HBc (1-183).
[0030] The p20 HBc (1-183) was used as a template, primer 3, Hind III-R 5'-GTGAAATTGTTATCCGCTC-3', primer 4, Nco I-F 5'-TTGGGCCATGGACATCGACCCTTA-3' were added to perform PCR reaction, the plasmid p20 HBc (1-183) and the PCR product were digested with Nco I and Hind III, purified by 1.25% agarose electrophoresis, extracted by QIAEX II gel system, the large fragment of the plasmid was ligated with the about 450bp fragment of the PCR product, and then transformed into E. coli DH5α to obtain a clone with Nco I-Hind III enzyme cutting sites at both ends and a stop codon at 150th position, which was named p20-1 HBc (1-150).
[0031] The p20-1-HBc (1-150) was used as a template, primer 5, Nco I-F 5'-TTGGGCCATGGACATCGACCCTTA-3' and primer 6, C-Hind III-R 5'-CGCAAGCTTACTAGCAAACAACAGTAGTCTCGGAA-3' were added to perform PCR reaction, the template p20-1 HBc (1-150) and the PCR product were digested with Nco I and Hind III, purified by 1.25% agarose electrophoresis, extracted by QIAEX II gel system, the large fragment of the template was ligated with the about 450bp fragment of the PCR product, and then transformed into JM103 to obtain a clone HBc149+C with Nco I-Hind III enzyme cutting sites at both ends and a cysteine inserted at V149th position and a stop codon, and the plasmid containing the clone was named p20-1 HBc (1-150+C).
[0032] A 165 bp 5' end fragment was generated by PCR using p20-1 HBc (1-150+C) as template, primer 7, Ncol-F-5'GGGCC ATG GAC ATC GAC CCT TA-3', primer 8, 5'-GAG GC AGT ATG GTG AGG TGA GCT ATG CTC AGG AGA CTC-3'. A 295 bp 3' end fragment was generated by PCR using p20-1 HBc (1-150+C) as template, primer 9, Hhal-F-5'-GAG GCG CTC AGG CAA GCA ATT CTT T T-3', primer 10, Hindlll-R 5'-CGC AAG CTT AAA CAA CAG T AGT CTC CGG AAG-3', and digested with Hhal, ligated, transformed into JM103 bacteria, positive clones were selected and confirmed by sequencing. The plasmid containing the clone was named p20-2 HBc (1-150+C). The positive clone was cultured to extract plasmid p20-2 HBc (1-150+C), and primers 11, Ncol-F-5'-GGGCC ATG GAC ATC GAC CCT TA-3', primer 12, Hindlll-R-5'-CGC AAG CTT AAA CAA CAG T AGT CTC CGG AAG-3', were used to generate a 450 bp fragment by PCR, and the above cloning steps were added with a stop codon after S150. The plasmid containing the clone was named p20.3-HBc (1-150+Z).
[0033] The plasmid p20.3-HBc (1-150+Z) and the QuickChange XL site-directed mutagenesis kit (Stratagene) were used to synthesize primers, and the 7th lysine codon AAA was replaced with the arginine codon CGC, the 97th lysine codon was replaced with CGC, the 48th and 107th cysteine codons (TGT) were replaced with the tryptophan codon TCT, and a lysine codon was inserted between HBc gene L76 and E77. The above PCR conditions were used to mutate and clone the four sites, and the second mutation and cloning were performed on the basis of the first cloning and sequencing.
[0034] Site 7 forward primer:
[0035] K7R-Forward-CCATGGACATCGACCCTTATCGCGAATTTGGAGCTACTGTGGAG
[0036] Site 7 reverse primer:
[0037] K7R-Rerverse-CTCCACAGTAGCTCCAAATTCGCGATAAGGGTCGATGTC-CATGG
[0038] 97K97R-Forward-CACTAATATGGGCCTAAGGTTCAGGCAACTCTTGTGGS
[0039] 97K97R-Reverse-CTCTAGACGCTGGATCTTCTTTCAAATTAACACCCACCCAGGS
[0040] K97R-Reverse-CCACAAGAGTTGCCTGAACCTTAGGCCCATATTAGTG
[0041] 48K48S-Forward-GCCTTAGAGTCTCCTGAGCATTGTTCACCTCACCATACTG C
[0042] C48S-Forward-GCCTTAGAGTCTCCTGAGCATTGTTCACCTCACCATACTG C
[0043] 48K48S-Reverse-GCAGTATGGTGAGGTGAAGAATGCTCAGGAGACTCTAAGGC
[0044] C48S-Reverse-GCAGTATGGTGAGGTGAAGAATGCTCAGGAGACTCTAAGGC
[0045] 107K107S-Forward-GGCAACTCTTGTGGTTTCACATTTCTTGTCTCACTTTTGGAA GAG
[0046] C107S-Forward-GGCAACTCTTGTGGTTTCACATTTCTTGTCTCACTTTTGGAA GAG
[0047] 107K107S-Reverse-CTCTTCCAAAAGTGAGAGAAGAAATGTGAAACCACAAGAG TTGCC
[0048] C107S-Reverse-CTCTTCCAAAAGTGAGAGAAGAAATGTGAAACCACAAGAG TTGCC
[0049] K77-Forward-CCTGGGTGGGTGTTAATTTGAAAGAAGATCCAGCGTCTAGAG
[0050] K77-Forward-CCTGGGTGGGTGTTAATTTGAAAGAAGATCCAGCGTCTAGAG
[0051] K77-Reverse-CTCTAGACGCTGGATCTTCTTTCAAATTAACACCCACCCAGGS
[0052] K77-Reverse-CTCTAGACGCTGGATCTTCTTTCAAATTAACACCCACCCAGGS
[0053] The following were obtained by cloning, sequencing, mutation, and insertion: lysine at position 7 and 97 was replaced by arginine for subsequent insertion of T cell epitope peptide, lysine between L76 and E77 of the HBc gene was mutated to arginine for insertion of B cell epitope peptide in the immunodominant epitope, cysteine at position 48 and 107 was replaced by tryptophan, the clone was sequenced, and the plasmid containing the clone was designated p20.3-HBc150(C48S / C107S+C).
[0054] The lysine codon at position 97 was replaced by CGC, and the cysteine codons (TGT) at position 48 and 107 were replaced by tryptophan codon TCT, respectively. One lysine codon was inserted between L76 and E77 of the HBc gene after the arginine codon CGC was replaced, the lysine codon at position 97 was replaced by CGC, and the cysteine codons (TGT) at position 48 and 107 were replaced by tryptophan codon TCT, respectively, to obtain p20.2-HBc149(C48S / C107S). One lysine codon was inserted between L76 and E77 of the HBc gene after the cysteine, and the plasmid containing the clone was designated p20.2 HBc149.
[0055] Example 2. Construction of recombinant protein nanoparticle carrier for enhancing anti-tumor immune response
[0056] 2.1 Construction of recombinant nanoparticle carrier for enhancing anti-tumor humoral immune response
[0057] To insert the Claudin-18.2 epitope peptide between position 78 aspartate and position 96 of p20.2 HBc149, unique restriction enzyme cutting sites Sal I and Spel I were introduced, so that the inserted epitope peptide has valine and aspartate (VD) at the 5' end (Sall restriction enzyme cutting site sequence), threonine and serine TS at the 3' end (Spell restriction enzyme cutting site), and is separated by di-alanine in the middle.
[0058] PCR amplification was performed using the following three pairs of primers as templates for p20.2-HBc149(C48S / C107S), resulting in a 249 bp fragment (N-terminal) and a 243 bp fragment (C-terminal). The N-terminal was cut with Nco I and Sal I, the C-terminal was cut with Spel and Hind III, and was ligated to the large fragment cut with Nco I and Hind III of plasmid p19.2-HBc149(C48S / C107S) to clone p19.2-HBc149(C48S / C107S), which was designated p20.3-HBc149(C48S / C107S).
