A method for metabolically engineering brewer's yeast to produce limonene and its derivatives

By modifying Saccharomyces cerevisiae through metabolic engineering, overexpressing key genes and integrating P450 oxidase, the efficient production of limonene and perillic acid was achieved, solving the problem that Saccharomyces cerevisiae cannot efficiently synthesize limonene and its derivatives in existing technologies, and realizing the industrial production of high-yield limonene and perillic acid.

CN116515658BActive Publication Date: 2026-04-17JIANGNAN UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202310448344.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-04-24
Publication Date
2026-04-17
Estimated Expiration
2043-04-24

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently synthesize limonene and its derivative perillic acid using brewer's yeast, and traditional methods cannot meet the needs of industrial production.

Method used

By modifying Saccharomyces cerevisiae through metabolic engineering, overexpressing key genes and integrating the cytochrome P450 oxidase CYP71A76 gene derived from Salvia miltiorrhiza, efficient accumulation of limonene was achieved. Limonene was then converted into perillic acid via P450 enzyme. Combined with modular engineering and peroxisomal compartmentalization strategies, a high-efficiency production strain was constructed.

Benefits of technology

High yields of limonene and perillic acid were achieved, with limonene yield reaching 86.74 mg/L and perillic acid yield reaching 4.42 mg/L, meeting the needs of industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116515658B_ABST
    Figure CN116515658B_ABST
Patent Text Reader

Abstract

This invention discloses a method for metabolically engineering Saccharomyces cerevisiae to produce limonene and its derivatives, belonging to the field of biotechnology. The recombinant Saccharomyces cerevisiae uses a Saccharomyces cerevisiae strain with integrated cytochrome P450 oxidase and CPR genes from Salvia miltiorrhiza as the chassis cell. The following genes, with the nucleotide sequence ePTS linked to the 3' end of each gene, are overexpressed: acetyl-CoA thiolase, HMG-CoA synthase, HMG-CoA reductase (tHMGR), mevalonate kinase, phosphate mevalonate kinase, diphosphate mevalonate kinase, isopentenyl pyrophosphate isomerase, and farnesyl pyrophosphate synthase, as well as a truncated limonene synthase from Spearmint. After 120 h of shake-flask fermentation, the recombinant strain HY-PER-03 produced 86.74 mg / L of limonene, while S. cerevisiae HY-PA-01 produced 4.42 mg / L of perillic acid.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a method for metabolically engineering brewing yeast to produce limonene and its derivatives, belonging to the field of biotechnology. Background Technology

[0002] Monoterpenes are a class of natural products with isoprene as their backbone, possessing significant economic value. Limonene, a typical monoterpene, has been found in over 300 plant species and some bacteria. Limonene and its derivative, perillic acid, are widely used in industrial production due to their pleasant aroma, unique bioactivity, and excellent physicochemical properties, appearing in pharmaceuticals, food, skincare products, biofuels, and biomaterials. Global limonene production is growing rapidly, and the market size is projected to exceed $1.9 billion by 2024. While the wide range of applications for limonene and perillic acid has led to a surge in market demand, seasonal climate changes severely impact the extraction of these compounds from natural plants. Furthermore, chemical synthesis processes suffer from low efficiency, high energy consumption, significant environmental pollution, and toxic byproducts, hindering large-scale production and application.

[0003] The known pharmacological activities of limonene and perillic acid include: (1) broad-spectrum antibacterial activity: limonene has obvious inhibitory effects on the growth and reproduction of common bacteria such as Escherichia coli and Staphylococcus aureus, as well as fungi such as yeast and some molds; (2) anti-inflammatory: limonene and perillic acid can inhibit the expression of pro-inflammatory factors TNF-α and IL-6 in leukocytes, thereby playing a certain anti-inflammatory role; (3) antioxidant: limonene is an antioxidant with the ability to scavenge diphenylpicrylhydrazide (DPPH) free radicals; (4) antitumor: limonene and perillic acid have preventive and therapeutic effects on many types of cancer, such as gastric cancer, breast cancer, skin cancer, and lymphoma; (5) expectorant, antiasthmatic, choleretic, and litholytic effects of limonene. Therefore, large-scale production of limonene and perillic acid has become an inevitable trend.

[0004] The rapid development of synthetic biology and metabolic engineering has provided another approach for the sustainable production of high-value-added natural products. To date, researchers have achieved the biosynthesis of limonene in Escherichia coli, yeast, and mold, and have also successfully achieved the biocatalysis of limonene to perillic acid using Yarrowia lipolytica. However, there are currently no reports on the de novo synthesis of perillic acid by Saccharomyces cerevisiae. To increase limonene yield, traditional metabolic engineering strategies include: (1) overexpressing or modifying the rate-limiting gene HMGR in the MVA pathway; (2) modifying the gene ERG20 to weaken the competitive pathway and promote the accumulation of terpene precursor GPP; and (3) introducing orthogonal pathways to alleviate cellular regulation of the MVA pathway. However, the resulting limonene titers still cannot meet the needs of industrial production. In recent years, organelle compartmentalization has been proven to be a feasible method for producing isoprene. Compartmentation of mitochondria, peroxisomes, and endoplasmic reticulum has been reported to promote the production of various isoprene compounds, but there are few reports on compartmentalization of the limonene synthesis pathway in *S. cerevisiae*. Utilization of organelles may further enhance the ability of *S. cerevisiae* to produce limonene and perillic acid.

[0005] Therefore, the current research goal is to use metabolic engineering and synthetic biology techniques to modify the S. cerevisiae starting strain in order to achieve efficient production of limonene and perillic acid. Summary of the Invention

[0006] Based on existing technologies, this invention provides a method for metabolically engineering Saccharomyces cerevisiae to synthesize limonene and its derivative perillic acid. Utilizing metabolic engineering and synthetic biology techniques, starting with S. cerevisiae BY4741, modular engineering was employed to achieve efficient accumulation of limonene, and the effect of peroxisome compartmentalization on limonene potency was investigated. Furthermore, by expressing a P450 enzyme derived from Tanshinone, the conversion of limonene to perillic acid was achieved, successfully constructing a S. cerevisiae strain capable of de novo synthesis of perillic acid.

[0007] This invention provides a *S. cerevisiae* strain that produces limonene and perillic acid. The strain overexpresses the MVA pathway genes ERG10 (acetyl-CoA thiolase), ERG13 (HMG-CoA synthase), tHMGR (HMG-CoA reductase), ERG12 (mevalonate kinase), ERG8 (mevalonate phosphate kinase), MVD1 (mevalonate phosphate kinase), and IDI1 (isopentenyl pyrophosphate isomerase) in *S. cerevisiae* BY4741 (laboratory deposit). It also integrates the gene ERG20ww (based on codon preferences and specificities of *Saccharomyces cerevisiae*) and the exogenous genes tLS and CYP71A76, thereby achieving the production of limonene and perillic acid.

[0008] This invention provides a recombinant Saccharomyces cerevisiae capable of producing perillic acid, wherein the recombinant Saccharomyces cerevisiae is based on a Saccharomyces cerevisiae strain whose genome integrates the cytochrome P450 oxidase CYP71A76 gene and the cytochrome P450 oxidase coenzyme CPR gene derived from Salvia miltiorrhiza as the chassis cell.

[0009] The following genes, with the nucleotide sequence shown in SEQ ID NO.6 linked to the 3' end of each gene respectively, were overexpressed: acetyl-CoA thiolytic enzyme gene ERG10 (ERG10-ePTS), HMG-CoA synthase gene ERG13 (ERG13-ePTS), HMG-CoA reductase gene tHMGR (tHMGR-ePTS), mevalonate kinase gene ERG12 (ERG12-ePTS), mevalonate phosphate kinase gene ERG8 (ERG8-ePTS), mevalonate diphosphate kinase MVD1 (MVD1-ePTS), isopentenyl pyrophosphate isomerase IDI1 (IDI1-ePTS), and farnesyl pyrophosphate synthase ERG20ww (ERG20ww-ePTS), as well as truncated limonene synthase tLS (tLS-ePTS) from spearmint.

[0010] In one embodiment of the present invention, the acetyl-CoA thiolytic enzyme gene ERG10 is numbered 856079 in NCBI.

[0011] The HMG CoA synthase gene ERG13 is numbered 854913 in NCBI.

[0012] The HMG-CoA reductase gene tHMGR is numbered 851171 in NCBI.

[0013] The mevalonate kinase gene ERG12 is numbered 855248 in NCBI.

[0014] The phosphate mevalonate kinase gene ERG8 is numbered 855260 in NCBI.

[0015] The MVD1 diphosphate kinase is numbered 855779 in NCBI.

[0016] The isopentenyl pyrophosphate isomerase IDI1 has the NCBI number 855986.

[0017] The farnesyl pyrophosphate synthase mutant gene ERG20ww is formed by mutating phenylalanine at position 95 and asparagine at position 126 of ERG20 to tryptophan. The NCBI number for ERG20 is 853272.

[0018] The limonene synthase tLS is numbered JX555965 in NCBI.

[0019] In one embodiment of the present invention, the nucleotide sequence encoding the cytochrome P450 oxidase CYP71A76 is shown in SEQ.ID.NO.1.

[0020] In one embodiment of the present invention, the recombinant Saccharomyces cerevisiae is based on Saccharomyces cerevisiae BY4741, which integrates the cytochrome P450 oxidase CYP71A76 gene and the cytochrome P450 oxidase coenzyme CPR gene from Salvia miltiorrhiza into its genome.

[0021] In one embodiment of the present invention, the cytochrome P450 oxidase CYP71A76 gene and the cytochrome P450 oxidase coenzyme CPR gene are simultaneously integrated into the ROX1 site (NCBI number: 856178) on the genome of Saccharomyces cerevisiae BY4741.

[0022] In one embodiment of the present invention, the recombinant Saccharomyces cerevisiae is expressed using pESC plasmid as a free expression vector.

[0023] In one embodiment of the present invention, the recombinant Saccharomyces cerevisiae is prepared by overexpressing mevalonate kinase MVD1-ePTS and isopentenyl pyrophosphate isomerase IDI1-ePTS using the pESC-leu plasmid.

[0024] In one embodiment of the present invention, the mevalonate kinase MVD1-ePTS was overexpressed using the PGal10 promoter with the nucleotide sequence shown in SEQ.ID.NO.2 and the TCYC1 terminator with the nucleotide sequence shown in SEQ.ID.NO.3; and the isopentenyl pyrophosphate isomerase IDI1-ePTS was overexpressed using the PGal1 promoter with the nucleotide sequence shown in SEQ.ID.NO.4 and the TADH1 terminator with the nucleotide sequence shown in SEQ.ID.NO.5.

[0025] In one embodiment of the present invention, the recombinant brewer's yeast is prepared by overexpressing the mevalonate kinase gene ERG12-ePTS and the mevalonate phosphate kinase gene ERG8-ePTS using the pESC-his plasmid.

[0026] In one embodiment of the present invention, the mevalonate kinase gene ERG12-ePTS was overexpressed using the PGal10 promoter with the nucleotide sequence shown in SEQ.ID.NO.2 and the TCYC1 terminator with the nucleotide sequence shown in SEQ.ID.NO.3; and the phosphate mevalonate kinase gene ERG8-ePTS was overexpressed using the PGal1 promoter with the nucleotide sequence shown in SEQ.ID.NO.4 and the TADH1 terminator with the nucleotide sequence shown in SEQ.ID.NO.5.

[0027] In one embodiment of the present invention, the recombinant Saccharomyces cerevisiae is prepared by overexpressing the HMG-CoA synthase gene ERG13, the acetyl-CoA thiolytic enzyme gene ERG10-ePTS, and the HMG-CoA reductase gene tHMGR-ePTS using the pESC-trp plasmid.

[0028] In one embodiment of the present invention, the genes ERG13 and ERG10 are fused via GGGS Linker; the fusion is performed in the order of ERG10-ERG13 to obtain ERG10-ERG13-ePTS.