[0059] Primer 13: HBc149 / Nco I-F 5'-TTGGG CCATGGACATCGACCCTTA
[0060] Primer 14: HBc-E77 / EcoRI-R 5'-GCGGAATTCCTTCCAAATTAACACCCACC-3'
[0061] Primer 15: HBc-D78 / EcoRI-SacI-F 5'-CGCGAATTCAAAAAGAGCTCGATCCAGCGTCTAGAGAC-3' (Sal I-AA-Spe I)
[0062] Primer 16: HBc149 / HindIII-R 5'-CGCAAGCTTAAACAACAGTAGTCTCCGGAA-3'
[0063] Primer 17: HBc149 / NcoI-F 5'-TTGGGCCATGGACATCGACCCTTA-3'
[0064] Primer 18: HBc-D78 / EcoRI-R 5'-GCGGAATTCCATCTTCCAAATTAACACCCAC-3' (Sall replaced)
[0065] Primer 19: HBc-P79 / EcoRI-SacI-F 5'-CGCGAATTCAAAAAGAGCTCCCAGCGTCTAGAGACCTAG-3' (Sall-AA-replaced)
[0066] Primer 20: HBc149 / HindIII-R 5'-CGCAAGCTTAAACAACAGTAGTCTCCGGAAG-3'
[0067] A peptide consisting of 10-13 amino acids of the extracellular domain of CLDN18.2 was selected, its nucleotide sequence was synthesized and inserted into the position of the sequence 78-100 of HBc149 (C48S / C107S). The linker sequence GGSGG, the tight junction extracellular domain peptide, abbreviated as CLDN18.2.EC1, has the sequence TEDEVQSYPSKHDYV (15 aa), the linker-epitope peptide 1-linker sequence GGSG-TEDEVQSYPSKHDYV-GSGG, the obtained clone is called p20.3-HBc149 (C48S / C107S+C+GLDN18.2B), abbreviated as p-HBc149-18.2.
[0068] 2.2 Enhancement of anti-tumor cell immune response Recombinant nanoparticle carrier construction
[0069] To enhance the cellular immune response of the vector to human tumors, the T cell epitope peptide Tl consisting of 10 amino acids at positions 18-27 of the core antigen of the woodchuck hepatitis B virus was selected, the nucleotide sequence of Tl being acattgctct ccgcaccatacagctataca, and the corresponding amino acid sequence being TLLSAPYSYT.
[0070] The T cell epitope peptide T2 consisting of 17 amino acids at positions 120-139 of the core antigen of the woodchuck hepatitis B virus, the nucleotide sequence of T2 being:
[0071] aagaattttta gtaagttttg gagtatggat caggactcct ccatatagac c, and the corresponding amino acid sequence being NIALRTIQLLDKLYAGM
[0072] NIALRTIQLLDKLYAGM
[0073] To fuse the T2 cell epitope to the HBc chimera at positions 120-137, unique Sall and Spell restriction sites were inserted between the cysteine-149 and the Hind III restriction site, and the synthesized Tl was inserted between the Sall-Hind III (or Sall-Spell) restriction sites, the following primer pair with the Ncol restriction site was used to amplify HBc 149-18.2. The primer pair with the Sall, Spell and Hind III restriction sites was used to amplify the C-terminal end of the p-HBc 149-18.2 gene, the product of the PCR reaction was about 479 bp, and was cleaved with Ncol / Hind III and cloned into a plasmid, which was designated p20.4-HBc 149-18.2.
[0074] The Sall-T2 cell epitope peptide-Spell double-stranded DNA with Sall-Spell restriction sites at both ends was ligated to the large fragment of p20.4-HBc 149-18.2 cleaved with Sall and Spell, transformed, and clones were selected and sequenced, and the clone with the T2 cell epitope inserted at the C-terminal end was correct in sequence, and the plasmid was designated p20.5-HBc 149-18.2-T2.
[0075] Construction of a clone containing the Tl cell epitope at the N-terminal end
[0076] The primer of T1 epitope peptide carrying NcoI / SacI restriction sites was artificially synthesized with p20.5-HBc149-18.2-T2 as a template, and PCR amplification reaction was performed to obtain T cell epitope peptide T11-110 fragment containing EcoRI and SacI restriction sites. The EcoRI and SacI enzyme digestion was performed, and the enzyme digestion of the large fragment of p20.1-HBc149-18.2-T2 was connected. The positive plasmid obtained was called p20.6-T1-HBc149-18.2-T2 (the full sequence of the plasmid is shown as SEQ ID NO. 1), and the positive clone obtained by transforming E. coli / DH 5α was called p20.6-T1-HBc149-18.2-T2 / DH 5α.
[0077] HBc149 / NcoI-F: 5'-TTGGGCCATGGACATCGACCCTTA-3'
[0078] HBc149 / SacI-EcoRI-H3-R: 5'-CGCAAGCTTAGAGCTCTTGAATTC-3'
[0079] Spell and Sall restriction enzyme site primer: 5'-CAACAACAGTAGTCTCCG-3'
[0080] HBc149 / SacI-EcoRI-H3-R: 5'-CGCAAGCTTAGAGCTCTTGAATTCCAACAACAGTAGTCTCCG-3'
[0081] HBc-P79 / SacI-F: 5'-CGCGAGCTCCCAGCGTCTAGAGACCTAG-3'
[0082] p-3 / R: 5'-GTATCAGGCTGAAAATC-3'
[0083] N-terminal primer sequence (NcoI restriction site):
[0084] HBc149 / NcoI-F 5'-TTGGGCCATGGACATCGACCCTTA-3'
[0085] (HindIII): HBc156 (E.cR)-H3-R: 5'-GCGAAGCTTACTAAGGGGAGCGGCCTCGTCG-ACGAACAACAGTAGTCTCC GG-3'
[0086] HBc149 / HindIII-R: 5'-CGCAAGCTTAAACAACAGTAGTCTCCGGAAG-3'
[0087] HBc149+C / HindIII-R: 5'-CGCAAGCTTACTAGCAAACAACAGTAGTCTCCGGAAG-3'
[0088] The plasmid p20.6-T1-HBc149-18.2-T2 was used as a template for synthesis of an XbaI and NheI primer, and a PCR reaction was performed. The reaction product was digested with XbaI and NheI, and the plasmid pET19b was digested with XbaI and NheI to obtain a large fragment. The fragments were subjected to a ligation reaction, and E. coli BL-21 was transformed. The plasmid was referred to as PET-19-HBc-Claudin18.2, and the obtained engineering bacteria PET-19-HBc-Claudin18.2 / BL-21. The anti-gastric cancer recombinant protein nanoparticle engineering bacteria provided by the application is named XL2021-520 strain, and is preserved in the China General Microbiological Culture Collection Center, located at No. 1, Yihuangyuan, Beichenxilu, Chaoyang District, Beijing, China, and the microbial preservation number is CGMCC NO: 22586, and the preservation time is May 24, 2021.
[0089] Example 3. Preparation of a recombinant virus-like nanoparticle
[0090] The XL2021-520 strain culture solution was spread on an LB plate containing 50 mg / L ampicillin, and a positive clone was picked and inoculated into 5 mL of LB culture medium containing 50 mg / L ampicillin and incubated at 37°C for 16-18 hours. The culture was inoculated into 15 L of 2xTYP (supplemented with 3.47 g of KH2PO4 and 18.8 g of K2HPO4 / L, pH 7.4) at a ratio of 1:100, and the culture was rotated at 37°C. When the OD600 of the culture reached 0.6-1.0, 25 μM of IPTG was added, and the culture was incubated for 4-5 hours. The bacterial cells were harvested by centrifugation at 15,000 x g for 10 minutes, and the bacterial cells were stored at -20°C for later use.
[0091] The bacterial cells were removed, thawed on ice and resuspended in 4 volumes of lysis buffer (50 mM Tris-HCl, pH 8.0, 5 mM EDTA, 0.5 mM PMSF, 150 mM NaCl, 0.1 % Triton X100, 5 mM DTT) and disrupted by three cycles of pressure at 20,000 psi using a French press. The lysis buffer was clarified by centrifugation at 10,000 rpm (13,000 x g) for 30 min at 4°C. The supernatant was incubated with 0.5 M urea and DNase I (125 μg / mL) for 30 min at 4°C. The lysis buffer was clarified by centrifugation at 10,000 rpm (13,000 x g) for 30 min at 4°C. The supernatant was incubated with 35% saturated ammonium sulfate for 1 h at 4°C. The precipitate was dissolved in PBS (containing 0.5 M urea, 0.5 mM PMSF, 0.1 % Triton X100, 5 mM DTT) and clarified by centrifugation at 10,000 rpm (13,000 x g) for 30 min at 4°C. The sample was applied to a Sepharose 4FF column (volume 320 mL) and the eluate was applied to a Fractogel DEAE(M) column (volume 60 mL) equilibrated in PBS / 5 mM DTT. The virus-like particles were eluted with 1 M KCl.
[0092] The eluate was pooled, filtered through a 0.45 μM filter and applied to a Mono Q.HR 10 / 100 ion exchange column (equilibrated in 25 mM Tris-HCl and 0.02% sodium azide) and washed with 25 mM Tris-HCl. The protein was eluted with a linear gradient of 0-3 M NaCl in 25 mM Tris-HCl. The pooled peak fractions were precipitated by the addition of saturated ammonium sulfate (1 :1) and stirred gently for 60 min at 4°C. The precipitate was pelleted by centrifugation at 17,500 x g for 30 min. The supernatant was discarded and the pellet was resuspended in 20 mL of 20 mM sodium phosphate, pH 6.8 and transferred to a dialysis tube (8,000 dalton molecular weight cut-off). The protein was dialyzed against 20 L of 20 mM sodium phosphate, pH 6.8 overnight. The dialysate was filtered through a 0.45 μM filter. The purified protein was stored at 4°C for up to 24 h before lyophilization. The amino acid sequence of the recombinant protein XL2021-520 obtained is shown in SEQ ID NO. 2.
[0093] Example 4 Properties of the recombinant virus-like nanoparticles
[0094] 4.1 Detection of the native conformation of the preparation stock by two methods using analytical size exclusion, the Ellman test
[0095] To assess whether the E. coli XL2021-520 expression product exists as a particle or non-particle, purified protein samples were analyzed by analytical size exclusion chromatography, each sample containing 50-90 μg of protein was injected into a Superose 6 HR 10 / 30 column (GE) attached to an HPLC (BioCad) or Akta Purifier (GE). 20 mM sodium phosphate (pH 6.8) was pumped into the flow through bed column at 0.5 mL / min. The integrity of the particle was assessed by observing the elution profile: one peak appeared at approximately 7 mL of elution indicating intact particles, followed by peaks of non-particle structures such as dimers and monomers.
[0096] 4.2 Disulfide bond formation assay: samples were diluted to 1 mg / mL in 20 mM sodium phosphate (pH 6.8, 0.1% SDS) and Ellman's (purchased from Sigma) reagent was diluted to 200 mM with dimethyl sulfoxide and the recombinant protein stock was diluted 1:200 in 20 mM sodium phosphate (pH 6.8) to a final concentration of 0.1 mM and incubated at room temperature for 15 minutes. The plate was read in a spectrometer at 412 nm for color analysis, no disulfide bonds resulted in a yellow color and complete disulfide bonds appeared colorless.
[0097] 4.3 Non-reducing and reducing SDS-PAGE gel to detect disulfide bond induced monomer, dimer cross-linking and monomer integrity.
[0098] All SDS-PAGE gels were run using the NuPAGE system purchased from Invitrogen. 10% Bis-Tris 1.5 mm x 10 well gels were run using MES buffer, samples were added to LDS buffer and 10% beta-mercaptoethanol was added to a final concentration and heated at 50°C for 10 minutes. The gels were run at 200 V for 30 minutes and stained using SimplyBlue SafeStain (purchased from Invitrogen,) Non-reducing samples cross-linking occurs without monomeric and dimeric state, large molecular weight proteins form a visible spike at the top of the gel. Monomeric is one band with a molecular weight of approximately 17 kDa. .TM.
[0099] Gel filtration analysis: A 5 mL Superose 6 HR 10 / 30 column (GE #17-0537-01) and a BioCAD SPRINT diffusion chromatography system were used with the UV detector set to monitor 280 nm wavelength. The column was equilibrated with 3 CV (approximately 75 mL) of 20 mM NaP04(pH 6.8) buffer at a flow rate of 0.50 mL / min. The sample to be analyzed was diluted to 1 mg / mL with 20 mM NaP04(pH 6.8) buffer and 200 microliters was loaded into a 200 microliter loop and injected into the column. Elution was performed with 20 mM NaP04(pH 6.8) buffer at a flow rate of 0.50 mL / min.
[0100] 4.4 Structural analysis methods
[0101] Samples were negatively stained and observed by transmission electron microscopy. Particle concentration was determined by nanoparticle tracking analysis using a NanoSight LM-10 (Malvern Instruments Ltd., Worcestershire, UK).
[0102] Virus-like particle average diameter and homogeneity was analyzed by dynamic light scattering (DLS) at 25°C. Purified VLPs were diluted 1 : 100 in PBS and measured 5 times using intensity to calculate size distribution. Virus-like particle sample homogeneity was determined by polydispersity index (PDI). The instrument used was a Zetasizer Nano ZS (Malvern Instruments Ltd, UK) and intensity, volume parameter histograms were plotted using the software.
[0103] Virus-like particle sample total protein concentration was determined using Quickstart Bradford dye reagent (Bio-Rad, 5000201) and a bovine serum albumin standard curve.
[0104] The tight junction protein 18.2 content in VLP samples was determined using a quantitative ELISA.
[0105] Specifically, 96 well plates were coated with different virus-like particles and recombinant human claudin 18.2 overnight at 4°C, blocking solution (0.1% Tween 20 (PBS-T) and 0.3% BSA) was added for 1 hour at room temperature, claudin was stained with 5 pg / mL Trastuzumab (purchased from BioVision Milpitas) for 1 hour at room temperature, 1 :2000 diluted horseradish peroxidase anti-human IgG antibody was added for 1 hour at room temperature, plates were washed 6 times with PBS-T, 100 microliters of TMB (purchased from Invitrogen) was added per well, 100 pL of 2N H2SO4was added per well, and the OD450 optical density value was read on a microplate reader, and a claudin concentration curve was established using Excell software. The relative claudin concentration can be determined by the absorbance value and the apparent relationship of the claudin standard. The optical density was detected using a WPA BioWave S2100 instrument (Biochrom Ltd., UK), and 0.71 mg of HBc protein corresponds to 1 optical absorption unit.
[0106] Natural Agarose Gel Electrophoresis System (NAGE) from Invitrogen), 0.7% agarose (dissolved in TAE buffer (40 mM Tris, 20 mM acetic acid, 1 mM EDTA), 1 microliter of bromoethidium was added per 1 milliliter, 60 micrograms of Coomassie Brilliant Blue-250 (dissolved in 10% acetic acid), pH-adjusted liquid: 0.1 M sodium acetate / acetic acid (pH 5.3), 0.1 M K2PO4 / NaOH (pH 6.5), 0.1 M K2PO4 / NaOH (pH 7.5), TAE pH (8.3), 0.025 M Na2B4O7x 10 H2O / HCl (pH 9.0) Protein was separated by Tris-glycine-SDS system 15% SDS-PAGE gel, and analyzed by Coomassie Brilliant Blue or silver staining method according to standard operation.
[0107] 4.5 Physico-chemical stability:
[0108] Low concentration, reassembled, purified samples obtained were stored in low ionic strength buffer, for analysis of the stabilizing effect of the remaining disulfide bonds of the capsid protein dimers, 100 mM DTT was added. The first purified VLPs were dialyzed with Tris-buffer (50 mM; pH 7.5), 0.275 pg / pL of dialyzed VLP solution was taken for dot blot or NAGE analysis. For urea pressure reaction analysis, fresh 10 M urea was prepared, and the urea and nanoparticle sample were adjusted to the final required concentration with Tris-buffer, and incubated at room temperature for 24 hours.