[0029] In one embodiment of the present invention, the acetyl-CoA thiodiolase gene ERG10 and the HMG-CoA synthase gene ERG13 (ERG10-ERG13-ePTS) are overexpressed using the PGal10 promoter with the nucleotide sequence shown in SEQ.ID.NO.2 and the TCYC1 terminator with the nucleotide sequence shown in SEQ.ID.NO.3; and the HMG-CoA reductase gene tHMGR-ePTS is overexpressed using the PGal1 promoter with the nucleotide sequence shown in SEQ.ID.NO.4 and the TADH1 terminator with the nucleotide sequence shown in SEQ.ID.NO.5.

[0030] In one embodiment of the present invention, the recombinant Saccharomyces cerevisiae is prepared by overexpressing the farnesyl pyrophosphate synthase mutant gene ERG20ww-ePTS and the truncated limonene synthase tLS-ePTS using the pESC-ura plasmid.

[0031] In one embodiment of the present invention, the farnesyl pyrophosphate synthase mutant gene ERG20ww-ePTS was overexpressed using the PGal10 promoter with the nucleotide sequence shown in SEQ.ID.NO.2 and the TCYC1 terminator with the nucleotide sequence shown in SEQ.ID.NO.3; and the truncated limonene synthase tLS-ePTS was overexpressed using the PGal1 promoter with the nucleotide sequence shown in SEQ.ID.NO.4 and the TADH1 terminator with the nucleotide sequence shown in SEQ.ID.NO.5.

[0032] In one embodiment of the present invention, the chassis cell is S. cerevisiae BY4741, which integrates the cytochrome P450 oxidase CYP71A76 gene and the cytochrome P450 oxidase coenzyme CPR gene from tanshinone, and knocks out the GAL80 gene and the URA3 gene.

[0033] Alternatively, the endogenous genes ERG10 and ERG13 can be linked by a flexible linker (GGGS) to construct a fusion gene expression vector, which is then integrated into the S. cerevisiae BY4741 genome. This strategy has resulted in increased yield.

[0034] The present invention also provides a knockout frame for knocking out the endogenous genes DPP1 and LPP1 in Saccharomyces cerevisiae.

[0035] This invention also provides a modular engineering method, a strategy for expressing the above-mentioned endogenous genes in modules.

[0036] This invention also provides a method for constructing pESC free plasmids.

[0037] In one embodiment of the present invention, the yield of limonene is further increased by overexpressing the above-mentioned gene using a free plasmid.

[0038] The present invention also provides a knockout frame for knocking out the endogenous gene GAL80 in Saccharomyces cerevisiae.

[0039] The present invention also provides a strategy for converting limonene to perillic acid by expressing the P450 enzyme CYP71A76 and the coenzyme CPR.

[0040] In one embodiment of the present invention, the recombinant cells use Escherichia coli or Saccharomyces cerevisiae as host cells.

[0041] The present invention also provides a method for constructing the above-mentioned recombinant brewer's yeast, the method comprising the following steps:

[0042] (1) Chemical synthesis of limonene synthase and CYP71A76 gene.

[0043] (2) Prepare recombinant plasmids of module I, module II and module III. By fusing the protein targeting signal peptide ePTS at the C-terminus of the gene, the gene can be localized to the peroxisome.

[0044] (3) The obtained expression cassette was digested with SalⅠ and SpeⅠ enzymes and then converted into Saccharomyces cerevisiae by ethanol precipitation and concentration of lithium acetate conversion method. For the specific method, please refer to Example 2.

[0045] (4) Four pESC series free plasmids were constructed to overexpress the genes ERG10, ERG13, tHMGR, ERG12, ERG8, MVD1, IDI1, ERG20ww and tLS respectively.

[0046] (5) Genes ERG10 and ERG13 are expressed through linker fusion to increase limonene production.

[0047] (6) The carbon source for shake-flask fermentation was initially optimized to increase the yield of limonene. The method is described in Example 5.

[0048] (7) Prepare recombinant plasmid TS-ROX1-gda-URA3-TEF1-CYP71A76-ADH1-TDH3-CPR-CYC1 and integrate it into the ROX1 site of the recombinant Saccharomyces cerevisiae genome.

[0049] (8) Prepare the knockout plasmid GAL80 to relieve the inhibition of glucose on the galactose-inducible promoter.

[0050] In one embodiment of the present invention, the method comprises: taking the recombinant strain S. cerevisiae Lim01,

[0051] S. cerevisiae Lim 02, S. cerevisiae Lim 03, S. cerevisiae Lim 04, S. cerevisiae Lim 05, S. cerevisiae Lim 06, S. cerevisiae Lim 07, and S. cerevisiae Lim 08 were inoculated into YPD seed culture medium and cultured at 30℃ and 200 r / min to prepare seed liquid. The seed liquid was then inoculated into YPD fermentation medium for fermentation to prepare mouse limonene.

[0052] In one embodiment of the present invention, the recombinant strains S. cerevisiae HY-CYT-01, S. cerevisiae HY-CYT-02, S. cerevisiae HY-PER-01, and S. cerevisiae HY-PER-02 were inoculated into solid MM medium and cultured to obtain single colonies. A single colony was picked and inoculated into MM liquid medium and cultured at 30°C and 200 rpm for 1 day to prepare a seed culture. The seed culture was then inoculated into SG fermentation medium for fermentation to prepare limonene.

[0053] In one embodiment of the present invention, the recombinant strain S. cerevisiae HY-PER-01 was inoculated into solid MM medium and cultured to obtain single colonies. A single colony was picked and inoculated into MM liquid medium, and cultured at 30°C and 200 r / min for 1 day to prepare a seed culture. The seed culture was then inoculated into fermentation media with different concentrations of galactose and raffinose to ferment and prepare limonene.

[0054] In one embodiment of the present invention, the recombinant strain S. cerevisiae HY-PA-01 was inoculated into solid MM medium and cultured to obtain single colonies. A single colony was picked and inoculated into MM liquid medium, and cultured at 30°C and 200 rpm for 1 day to prepare a seed culture. The seed culture was then inoculated into 2XSG fermentation medium for fermentation to prepare perillic acid.

[0055] In one embodiment of the present invention, the recombinant strain S. cerevisiae HY-PER-03 was inoculated into solid MM medium and cultured to obtain single colonies. A single colony was picked and inoculated into MM liquid medium, and cultured at 30°C and 200 rpm for 1 day to prepare a seed culture. The seed culture was then inoculated into fermentation media with different glucose concentrations to ferment and prepare limonene.