[0109] 4.6 Thermal stability test:
[0110] Samples were incubated at different temperatures (4°C, room temperature, 37°C) for a period of time, and samples were collected at 0, 3, 7, 14 days for evaluation using the method 4.3 above. Purified protein particles were diluted to 0.5-1 mg / mL in 50 mM NaP04(pH 6.8) and incubated at different temperatures (4°C, room temperature, 37°C), and samples were collected at 0, 3, 7, 14 days and mixed with SDS-PAGE sample buffer (reducing) and run on 10% SDS-PAGE gels (SimplyBlue SafeStain (Invitrogen) and analyzed. Temperature tests were performed on a PCR machine set to the temperature for 15 minutes, and particle samples were tested 5 hours after storage at 4°C. Freeze / thaw cycles were performed by quick freezing in liquid nitrogen and melting in a 25°C water bath for the number of cycles indicated.
[0111] SDS test: samples were incubated in SDS-Tris buffer for 20 minutes at the given concentration (w / v) and then subjected to shaking stress in a thermomixer (Eppendorf) set to 25°C, 1.200 rpm and time.
[0112] pH stability: samples were dialyzed against different pH buffers overnight, and the pH of the buffer was checked. The pH of the buffer was not allowed to vary more than ±0.2, and the volume of the dialysis buffer was 150 times the volume of the sample. The dialysis was performed at least three times. Dithiothreitol (DTT) was added 5 minutes before the test.
[0113] Native agarose gel electrophoresis (NAGE), dot blot, immunoblot, dynamic light scattering (DLS) were performed on 2.6% agarose gels prepared according to the standardized instrument to ensure uniform, smooth, flat, and even thickness. Each well was loaded with 7 μg of each viral-like particle sample, and the gel was run at 4°C and 50 V for 13 ± 1 h using TAE buffer. The gel was stained with fresh PageBlue Coomassie staining solution (Thermo) for 30 minutes and destained with distilled water overnight to obtain a uniform background gel. The apparent relationship between XL2021-520 and carrier protein band density / quantity was calculated to be R2≥0.98, representing 0-8.5 μg of protein, with a maximum error of ±3% between batches (n=3).
[0114] Chemical stability:
[0115] Chemical stress condition test: XL2021-520 nm microspheres and carrier HBC (1-150, C48S, C107S) microspheres samples were tested under chemical stress conditions, and the integrity of the recombinant capsid protein was analyzed independently by NAGE, DLS, and dot blotting. Dot blotting mainly relies on mAb3120 to detect the discontinuous epitope on the surface of the nanometer microspheres. The absence of reduction or dot blotting signal indicates any epitope modification or mutation, or the inability to bind to the antibody or the particle capsid, or the inability to bind to the membrane. Based on the liquid dynamic diameter of macromolecules in solution detected by DLS, the changes in the capsid protein of the nanometer microspheres and the carrier microspheres can be deduced: the average molecular weight of all solutions is proportional to the grating intensity, mainly determined by the largest and most components. DLS is highly sensitive to large agglomerates. In NAGE, the capsid protein presents a distinct protein band, and if the protein is aggregated or disaggregated, it presents a fuzzy, signal intensity decreased or completely no signal band.
[0116] Comparative dot blot analysis: 0.27 μg of recombinant particles and 0.54 μg of carrier VLP were dotted on a nitrocellulose membrane (purchased from Merck Company), the membrane was blocked at room temperature for 1 hour, HBcAg particle specific monoclonal antibody (mAb3120; purchased from Tokyo Institute of Immunology, Japan) was added at a ratio of 1:10000, washed at room temperature for 1 hour, incubated at room temperature for 1 hour, and then incubated with species-specific horseradish peroxidase IgG secondary antibody (purchased from Kewei Biological). The membrane was washed three times, and then incubated with enhanced luminescence color developing solution (purchased from Hot Electric Company), and finally the file was created and the signal was analyzed on the luminescence image (ImageQuant LAS 4000, GE Company).
[0117] NuPAGE separation sample immunoblotting: After separation of the sample, the transfected and blocked PVDF membrane was incubated with HBcAg N-terminal, C-terminal, and tight junction 18.2 monoclonal antibodies at room temperature for 1 hour, and then the secondary antibody was added for incubation. The signal detection was performed as in the dot blotting analysis.
[0118] Dynamic light scattering (DLS) was used to detect the distribution of different virus-like particles at the nanometer level. The instrument used was Nicomp 380 DLS system (PSS Nicomp), which was operated according to the standard detection procedure. Specifically, a capillary tube containing 200 μL of LVP sample with a concentration of 0.5 mg / mL was incubated at 25°C for 1 hour, and the particle hydrodynamic average diameter and sufficient dispersion intensity were plotted.
[0119] XL2021-520 and carrier HBC (1-150, C48S, C107S) purified samples were quantified and pressure analyzed on at least 4-10 gels stained with Coomassie Brilliant Blue. Semi-quantification was performed with gels stained with colloidal Coomassie Brilliant Blue and quantified with a high resolution image scanning system (Microtek ScanMaker i800) and evaluation software ImageQuant TL version 7.0 (GE Healthcare). To ensure compatibility, the complete NAGE procedure (gel casting, loading, separation, staining, destaining, scanning) was standardized. Symmetrical, uniformly stained background gels were quantified that allowed clear separation of T=3- / T=4- pairs. The signal intensity (volume values) of each protein band, untreated reference and background intensity were subtracted on the same gel and expressed as mean values and standard error.
[0120] Thermal stability test: Temperature test was performed on a PCR machine set to heat for 15 minutes, and the particle samples were tested 5 hours after storage at 4°C. Freeze / thaw cycles were performed by quick freezing in liquid nitrogen and thawing in a 25°C water bath for the set number of cycles.
[0121] SDS test: Samples were incubated in SDS-Tris buffer for 20 minutes at the given concentration (w / v) and then tested. Shaking pressure was performed on a thermomixer (Eppendorf) set to 25°C, 1.200 rpm and time.
[0122] pH stability: Nanoparticle samples were dialyzed against different pH buffers overnight, the pH of the buffer was checked, the pH of the buffer was not allowed to vary more than ±0.2, the volume of the dialysis buffer was 150 times the volume of the sample, and the dialysis was performed at least three times. Dithiothreitol (DTT) was added 5 minutes before testing.
[0123] Native agarose gel electrophoresis (NAGE), dot blot, immunoblot, dynamic light scattering (DLS) were performed according to standardized instruments. 2.6% agarose gels were prepared to ensure uniform, smooth, flat, and even thickness. Each well was loaded with 7 μg of each virus-like particle sample, and the gel was run at 4°C and 50 V for 13±1 h using TAE buffer. The gel was stained with fresh PageBlue colloidal Coomassie (Thermo) for 30 minutes and destained with distilled water overnight to obtain a uniform background gel. The linear relationship between the density of the XL2021-520 and carrier protein bands was calculated to be R2≥0.98, representing 0-8.5 μg of protein, with a maximum error of ±3% between batches (n=3).
[0124] Comparative dot blot analysis: 0.27 pg of recombinant particles and 0.54 pg of carrier VLPs were dotted on nitrocellulose membranes (purchased from Merck), membranes were blocked for 1 h at room temperature, HBcAg particle specific mAb (mAb 3120; purchased from Immunological Laboratories, Tokyo, Japan) was added at 1 : 10,000 for 1 h at room temperature, secondary species specific horseradish peroxidase IgG antibody (purchased from Kowa Biological Products) was added for 1 h at room temperature, incubation, repeated washing three times, and enhanced chemiluminescence substrate (purchased from Thermo) was added for 1 h at room temperature, and luminescence imaging (ImageQuant LAS 4000, GE) was performed for documentation and signal analysis.
[0125] Native electrophoretic separation sample immunoblotting: After separation of the sample, the PVDF membrane was transferred, blocked, and incubated with HBcAg N- and C-terminal and ZO-1 18.2 mAb for 1 h at room temperature, secondary antibody was added for incubation, and signal detection was performed as described for the dot blot analysis.
[0126] Dynamic light scattering (DLS) was used to detect the distribution of different virus-like particles at the nanometer level. The instrument used was a Nicomp 380 DLS system (PSS Nicomp) according to the standard detection procedure, specifically: a capillary containing 200 pL of a 0.5 mg / mL VLP sample was incubated for 1 h at 25 °C, and the particle hydrodynamic mean diameter and sufficient dispersion strength were plotted.
[0127] XL2021-520 and carrier HBC (1-150, C48S, C107S) purified VLP samples were subjected to native agarose gel density analysis using at least 4-10 gels for quantification and pressure analysis. Semi-quantification was performed using colloidal Coomassie blue staining of protein bands, using a high-resolution image scanning system (Microtek ScanMaker i800) and evaluation software ImageQuant TL version 7.0 (GE Healthcare). To ensure compatibility, the complete NAGE procedure (gel casting, loading, separation, staining, destaining, scanning) was standardized. Gels that allowed clear separation of T=3- / T=4- symmetric, uniformly stained background gels were quantified. The signal intensity (volume values) of the untreated reference and each protein band on the same gel was subtracted from the background intensity, and the mean and standard error were determined.
[0128] Molecular exclusion chromatography elution peak analysis showed that four of the five predicted cysteine residues were successfully assembled into particles, and that mutation of C48 and C107 did not affect particle assembly, including HBc149, HBc149(C48S / C107S), HBc149+C, and HBc149(C48S / C107S)+C, with HBc149(C48S / C107S)+C being preferred as a carrier for particle formation.
[0129] Further, all expressed particles were calculated yield after purification, relative to the original HBc149 vector, and the yield was still high after insertion of the extracellular domain peptide of the tight junction protein, the heterologous T-cell epitope peptide Tl, the heterologous T-cell epitope peptide T2 in the immunodominant site, revealing that these mutations and heterologous sequences did not have a great impact on the assembly of the particles.
[0130] From the above analysis, it can be determined that about 2 mg of protein is needed for the complete analysis of each chimera. In most cases, the maximum is 50 AU (half-purified protein 25 mg), which also indirectly indicates that the E. coli system has a large production of recombinant protein nanoparticles per unit volume.
[0131] The formation of disulfide bonds in peptides and proteins varies with time, temperature,
[0132] Purified recombinant protein sample analysis size exclusion chromatography analysis: there is no difference in the purification profile after two weeks at 4°C, and the integrity of the particles is not different. After 0, 3, 7, 14 days at 37°C, the particles are still intact. Further cross-linking analysis with non-reducing SDS-PAGE gel shows that the disulfide bond is not complete in most samples at 4°C for zero days. Room temperature enhances disulfide bond formation, and also increases the formation of higher-order multimers. The disulfide bond is completely formed after 7 days at 37°C.
[0133] Non-reducing SDS-PAGE gel analysis shows that there is no significant change in the density of monomers during the stability study, showing that all monomers are in the native state. This can be confirmed by comparing the sample analysis of 0, 14 days at 37°C. More importantly, it is confirmed that monomers and dimers are not degradation products under non-reducing conditions. The presence or absence of free sulfhydryl groups in the recombinant protein was detected during the stability test. Although free sulfhydryl groups react with Ellman's reagent, sulfhydryl groups involved in disulfide bonds do not react with Ellman's reagent. These results show that the presence of free sulfhydryl groups decreases with time and accelerates with increasing temperature. The control samples containing wild-type C48, C107 mutations show the presence of free sulfhydryl groups in all time and temperature experiments, confirming that these cysteine residues are mostly in the reduced state, and the samples in which cysteine is mutated to serine remove the possibility of disulfide bond formation. Obviously, all C48S / C107S epitope-carrying samples and wild-type samples are similar, indicating that these mutations have no effect on the assembly of the particles. Further, the stability of the selected XL2021-520 is demonstrated. The transmission electron microscopy image shows that the recombinant virus-like nanoparticles have a concentration range of 6-8 x 10 Figure 2 11 Particles / mL, diameter 20-400 nm, 65% - 82% of total particles, the mass of the particles was detected by dynamic light scattering (DLS), between 0.1-0.2, the average diameter of all particles was 30 ± 5 nm, the yield of recombinant protein was 69.70 μg / mL, and the purity was > 90%. The VLPs purified by T = 4 or T = 3 particle uniformity were different in the moving distance of SDS-PAGE and NAGE. Immunoblot analysis with monoclonal antibodies highly specific to the N and C termini of HBC can form bands containing constituent amino acids.
[0134] In this example, XL2021-520 recombinant virus-like nanospheres and carrier HBC (1-150, C48S, C107S) particles are both T = 3- and T = 4-symmetrical virus-like particles (VLPs). The XL2021-520 recombinant protein nanospheres and the carrier can be quantitatively analyzed by semi-quantitative NAGE density method, and the T = 3- and T = 4-symmetry of the XL2021-520 nanospheres and the carrier HBC (1-150, C48S, C107S) capsid protein can be quantitatively evaluated and identified.
[0135] When the sample is treated with urea, detergent, non-ionic protein denaturant, the stability of the nanosphere particles is affected in a urea concentration-dependent manner, and XL2021-520 is significantly more resistant to urea than the carrier nanospheres. The icosahedral structure of the two nanospheres is reduced in the presence of DTT, and further, T = 3 particles are more easily dissociated than T = 4 particles in the presence of low-concentration urea. Similarly, XL2021-520 and the carrier nanospheres are more easily dissociated in T = 3 particles than in T = 4 particles under suitable alkaline pH conditions, and the T4 particles of XL2021-520 are more stable than the T4 particles of the carrier. The same results can also be observed by dot blot analysis. The monoclonal antibody binding to the capsid protein is less detectable under alkaline pH conditions than under alkaline pH, urea, SDS treatment conditions. This indicates that alkaline pH has less impact on the stability of the particles. In an alkaline condition, the presence of DTT has little effect on the integrity of XL2021-520 and carrier particles. DLS testing shows that under acidic pH conditions, the particles precipitate at the isoelectric point and the diameter increases. In summary, all the analysis of chemical stress parameters can affect the stability of the particles. In urea and SDS tests, the stability of the DTT-treated particle sample is low. T3 particles are less stable than T4 particles.
[0136] In summary, the comparison of XL2021-520 nanospheres and carrier nanospheres HBC (1-150, C48S, C107S) shows high chemical stability, and the capsid protein is modified by cysteine mutation, N-terminal chimeric, C-terminal chimeric, and immunodominant epitope chimeric modification: XL2021-520 nanosphere particles and HBC (1-150, C48S, C107S) carrier particles T = 4 > T = 3.