[0056] In the above embodiments, the shake-flask fermentation conditions are as follows: the seed liquid is inoculated into the liquid culture medium at an inoculation ratio of OD=0.5, and shake-flask fermentation is carried out for 120 hours.

[0057] The present invention also provides the application of the above-mentioned recombinant brewing yeast in the preparation of perillic acid or products containing perillic acid.

[0058] Beneficial effects

[0059] The recombinant S. cerevisiae HY-PER-03 provided by this invention enables the conversion of glucose into limonene, and the fermentation of limonene in a glucose culture medium yields up to 86.74 mg / L. The recombinant strain S. cerevisiae HY-PA-01 enables the de novo synthesis of perillic acid by Saccharomyces cerevisiae, with a perillic acid yield of 4.42 mg / L. Attached Figure Description

[0060] Figure 1 The yield of oxalic acid from the recombinant bacteria S. cerevisiae Lim 01, S. cerevisiae Lim 02, S. cerevisiae Lim 03, S. cerevisiae Lim 04, S. cerevisiae Lim 05, S. cerevisiae Lim 06, S. cerevisiae Lim 07, and S. cerevisiae Lim 08 constructed in this invention after fermentation in YPD fermentation medium for 120 h.

[0061] Figure 2 The limonene yield of the recombinant strains S. cerevisiae HY-CYT-01, S. cerevisiae HY-CYT-02, S. cerevisiae HY-PER-01, and S. cerevisiae HY-PER-02 constructed in this invention after fermentation in SG fermentation medium for 120 h.

[0062] Figure 3 The limonene yield of the recombinant strain S. cerevisiae HY-PER-01 constructed in this invention was obtained by fermenting for 120 h in fermentation media with different concentrations of galactose and raffinose.

[0063] Figure 4 The perillic acid yield of the recombinant strain S. cerevisiae HY-PA-01 constructed in this invention after fermentation in 2XSG fermentation medium for 120 h.

[0064] Figure 5 The limonene yield of the recombinant strain S. cerevisiae HY-PER-03 constructed in this invention was obtained by fermenting for 120 h in fermentation media with different glucose concentrations.

[0065] Figure 6 : The yield of limonene from the carbon source optimized by the recombinant strain S. cerevisiae HY-PER-03. Detailed Implementation

[0066] Saccharomyces cerevisiae BY4741 and Escherichia coli JM109 were provided by our laboratory; pESC series plasmids were purchased from Agilent Technologies; pMD19-T (Simple) was purchased from TaKaRa.

[0067] The culture media involved in the following examples are as follows:

[0068] (1) Luria-Bertani (LB) medium (g / L): yeast extract 5, tryptone 10, NaCl 10.

[0069] (2) YPD medium (g / L): yeast extract 10, glucose 20, tryptone 20. Solid medium supplemented with 2% (w / v) agar powder.

[0070] (3) MM medium (g / L): (NH4)2SO4 10, YNB 6.7, glucose 20, solid medium with 2% (w / v) agar powder added.

[0071] (4) SM medium (g / L): (NH4)2SO4 10, YNB 6.7, glucose 20, agar powder 20, uracil 0.06.

[0072] (5) SD medium (g / L): (NH4)2SO4 10, YNB 6.7, galactose 20; amino acid supplement 10mL / L.

[0073] (6) SG medium (g / L): (NH4)2SO4 10, YNB 6.7, galactose 20; amino acid supplement 10mL / L.

[0074] (7) Amino acid supplements (g / L): Leucine 10, Histidine 10, Methionine 10, Tryptophan 10.

[0075] The detection methods for limonene and perillic acid involved in the following examples are as follows:

[0076] Detection of limonene

[0077] For the detection of limonene, the fermentation broth was centrifuged at 5000 rpm for 10 min to obtain the organic layer. Anhydrous sodium sulfate was added, and the mixture was allowed to stand for 1-2 h to remove water. 1 mL of the upper dodecane organic phase was then drawn up using a syringe, filtered through a filter membrane, and used for GC-MS analysis. The GC-MS detection conditions were as follows: a TG-5MS column was used, with helium as the carrier gas. The temperature program was: 50℃ for 1 min, then increased to 100℃ at a rate of 6℃ / min, and then increased to 280℃ at a rate of 20℃ / min, and remained there for 5 min.

[0078] Detection of perillic acid

[0079] For the detection of perillic acid, 5 mL of fermentation broth was placed in a centrifuge tube, and 5 mL of ethyl acetate was added. The mixture was thoroughly shaken and mixed using a shaker, and then centrifuged at 5000 rpm for 10 min. After centrifugation, 3 mL of the upper organic phase was transferred to a centrifuge tube, anhydrous sodium sulfate was added, and the mixture was allowed to stand for 1-2 h to remove water. 1 mL of the upper ethyl acetate phase was then drawn up using a syringe, filtered through an organic filter membrane, and used for gas chromatography analysis.

[0080] The lithium acetate conversion method of S. cerevisiae involved in the following examples is as follows:

[0081] *S. cerevisiae* were cultured in 20 mL of YPD medium at 30 °C for 20–24 h. Then, 0.5–1 mL was transferred to 50 mL of YPD medium and cultured at 30 °C until OD600 = 0.6–0.8. Cells were collected and suspended in 1 mL of 100 mmol / L lithium acetate. 50 μL of the cell suspension was transferred to a centrifuge tube, centrifuged to remove lithium acetate. The transformation mixture was added in the following order: 240 μL of PEG (50%, w / v), 36 μL of 1.0 mol / L LiAc, 25 μL of single-stranded vector DNA, and 50 μL of free plasmid (precipitated with ethanol). The centrifuge tube was vigorously shaken until the cells were completely mixed. The mixture was incubated at 30 °C for 30 min, followed by heat shock at 42 °C for 20–25 min. The cells were then plated onto MM plates with 100 μL of the transformation mixture.