[0137] Chemical stability:
[0138] XL2021-520 nanoscale microparticle and carrier HBC(1-150, C48S, C107S) microparticle samples were subjected to chemical stress conditions and analyzed independently for integrity of the recombinant capsid protein by NAGE, DLS, and dot blot. Dot blotting relies primarily on the detection of the discontinuous conformational epitope on the nanoscale microparticle by mAb 3120, and the absence of a signal by reduction or dot blotting reveals any modification of the epitope, either by inability of the antibody to bind, or by inability to bind the particle capsid to the membrane. DLS, based on the measurement of the hydrodynamic diameter of macromolecules in solution, can infer changes in the capsid protein of the nanoscale microparticle and carrier microparticle: the average molecular weight of all solutions is proportional to the intensity of the light scattered, and is primarily determined by the largest and most abundant component. DLS is highly sensitive to large aggregates. NAGE, the capsid protein presents a sharp staining protein band, and particle aggregation or disaggregation presents a band that is fuzzy, with reduced signal intensity or no signal at all. In this case, XL2021-520 recombinant protein nanoscale microparticles and carrier HBC(1-150, C48S, C107S) are T=3- and T=4- symmetric HBcAg-VLPs. Semi-quantitative NAGE density allows quantification of XL2021-520 recombinant protein nanoscale microparticles and carrier, and also allows quantitative assessment and differentiation of XL2021-520 microparticles and carrier microparticles HBC(1-150, C48S, C107S) capsid protein T=3-, T=4- symmetry. When the microparticles are treated with urea, detergent, non-ionic protein denaturant, the microparticle particle stability is affected in a urea concentration-dependent manner, and XL2021-520 is significantly more resistant to the effects of urea than the carrier microparticle. The icosahedral symmetry of both microparticles is reduced in the presence of DTT, and further, T=3 particles are more susceptible to dissociation than T=4 particles in the presence of low concentrations of urea. Similarly, XL2021-520 and carrier microparticles are more susceptible to dissociation of T=3 particles than T=4 particles at appropriate alkaline pH conditions, and T4 particles of XL2021-520 are more stable than T4 particles of the carrier. The same results are also observed by dot blot analysis. The mAb binding to the capsid protein is less detectable at alkaline pH conditions than at alkaline pH, urea, SDS treatment conditions. This indicates that alkaline pH has less impact on the stability of the particles. The presence of DTT has less impact on the integrity of XL2021-520 and carrier particles at alkaline conditions. DLS testing shows that at acidic pH conditions, the particles precipitate at the isoelectric point, and the diameter increases. In summary, all the analyzed chemical stress parameters can affect the stability of the particles. In the urea and SDS tests, the stability of the particle samples treated with DTT is lower. T3 particles are less stable than T4 particles.In summary, XL2021-520 microspheres and carrier microspheres HBC (1-150, C48S, C107S) show high chemical stability, with mutations of cysteines, N-terminal chimerization, C-terminal chimerization, and immunodominant epitope chimerization of the capsid protein: T=4 > T=3 for XL2021-520 microspheres and HBC (1-150, C48S, C107S) carrier particles.
[0139] XL2021-520 microspheres and HBC (1-150, C48S, C107S) carrier particles physical stability
[0140] XL2021-520 microspheres and HBC (1-150, C48S, C107S) carrier particles show no particles at temperatures greater than 80°C, with NAGE and dot blot detection, and the carrier shows lower thermal stability at 70-80°C. In the presence of DTT, T=4 particles and T=3 particles are apparently indistinguishable. DTT only slightly weakens the stability of the capsid protein. Heating to 70°C or above causes the particles to thermally coagulate, and the microsphere sample shows a white precipitate, while the carrier sample shows no white precipitate. DLS analysis of the particles induced by heating shows that the average diameter of the microsphere particles begins to rise at 70°C in the presence of DTT. After 72 hours of shaking at 25°C, dot blot and NAGE analysis show that 72 hours of shaking at 25°C has no effect on the stability of the microsphere particles and a slight effect on the carrier particles. T=3 capsid protein and T=4 capsid protein are affected to the same extent, and dot blot analysis shows that 72 hours of shaking results in a weaker signal. DTT has a positive effect on the integrity of the capsid protein. DLS detection of particle diameter after 72 hours of shaking of the sample shows a significant increase compared to the particle diameter of the fresh sample. This solves the problem of adding DTT to the Tris buffer to prevent self-coagulation of the microsphere particles after a period of storage. NAGE analysis of the effect of repeated freeze / thaw cycles on the stability of the particles shows that the microsphere particles are highly resistant to multiple freeze / thaw cycles in the presence of a reducing agent, and that 4 or more freeze / thaw cycles have the least effect on NAGE detection and analysis and a slight effect on dot blot detection. The ratio of the two particles, T=3:T=4, remains constant in all tests. Compared to the carrier particles, the microsphere particles are more resistant to multiple freeze / thaw cycles under various stress test conditions. In particular, in the presence of DTT, a single freeze / thaw cycle can completely eliminate the NAGE or dot blot signal of the carrier. In the presence of DTT, DLS can detect an increase in the average diameter of the carrier sample at an early stage.
[0141] The stability of the particles was greater than the carrier in the chemical and physical pressure tests, and there was no difference between the particle sample and the carrier sample T = 3: T = 4 ratio. The above tests confirmed that the DTT-sensitive disulfide bond made the particle microsphere complete and stable, and the heterogenous insertion of the linker-tight junction 18.2 peptide, T1 and T2 peptide did not affect the stability of the particles, and significantly improved the stability under physical pressure.
[0142] Example 5. Anti-tumor metastasis effect of recombinant virus-like nanoparticles
[0143] 5.1 Cell culture
[0144] The mouse luciferin-CLDN18.2 human gastric cancer cell line NugC4 was stably expressed, and CHO cells CT26 colon cancer cells (purchased from Jin Sui) were purchased. The cell culture medium was RPMI complete medium + 10% FBS, and the culture conditions were 37°C, 7.5% CO2, and a humidified incubator.
[0145] 5.2 Injection procedure and sampling time
[0146] 6-8 week old female BALB / c mice, 5 in each group, were injected intramuscularly with 15 micrograms of recombinant virus-like nanoparticles (XL2021-520-VLPs, prepared in Example 3) at 0, 1, 2, 3, 4, 5, 6 weeks, respectively, and the serum of the mice was collected at 1 week after injection to test the serum anti-CLDN18.2 level. At 1 week after injection, 1x10 5 Isogenic stably transfected mice were injected with CLDN18.2 CT26 colon cancer cells in the tail vein, and 2 weeks after injection of colon cancer cells in the tail vein, the mice were sacrificed, the lungs were weighed, and the lung metastasis load was evaluated by gross observation.
[0147] 5.3 Histopathological analysis: 3-micron sections of formalin-fixed, paraffin-embedded sections were deparaffinized, rehydrated, and the epitope was activated in citrate buffer pH 6. H2O2 was used to inhibit endogenous peroxidase, and 10% goat serum was added overnight to block non-specific antibody binding. Rabbit anti-CLDN18 was added overnight, and for detection, horseradish peroxidase secondary antibody was added, and a colorimetric kit was used according to the routine operation procedure. After hematoxylin re-staining, dehydration, and fixation, the sections were scanned with MIRAX SCAN (Zeiss), and the areas of tumor and normal tissue were determined using ImageJ Software v.1.44 software, and the significant differences between groups were evaluated using ANOVA and Dunn's test.
[0148] 5.4 Indirect ELISA: Rabbit polyclonal HBcAg antibody was purchased from DAKO (B058601), MaxVision HRP-polymer immunohistochemistry kit was purchased from Maixin Bio. Specifically, 96-well plates were coated with recombinant CLDN18.2 protein (CHO cells) or synthetic BSA-CLDN18.2 peptide, 200 ng per well, and the plates were sealed with 2% bovine serum. After 5-fold serial dilution of the serum, 100 μl was added to the reaction wells, incubated at room temperature for 1 hour, and then washed. Horseradish peroxidase anti-mouse antibody (purchased from Huaer Company) was added, and color developing liquid and termination liquid were added. The plates were read at 450 nm and 630 nm, respectively. The maximum dilution factor corresponding to the wells with OD450 nm-630 nm > 0.1 was used to calculate the antibody titer, and the formula was (OD450 nm-630 nm) / 0.1 x dilution factor.
[0149] 5.5 Immunofluorescence: Chinese hamster ovary cells were purchased from ATCC (CHO, ATCC No. CCL-61), and mouse CLDN18.2-eGFP-N plasmid was purchased from Jin Sui. The CHO cells were co-transfected, incubated for 24 hours, fixed with 4% paraformaldehyde (PFA), and then incubated with rabbit polyclonal antibody diluted 1:1000 for 1 hour. CY3-conjugated goat anti-rabbit IgG (H+L) monoclonal antibody was added at a dilution of 1:2000 and incubated for 30 minutes. DAPI was diluted 1:10000 and used to stain the cell nuclei.
[0150] 5.2 Flow cytometry analysis
[0151] 1 x 10 5 NUG-C4 cells (endogenously expressing mouse CLDN18.2) were added with 1:50 diluted mouse anti-serum and incubated for 1 hour. After washing, 1:100 diluted Alexa647-labeled goat anti-mouse IgG (H+L) monoclonal antibody was incubated for 1 hour, and the fluorescence signals before and after immunization were analyzed.
[0152] Histopathological analysis: 3-micron sections of formalin-fixed, paraffin-embedded tissues were deparaffinized, rehydrated, and epitope activated in citrate buffer pH 6. Endogenous peroxidase was inhibited with H2O2, and 10% goat serum was added for overnight blocking of non-specific antibody binding. Rabbit anti-CLDN18 was added for overnight incubation. Horseradish peroxidase secondary antibody was added for detection of binding, and a color developing kit was used according to the regular operating procedure. After hematoxylin re-staining, dehydration, and mounting, the sections were scanned using MIRAX SCAN (Zeiss). The areas of tumor and normal tissues were determined using ImageJ Software v.1.44. The significance of differences between groups was evaluated using ANOVA and Dunn's test.
[0153] Results:
[0154] Transiently transfected CLDN18.2 CHO cells were fixed on slices, pre- soaked and incubated with polyclonal antibodies. The resulting antibodies recognized CHO cells with CLDN18.2 on their surface, indicating that XL2021-520-VLPs broke the self-tolerance barrier in mice and rabbits and produced an immune response against CLDN18.2 transfected syngeneic cells.
[0155] FACS analysis showed that the serum of XL2021-520-VLPs immunized mice produced CLDN18.2 specific polyclonal antibodies, which recognized the natural conformation of the cell surface antigen.
[0156] BALB / c mice were immunized and the CLDN18.2 antibodies were detected by ELISA against HBcAg antibodies. XL2021-520-VLPs immunized mice produced high titers of CLDN18.2 specific antibodies compared to BSA-conjugated CLDN18.2 32-41 peptide immunized mice. The highest average titer of polyclonal CLDN18.2 antibodies was produced in XL2021-520-VLPs immunized mice. All virus-like particles produced the same titer of HBcAg carrier antibodies. Heat inactivation of the chimeric VLPs reduced the ability of the antibodies to induce CLDN18.2-EC1 antibodies, but did not weaken the ability to induce HBcAg backbone antibodies.
[0157] Microspheres immunized mice produced anti-CLDN18.2 antibodies. BALB / c mice were immunized with microspheres and ELISA endpoint titer analysis showed that high titers of CLDN18.2 antibodies were produced, as well as high titers of carrier backbone heterologous HBc protein antibodies, which were the same as the titers of CLDN18.2 antibodies. Heat denaturation reduced the ability of the particles to induce antibodies against the carrier backbone HBc protein. Figure 3 、 4 )。
[0158] ELISA showed that XL2021-520-VLPs recognized about 91 linear CLDN18.2 epitopes, and FACS analysis showed that the antibodies produced by immunized mice bound to 1 / 3 of the natural CLDN18.2 molecules on transfected cells. All XL2021-520-VLPs immunized sera recognized linear CLDN18.2 peptides and natural CLDN18.2 molecules.
[0159] XL2021-520-VLPs were compared for their ability to stimulate the production of antibodies against self-antigens. The resulting polyclonal antibodies recognized the natural CLDN18.2 protein expressed at physiological density by tumor cells.
[0160] Sera from three immunizations provided partial immune protection against syngeneic mouse tumor models:
[0161] The gross observation of the lung of the immunized mice showed that the number of metastatic nodules in the lung of the mice immunized with XL2021-520-VLPs was significantly reduced compared with that of the mice immunized with HBc-150 VLPs and PBS. The lung weight of the mice immunized with XL2021-520-VLPs was significantly less than that of the mice immunized with HBc-150 VLPs and PBS, and was not significantly different from that of the mice without tumor challenge. The immunohistochemical staining was performed after the observation of the lung of the mice. The ratio of the tumor tissue area to the normal tissue area of each lung section was significantly less than that of the mice immunized with HBc-150 and PBS (p<0.05), as shown in Table 1 and Table 2.
[0162] Table 1. Lung weight of the mice injected with XL2021-520-VLPs
[0163]
[0164] Table 2. Tumor metastasis area of the lung of the mice
[0165]
[0166] This example shows that the immunization with XL2021-520-VLPs mediates the protection against the malignant tumor cell CT26-CLDN18.2.
[0167] Example 6. Anti-tumor activity of XL2021-520-VLPs in vivo
[0168] 6.1 Cell lines and animals
[0169] The gastric cancer, gastric adenocarcinoma cell lines BxPc3 and KATO III were purchased from ATCC, and the culture conditions were as follows: culture medium: Dulbecco’s Modifed Eagle Medium (DMEM) containing 10% (w / v) fetal bovine serum (FBS, Sigma Aldrich), containing 100 U / ml penicillin, containing 100 μg / ml streptomycin. Incubated at 37°C, 5% CO2 incubator, and trypsinized when the cells were 80-90% confluent.
[0170] Animal models: mice C57BL / 6J (CD45.2), mice B6.SJL / J-PTPRCa (CD45.1), and transgenic mice C57BL / 6-Tg(CLDN18.2)2201Ng / J (CLDN18.2 transgenic) were purchased from the Experimental Animal Center of China Medical University. The mice used in the first immunization test control group were selected from mice of appropriate gender and 7-12 weeks old. Expi293 system (Thermo Fisher).
[0171] 6-8 weeks old female C57BL / 6 mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. All animals were bred in a specific pathogen-free environment and were approved by the Animal Welfare Committee of Lanzhou Institute of Biological Products and operated according to the regulations and guidelines. The lentivirus-X 293 cell line was purchased from Thermo Fisher. B16-oVbumin (OVA) mouse melanoma cells were provided by the Institute of Genetics of Lanzhou University. Eμ-myc-OVA B cell lymphoma cells were thawed and directly injected into mice.
[0172] 6.2. Mouse anesthesia 5x10 5 BxPc3 and 3x10 6 KATO III cells, tumor inoculation, and treatment injection started on the first day. Injection time was 0, 1, 2, 4, 9, 15 weeks, and the start of injection was defined as 0 weeks, 15 μg each time, and when the tumor size (subcutaneous tumor area) reached 1000 mm 2 , survival rate and tumor-free mice were determined.
[0173] 6.3. Recall test: 100 days after the primary tumor completely disappeared, 3x10 6 KATO III was transplanted subcutaneously in the right side of the mouse, and recombinant virus-like nanoparticle XL2021-520-VLPs (prepared in Example 3) were injected simultaneously, 15 μg per day for 3 consecutive days. The mice with developed tumors were observed daily for disease symptoms, and when the disease was severe, the mice were anesthetized, and the spleen was removed for analysis of tumor burden. Tumor burden was determined by the number of CD45.2+CD19+ cells per spleen cell. For transgenic mouse littermates, the first injection was performed at 6 weeks of age. One week later, a booster was given. The primed mice received 3 consecutive days of treatment, and at 15 weeks or 21-24 weeks, they were weighed and fixed for histopathological analysis. The tumor histopathological analysis method is as follows:
[0174] Each group of tumors reached 1000 mm 3 , mice were anesthetized, and long-surviving mice were anesthetized for tumor tissue removal 70 days after tumor transplantation. The tumor tissue was fixed with formalin solution and paraffin-embedded for immunohistochemical analysis (IHC). 5-μm thick tumor sections were stained to observe CD8+ lymphocytes. The mouse anti-CD8+ polyclonal antibody used was purchased from Abeam (Cambridge, UK; ab203035), and hematoxylin staining was finally used.