[0082] Example 1: Construction of recombinant Saccharomyces cerevisiae strain

[0083] The specific steps are as follows:

[0084] 1. Construction of recombinant vectors

[0085] (1) Construction of recombinant vector pESC-leu-PGal10-MVD1-ePTS-TCYC1-PGal1-IDI1-ePTS-TADH1

[0086] Using the genome of S. cerevisiae as a template, the fragment IDI1-ePTS was amplified by PCR using primers IDI1-F1 and IDI1-R2. The pESC-leu plasmid and the IDI1-ePTS fragment were digested with NotⅠ and SacI, respectively, and ligated using Solution I ligase. The ligation was then performed and transformed into E. coli JM109 competent cells to construct the plasmid pESC-leu-PGal1-IDI1-ePTS-TADH1. Using the genome of *S. cerevisiae* as a template, PCR amplification was performed using primers MVD1-F1 and MVD1-R2 to obtain the fragment MVD1-ePTS. The plasmid pESC-leu-PGal1-IDI1-ePTS-TADH1 and the fragment MVD1-ePTS were double-digested with BamHI and XhoI, respectively. The fragments were ligated using Solution I, transformed into *E. coli* JM109, and screened to obtain the target plasmid pESC-leu-PGal10-MVD1-ePTS-TCYC1-PGal1-IDI1-ePTS-TADH1, thus obtaining vector 1.

[0087] (2) Construction of recombinant vector pESC-his-PGal10-ERG12-ePTS-TCYC1-PGal1-ERG8-ePTS-TADH1

[0088] Using the genome of *S. cerevisiae* as a template, PCR amplification was performed using primers ERG8-F1 and ERG8-R2 to obtain the ERG8-ePTS fragment. The pESC-his plasmid and the ERG8-ePTS fragment were digested with NotI and SacI, respectively, and ligated using Solution I ligase. The ligation was then performed and transformed into *E. coli* JM109 competent cells to construct the plasmid pESC-his-PGal1-ERG8-ePTS-TADH1. Using the genome of *S. cerevisiae* as a template, PCR amplification was performed using primers ERG12-F1 and ERG12-R2 to obtain the ERG12-ePTS fragment. The plasmid pESC-his-PGal1-ERG8-ePTS was double-digested with BamHI and XhoI, respectively.

[0089] -TADH1 and fragment ERG12-ePTS were ligated using Solution I, transformed into E.coli JM109, and screened to obtain the target plasmid pESC-his-PGal10-ERG12-ePTS-TCYC1-PGal1-ERG8-ePTS-TADH1, thus obtaining vector 2.

[0090] (3) Construction of recombinant vector pESC-trp-PGal10-ERG10-ERG13-ePTS-TCYC1-PGal1-tHMGR-ePTS-TADH1

[0091] The genes ERG13 and ERG10 are fused via the GGGS Linker. The fusion is performed in the order ERG10-ERG13, specifically: using the S. cerevisiae genome as a template, PCR amplification is performed using primers ERG10-F1 and ERG10-R1 to obtain fragment ERG10. The downstream primer ERG10-R1 contains the gene sequence of the GGGS Linker and the 10bp upstream homologous arm sequence of gene ERG13. Using the S. cerevisiae genome as a template, PCR amplification is performed using primers ERG13-F1 and ERG13-R2 to obtain fragment ERG13-ePTS. The upstream primer ERG13-F1 contains the gene sequence of the GGGS Linker and the 10bp downstream homologous arm sequence of gene ERG10. Using fragments ERG10 and ERG13-ePTS as templates, and primers ERG10-F1 and ERG13-R2, the fragment ERG10-ERG13-ePTS was amplified by fusion PCR.

[0092] Using the genome of S. cerevisiae as a template, the fragment tHMGR-ePTS was amplified by PCR using primers tHMGR-F1 and tHMGR-R2. The pESC-trp plasmid and the tHMGR-ePTS fragment were digested with NotI and SacI, respectively, and ligated using SolutationI ligase. The ligation was then transformed into E. coli JM109 competent cells to construct the plasmid pESC-trp-PGal1-tHMGR-ePTS-TADH1. The plasmid pESC-trp-PGal1-tHMGR-ePTS-TADH1 and the fragment ERG10-ERG13-ePTS were double-digested with BamHI and XhoI, respectively. They were then ligated using Solution I, transformed into E. coli JM109, and screened to obtain the target plasmid pESC-trp-PGal10-ERG10-ERG13-ePTS-TCYC1-PGal1-tHMGR-ePTS-TADH1, resulting in vector 3-1.

[0093] (4) Construction of recombinant vector pESC-trp1-PGal10-ERG13-ERG10-ePTS-TCYC1-PGal1-tHMGR-ePTS-TAD H1

[0094] The genes ERG13 and ERG10 are fused via the GGGS Linker. The fusion is performed in the order ERG13-ERG10, specifically: using the *S. cerevisiae* genome as a template, PCR amplification is performed using primers ERG13-F1 and ERG13-R1 to obtain fragment ERG13. The downstream primer ERG13-R1 contains the gene sequence of the GGGS Linker and the 10bp upstream homologous arm sequence of gene ERG10. Using the *S. cerevisiae* genome as a template, PCR amplification is performed using primers ERG10-F1 and ERG10-R2 to obtain fragment ERG10-ePTS. The upstream primer ERG10-F1 contains the gene sequence of the GGGS Linker and the 10bp downstream homologous arm sequence of gene ERG13. Using fragments ERG13 and ERG10-ePTS as templates, and primers ERG13-F1 and ERG10-R2, the fragment ERG13-ERG10-ePTS was amplified by fusion PCR.

[0095] Using the genome of S. cerevisiae as a template, the fragment tHMGR-ePTS was amplified by PCR using primers tHMGR-F1 and tHMGR-R2. The pESC-trp plasmid and the tHMGR-ePTS fragment were digested with NotI and SacI, respectively, and ligated using SolutationI ligase. The ligation was then transformed into E. coli JM109 competent cells to construct the plasmid pESC-trp-PGal1-tHMGR-ePTS-TADH1. The plasmid pESC-trp-PGal1-tHMGR-ePTS-TADH1 and the fragment ERG13-ERG10-ePTS were double-digested with BamHI and XhoI, respectively. They were then ligated using Solution I, transformed into E. coli JM109, and screened to obtain the target plasmid pESC-trp-PGal10-ERG13-ERG10-ePTS-TCYC1-PGal1-tHMGR-ePTS-TADH1, resulting in vector 3-2.