[0175] Results:
[0176] 1. Intravenous injection of recombinant virus-like nanoparticles provides therapeutic protection against gastric tumors. Initial treatment was administered on day 1 of tumor inoculation, followed by subsequent injections according to the prescribed schedule. Compared to untreated mice, immunotreated mice showed inhibited tumor growth and increased survival rates. In treated mice, the number of tumors that disappeared by the end of treatment reached 60%. Figure 5 The study investigated the effects of recombinant protein nanoparticle antigen therapy on tumor cell growth inhibition and survival percentage compared to untreated tumor cells. Mice that had undergone gastric cancer cell transplantation and vaccine treatment experienced tumor disappearance and survived to 90 days. These mice were then challenged again with gastric tumor cells, and compared to age-matched untreated mice that had undergone gastric tumor cell transplantation. Figure 6 and Figure 7 Data are presented as mean ± standard error. In the experimental group, n = 10 mice per group, and in the untreated group, n = 18 mice per group. Significant differences in tumor growth were assessed using two-way ANOVA and Tukey's multiple comparison test.
[0177] In mice with gastric cancer tumors, primary immunization and booster immunization with the vaccine (XL2021-520-VLPs + Keyhole Limpet Hemocyanin (KLH)) induced significant protection compared to the antigen (XL2021-520-VLPs) immunization group. The vaccine improved survival, significantly inhibited tumor growth, and induced complete anti-tumor immunity in 60% of tumor-bearing mice. The vaccine-induced anti-tumor immune response was long-lasting, lasting up to 75 days, and also enabled tumor-bearing mice to survive for up to 75 days. Booster immunizations on days 7 and 14 effectively controlled tumor cell growth, and also improved overall survival and the number of tumor-disappearing individuals. Comparing these results determined that a strategy of primary immunization followed by a booster immunization on day 6 or 13 was effective in suppressing tumor growth, improving overall survival, and significantly increasing the rate of tumor disappearance in subsequent experiments.
[0178] 2. This vaccine has specific and memory-like immunization effects.
[0179] The primary immunization was administered on day 2, followed by a booster immunization on day 9.
[0180] Compared with adjuvant-only tumor-bearing mice, the tumors in vaccine-bearing tumor-bearing mice were well controlled. Figure 7 ), and the survival rate was improved ( Figure 8 To evaluate vaccine-induced immune memory, mice that had been vaccinated, challenged with tumors and whose tumors had regressed and survived to 100 days were challenged again with gastric cancer tumors. The immunized mice showed protection against the second tumor challenge. 80% of the tumor-bearing mice experienced tumor regression, and all age-appropriate, unvaccinated mice that received their first tumor challenge suffered from tumor burden.
[0181] Example 6. Rat safety and tolerability in tumor-bearing mice
[0182] Treatment program: 0, 1, 2, 4, 9, 15 weeks, injection of localization at 0 weeks, collection of rat serum at 3, 5, 10, 16 weeks. XL2021-520-VLPs and KLH (10 or 50 mg / kg injected according to the treatment program in 10 male rats. Throughout the test, blood samples were taken for pharmacokinetic analysis, clinical pathology evaluation. On day 112, surviving rats were taken for histopathological evaluation of tissues. Total antibodies in serum were detected with biotin-conjugated polyclonal rabbit anti-mouse IgG (H+L) antibody, Alexa Fluor 647-labeled goat anti-rabbit IgG (H+L), detection limit 50 ng / mL. Pharmacokinetics was analyzed using non-compartmental methods with Phoenix software v.6.3 (Pharsight). Hematology, clinical chemistry: surviving animals were bled at 8, 15, 29, 37, 106 days for standard hematology and clinical chemistry studies. Microscopic analysis: animals were necropsied under anesthesia at day 18. At necropsy, each tissue was examined for lesions, and the large intestine, small intestine, eye, liver, lung, pancreas, kidney, stomach were collected and preserved in neutral 10% formalin (except the eye, which was preserved in 3% glutaraldehyde) and sectioned for hematoxylin and eosin staining and microscopic analysis. Tumor-bearing mice tolerability evaluation Gastric tumor cell-loaded mice were injected intravenously with 2 doses of XL2021-520-VLPs+KLH (0.40 mg / kg, i.v.) per week, and after 4 weeks the stomach was collected for histopathological, immunohistochemical and score analysis. Formalin-fixed, paraffin-embedded tumor tissue was stained with CLDN18.2 monoclonal antibody, followed by HRP-labeled polyclonal rabbit antibody detection and evaluation, and was considered positive only if the membrane was completely or partially stained. Tumor cell staining intensity was classified as weak (1+), moderate (2+), strong (3+). The IHC H-score was the product of the staining intensity (1+-3+) multiplied by the percentage of positive cells.
[0183] Results
[0184] Toxicity of XL2021-520-VLPs+KLH in rats and tumor-bearing mice
[0185] Figure 9 Figure 6 shows the serum concentration of XL2021-520-VLPs and KLH over time in rats injected with 10 mg / kg on day 1 and day 15, and the concentration of total XL2021-520 and total KLH was detected by ELISA.
[0186] XL2021-520-VLPs+KLH has a half-life of 10 ± 3 days and is not toxic in systemic circulation Figure 9). Mice injected at 50 mg / kg on day 3 were moribund and not anesthetized, but mice injected at 10 mg / kg lived up to 20 days without clinical signs of toxicity. Due to the expression of CLDN18.2, slight to moderate mitotic or single cell necrosis phenomena were observed microscopically in the glandular stomach, associated with the lysis of tumor cells expressing CLDN18.2. Other had total leukopenia, neutropenia, erythropenia, associated with moderate to significant microscopic changes in the structure of bone marrow, lymphoid tissue cells. Microscopic analysis performed at 10 mg / kg injection showed slight pulmonary edema, slight to moderate mitotic or single cell necrosis phenomena in the corneal epithelial cells of the eye, liver (stem cells, sinus endothelial cells, bile ducts), heart (interstitial cells), kidney (interstitial cells), intestine (cecum and colon epithelial cells), and also higher AST (1.5x), GLDH (2.4x) compared to controls. Tumor-bearing NSG mice had no toxic reactions 4 weeks after a single intravenous injection of recombinant virus-like nanoparticles (0.34 mg / kg).
Claims
1. A recombinant virus-like nanoparticle for immunotherapy of gastric cancer, characterized in that, The recombinant virus-like nanoparticles are chimeric recombinant protein nanoparticles formed by the self-assembly of the hepatitis B virus core protein and the CLDN18.2 tight linker protein HBC-CLDN18.
2. The amino acid sequence of the fusion protein HBC-CLDN18.2 is shown in SEQ ID NO.
2.
2. The recombinant virus-like nanoparticles as described in claim 1, characterized in that, The diameter of the nanoparticles is 25–40 nm.
3. The recombinant virus-like nanoparticles as described in claim 2, characterized in that, The diameter of the nanoparticles is 30 nm or 35 nm.
4. Encoding polynucleotides for assembling the fusion protein HBC-CLDN18.2 of the recombinant virus-like nanoparticles of claim 1.
5. A cloning and expression vector, characterized in that, The cloning and expression vector contains the polynucleotide described in claim 4.
6. A host cell, characterized in that, The host cell contains the cloning and expression vector as described in claim 5.
7. The host cell as described in claim 6, characterized in that, The host cell is an engineered bacterium containing the clone and expression vector described in claim 5, which is an anti-gastric cancer recombinant protein nanoparticle strain named XL2021-520. It is deposited at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. Its microbial accession number is CGMCC NO: 22586, and the deposit date is May 24, 2021.
8. The use of the recombinant virus-like nanoparticles according to any one of claims 1-3 in the preparation of immunotherapy drugs for gastric cancer.
9. The application as described in claim 8, characterized in that, The drug in question is an injectable drug.
Citation Information
Patent Citations
Application of HBcAg (hepatitis B core antigen) virus-like particle serving as cancer therapeutic vaccine carrier
CN105497886A
Recombinant drug carrier protein gene, and preparation method and application thereof
CN106906230A