[0096] (5) Construction of recombinant vector pESC-ura3-PGal10-ERG20ww-ePTS-TCYC1-PGal1-tLS-ePTS-TADH1

[0097] Using the genome of S. cerevisiae as a template, the fragment tLS-ePTS was amplified by PCR using primers tLS-F1 and tLS-R2. The pESC-ura3 plasmid and the tLS-ePTS fragment were digested with NotI and SacI, respectively. They were ligated using Solution I ligase and then transformed into E. coli JM109 competent cells to construct the plasmid pESC-ura3-PGal1-ERG8-ePTS-TADH1. Using the genome of *S. cerevisiae* as a template, PCR amplification was performed using primers ERG20ww-F1 and ERG20ww-R2 to obtain the fragment ERG20ww-ePTS. The plasmid pESC-ura3-PGal1-ERG8-ePTS-TADH1 and the fragment ERG20ww-ePTS were double-digested with BamHI and XhoI, respectively. The fragments were ligated using Solution I, transformed into *E. coli* JM109, and screened to obtain the target plasmid pESC-his-PGal10-ERG20ww-ePTS-TCYC1-PGal1-tLS-ePTS-TADH1, resulting in vector 4.

[0098] (6) Recombinant plasmid TS-GAL80-gda-URA3

[0099] Using GAL80-F and GAL80-R as primers and the S. cerevisiae BY4741 genome as a template, a 1308 bp GAL80 gene fragment was amplified by PCR and recovered by gel extraction. This fragment was ligated into pMD 19T Simple, and the ligation product was chemically transformed into E. coli JM109. The resulting product was plated on LB agar plates containing ampicillin-resistant culture medium and incubated at 37°C for 12 h. Single colonies were verified by enzyme digestion to obtain the recombinant plasmid TS-GAL80. Using primers Re-GAL80-F and Re-GAL80-R, and with plasmid TS-GAL80 as a template, the Re-GAL80 fragment was amplified by PCR. The plasmid TS-HO was digested with XbaI to obtain the gda-ura3 fragment. The Re-GAL80 fragment was digested with XbaI and then ligated with the gda-ura3 fragment to obtain the plasmid TS-GAL80-gda-ura3, resulting in vector 5.

[0100] 2. Construction of recombinant brewing yeast

[0101] Recombinant vector 1, recombinant vector 2, recombinant vector 3-1, and recombinant vector 4 were introduced into S. cerevisiae BY4741 to prepare recombinant Saccharomyces cerevisiae, which was named S. cerevisiae HY-PER-01.

[0102] Recombinant vectors 1, 2, 3-2, and 4 were introduced into S. cerevisiae BY4741 to prepare recombinant Saccharomyces cerevisiae, which was named S. cerevisiae HY-PER-02.

[0103] 3. Construction of recombinant brewer's yeast after chassis cell modification

[0104] (1) The constructed vector 5 (plasmid TS-GAL80-gda-URA3) was transformed into S. cerevisiae BY4741 to obtain the recombinant strain S. cerevisiae BY4741ΔGAL80.

[0105] The recombinant strain was plated on a 5-fluoroorotic acid plate, and the URA3 selection marker was popped to obtain the strain S. cerevisiae BY4741ΔGAL80ΔURA3.

[0106] (2) Recombinant vector 1, recombinant vector 2, recombinant vector 3-1 and recombinant vector 4 were introduced into S. cerevisiae BY4741ΔGAL80ΔURA3 to prepare recombinant brewer's yeast, named S. cerevisiae HY-PER-03.

[0107] Example 2: Effects of different recombinant brewing yeasts on limonene yield

[0108] The specific steps are as follows:

[0109] (1) The recombinant strains S. cerevisiae HY-PER-01, S. cerevisiae HY-PER-02 and S. cerevisiae HY-PER-03 prepared in Example 3 were streaked on MM solid medium to obtain single colonies. Single colonies were picked and inoculated into 100 mL Erlenmeyer flasks containing 20 mL of MM liquid medium and cultured at 30 °C and 200 r / min for 24 h to obtain seed liquids.

[0110] (2) The seed liquid prepared in step (1) was inoculated into 250 mL Erlenmeyer flasks containing 30 mL SG liquid culture medium at an inoculation amount of OD = 0.5, and cultured at 30 °C and 200 r / min for 120 h to prepare fermentation broth.

[0111] (3) Take the fermentation broth from step (2) and centrifuge it in a 50 mL centrifuge tube at 12000 rpm for 10 min. After centrifugation, obtain the organic layer. Add anhydrous sodium sulfate and let it stand for 1-2 h to remove water. Use a syringe to draw 1 mL of the upper dodecane organic phase, filter it through a filter membrane, and use it for GC-MS analysis. The limonene yield is as follows: Figures 2-3 , Figure 6 As shown.

[0112] The results show:

[0113] (1) The limonene production of the recombinant strain S. cerevisiae HY-PER-01 increased from 20.85 mg / L in S. cerevisiae HY-PER-02 to 24.60 mg / L, which is 1.18 times that of strain S. cerevisiae HY-PER-02. Figure 3 The results showed that, compared with the fusion protein gene ERG13-ERG10, the overexpression of the fusion protein gene ERG10-ERG13 was more beneficial to the production of limonene.

[0114] (2) The recombinant strain S. cerevisiae HY-PER-02 provided by this invention has a concentration of 20.85 mg / L. This indicates that overexpression of key enzymes in the limonene synthesis pathway plays a positive role in its efficient synthesis.

[0115] Example 3: The impact of preliminary carbon source optimization on limonene yield

[0116] The specific steps are as follows:

[0117] 1. Optimization of carbon source for recombinant strain S. cerevisiae HY-PER-01

[0118] (1) The recombinant strain S. cerevisiae HY-PER-01 prepared in Example 1 was streaked on MM solid medium to obtain single colonies. Single colonies were picked and inoculated into 100 mL Erlenmeyer flasks containing 20 mL SD liquid medium and cultured at 30 °C and 200 r / min for 24 h to obtain seed liquid.

[0119] (2) The seed liquid prepared in step (1) was inoculated into 250 mL Erlenmeyer flasks containing 30 mL of SG liquid medium containing 2% galactose, 2% galactose + 1% raffinose and 4% galactose + 2% raffinose respectively at an inoculation amount of OD = 0.5. The flasks were cultured at 30℃ and 200 r / min for 120 h to prepare fermentation broths.

[0120] (3) Take the fermentation broth from step (2) and centrifuge it in a 50 mL centrifuge tube at 12000 rpm for 10 min. After centrifugation, obtain the organic layer. Add anhydrous sodium sulfate and let it stand for 1-2 h to remove water. Use a syringe to draw 1 mL of the upper dodecane organic phase, filter it through a filter membrane, and use it for GC-MS analysis. The limonene yield is as follows: Figure 4 As shown.

[0121] The results show:

[0122] When fermented for 120 hours with 2% galactose as the carbon source, the yield of limonene was only 24.61 mg / L.

[0123] Adding 1% raffinose to 2% galactose as a carbon source to improve the growth of S. cerevisiae cells resulted in a limonene yield of 48.86 mg / L, which was 1.98 times higher than when only 2% galactose was used.

[0124] Using 4% galactose and 2% raffinose as carbon sources significantly enhanced cell growth and increased maximum bacterial concentration (OD). 600 The yield reached 26.20 mg / L, and the limonene yield reached 62.20 mg / L, which was 2.52 times that of using only 2% galactose.

[0125] The above results indicate that high concentrations of carbon sources can significantly enhance limonene production.

[0126] 2. Optimization of carbon source for recombinant strain S. cerevisiae HY-PER-03

[0127] The specific steps are as follows:

[0128] 1. Optimization of carbon source for recombinant strain S. cerevisiae HY-PER-03

[0129] (1) The recombinant strain S. cerevisiae HY-PER-03 prepared in Example 3 was streaked on MM solid medium to obtain single colonies. Single colonies were picked and inoculated into 100 mL Erlenmeyer flasks containing 20 mL SD liquid medium and cultured at 30 °C and 200 r / min for 24 h to obtain seed liquid.

[0130] (2) The seed liquid prepared in step (1) was inoculated into 250 mL Erlenmeyer flasks containing 30 mL of SD liquid medium with carbon source replaced by 20 g / L glucose, 40 g / L glucose and 60 g / L glucose respectively at an inoculation amount of OD=0.5. The flasks were cultured at 30℃ and 200 r / min for 120 h to prepare fermentation broth.

[0131] (3) Take the fermentation broth from step (2) and centrifuge it in a 50 mL centrifuge tube at 12000 rpm for 10 min. After centrifugation, obtain the organic layer. Add anhydrous sodium sulfate and let it stand for 1-2 h to remove water. Use a syringe to draw 1 mL of the upper dodecane organic phase, filter it through a filter membrane, and use it for GC-MS analysis. The limonene yield is as follows: Figure 6 As shown.

[0132] The results show:

[0133] When 20 g / L glucose was used as the carbon source, the cell concentration OD600 was 16.53, and the limonene yield was 58.92 mg / L. When the glucose concentration was increased to 40 g / L, the cell concentration OD600 reached 20.02, and the limonene yield increased to 69.45 mg / L. When the glucose concentration was further increased to 60 g / L, the cell concentration OD600 reached 25.13, and the limonene yield reached as high as 86.74 mg / L, which was 1.47 times that of the 20 g / L glucose.

[0134] Example 4: Construction of perilla acid producing strain

[0135] The specific steps are as follows:

[0136] 1. Construction of recombinant strains

[0137] (1) Using ROX1-F and ROX1-R as primers and the Saccharomyces cerevisiae genome (NCBI number: 559292) as template, the ROX1 gene fragment was amplified by PCR and the gel was recovered for later use.

[0138] The above fragment was ligated with pMD 19T Simple, and the ligation product was transformed into E. coli JM109 by chemical transformation. The product was then plated on LB solid medium plates containing ampicillin resistance and incubated at 37°C for 12–16 h. The resulting single colonies were verified by enzyme digestion to obtain the recombinant plasmid, which was named TS-ROX1.

[0139] Using primers Re-ROX1-F and Re-ROX1-R, and with plasmid TS-ROX1 as a template, the Re-ROX1 fragment was amplified by PCR. The plasmid TS-HO-gda-ura3 (previously constructed in the laboratory, Jiang Hui, Zhang Lihua, Xia Yuanyuan, et al. Modification of the metabolic pathway for fatty acid ethyl ester production in Saccharomyces cerevisiae [J]. Journal of Food and Biotechnology, 2022, 41(02):94-105.) was digested with XbaI to obtain the gda-URA3 fragment. The Re-ROX1 fragment was then ligated to the gda-URA3 fragment to obtain the plasmid TS-ROX1-gda-URA3.

[0140] Using primers CYP71A76-F and CYP7176-R, and with PUC57-CYP71A76 (synthesized by Genewiz) as a template, the CYP71A76 fragment was obtained by PCR amplification. Using primers CPR-F and CPR-R, and with PUC57-CPR (synthesized by Genewiz) as a template, the CYP71A76 fragment and the cytochrome P450 reductase CPR (NCBI ID: 829144) fragment were obtained by PCR amplification.

[0141] The CYP71A76 fragment was digested with NotⅠ and SacⅠ and ligated with plasmid TS-HO-gda-ura3 (previously constructed in the laboratory, Jiang Hui, Zhang Lihua, Xia Yuanyuan, et al. Modification of the metabolic pathway of fatty acid ethyl ester production in Saccharomyces cerevisiae [J]. Journal of Food and Biotechnology, 2022, 41(02):94-105.) to obtain plasmid TS-HO-CYP7A76. Then, TS-HO-CYP7A76 and fragment CPR were digested and ligated with BamHI and XhoⅠ to obtain plasmid TS-HO-CYP71A76-CPR. After amplification of TS-HO-CYP71A76-CPR with primers ADH1-F and CYC1-R, it was ligated with fragment ROX1-gda-URA3 in one step to obtain plasmid TS-ROX1-gda-URA3-CYP71A76-CPR.

[0142] The primer sequences involved are shown in Table 1:

[0143] Table 1: Primer sequences

[0144] ROX1-F GGACTAGTATGAATCCTAAATCCTCTAC SpeI ROX1-R GGACTAGTTCATTTCGGAGAAACTAGG SpeI Re-ROX1-F GCTCTAGAGTAACTACAACTACCACATCC XbaI Re-ROX1-R GCTCTAGAGTTGCTGCTGCTGTTGCT XbaI CYP71A76-F ATTTGCGGCCGCATGGCCGCTT TATTGCTCCTTA NotⅠ CYP71A76-R CGAGCTCATAAGCTCTT GGAGTAGTAA CAACCA SacⅠ CPR-F CGGGATCCATGTCTTCCT CCTCTTCCTC TTC BamHⅠ CPR-R CCGCTCGAGTTACCAAACATCTCTCAAGTATCTACC XhoI ADH1-F GGCCTCTTCGCTATTACGCCAGCTGAATTGGAGCGACCTCA CYC1-R TGACTGCTGTTGTTGATAATGGCTTCGAGCGTCCCAAAACCT

[0145] (2) The recombinant plasmid TS-ROX1-gda-URA3-CYP71A76-CPR obtained in step (1) was transformed into S. cerevisiae HY-PER-01 prepared in Example 3 to construct S. cerevisiae HY-PA-01.

[0146] 2. Fermentation preparation of perilla acid

[0147] (1) The prepared recombinant strain S. cerevisiae HY-PA-01 was streaked on MM solid medium to obtain single colonies. Single colonies were picked and inoculated into 100 mL Erlenmeyer flasks containing 20 mL SD liquid medium and cultured at 30 °C and 200 r / min for 24 h to obtain seed liquid.

[0148] (2) The seed liquid prepared in step (1) was inoculated into a 250 mL Erlenmeyer flask containing 30 mL of SG liquid culture medium at an inoculation amount of OD = 0.5, and cultured at 30 °C and 200 r / min for 120 h to prepare fermentation broth.

[0149] (3) Take 5 mL of fermentation broth into a centrifuge tube, add 5 mL of ethyl acetate, shake the mixture thoroughly with a shaker, and then centrifuge at 5,000 rpm for 10 min. After centrifugation, take 3 mL of the upper organic phase into a centrifuge tube, add anhydrous sodium sulfate and let stand for 1 h to remove water. Then, take 1 mL of the upper ethyl acetate phase with a syringe, filter it through an organic filter membrane, and use it for gas chromatography analysis.

[0150] The results showed that perilla acid production was as follows: Figure 5 The concentration shown is 4.42 mg / L.

[0151] Therefore, the S. cerevisiae HY-PER-03 strain of the present invention has wide applications in the industrial production of limonene, and S. cerevisiae HY-PA-01 has reference value for the de novo synthesis of perillic acid by yeast strains.

[0152] Example 5: Construction of an integration framework for different modules

[0153] For specific construction methods, please refer to the Chinese invention patent application text with publication number CN114277040A.

[0154] (1) Construction of Module I:

[0155] The existing laboratory plasmid TS-HO was digested with NotⅠ and SacⅠ, and the 8.8kb fragment was recovered and used as a vector. It was then ligated with the ERG10 gene fragment using SolutionⅠ to obtain the recombinant plasmid TS-HO-gda-ura3-ERG10. The recombinant plasmid was then digested with BamHI and XhoⅠ, and the 8.7kb fragment was recovered and ligated with the tHMGR gene fragment to obtain the recombinant plasmid TS-HO-gda-ura3-ERG10-tHMGR. PCR amplification was performed using primers ADH1-F0 and CYC1-F0 to obtain fragment 1.

[0156] Fragment 2 was obtained by fusion PCR of promoter HXT7 with gene ERG13 and terminator PDC1 fragment.

[0157] LPP1 (encoding lipopylipase) was selected as the integration site. After exotaq polymerase PCR amplification of the LPP1 fragment, it was ligated with 19T Simple to obtain plasmid TS-LPP1. PCR amplification using primers Re-LPP-F and Re-LPP-R yielded fragment 3, which was used as a vector. Fragment 3 was digested with XbaI and ligated with the gda-ura3 fragment to obtain the recombinant plasmid TS-LPP1-gda-ura3.

[0158] The recombinant plasmid was further digested with HindIII and ligated with fragment 2 to obtain TS-LPP1-gda-ura3-ERG13. The newly obtained plasmid was then digested with BssH II and ligated with fragment 1 to obtain the target plasmid TS-LPP1-gda-ura3-ERG13-ERG10-tHMGR. The target plasmid TS-LPP1-gda-ura3-ERG13-ERG10-tHMGR was then double-digested with SalI and SpeI to obtain the integration frame LPP-gda-ura3-P. TEF1 -ERG10-T ADH1 -P TDH3 -tHMGR-T CYC1 -P HXT7 -ERG13-T PDC1 -LPP.

[0159] (2) Construction of Module II

[0160] The plasmid TS-HO was double-digested with BamHI and XhoI, and then ligated to the genes IDI1 and ERG8, respectively, to obtain the recombinant plasmids TS-HO-ERG8 and TS-HO-IDI1. Then, the recombinant plasmids were double-digested with NotI and SacI, and ligated to the genes ERG12 and MVD1, respectively, to obtain the plasmids TS-HO-ERG8-ERG12 and TS-HO-IDI1-MVD1.

[0161] DPP1 (encoding diacylglycerol pyrophosphatase) was selected as the integration site. After PCR amplification of the DPP1 fragment using Ex Taq polymerase, it was ligated with 19T Simple to obtain plasmid TS-DPP1. Fragment 4 was amplified by PCR using primers Re-DPP1-F and Re-DPP1-R and used as a vector. Fragment 4 was digested with Xba I, cleaned with a PCR cleaning kit, and then ligated with the gda-ura3 fragment to obtain plasmid TS-DPP1-gda-ura3.

[0162] First, TS-DPP1-gda-ura3 was digested with SalI. After thorough digestion, it was recovered using a PCR cleaning kit and then digested with SpeI to obtain fragment 5, which was used as a vector. TS-HO-ERG8-ERG12 was amplified by PCR using primers ADH-F1 and CYC1-R1 to obtain fragment 6. Fragment 6 was digested with SalI and SpeI to remove sticky ends, and then ligated to fragment 5 to construct the plasmid TS-DPP1-gda-ura3-ERG8-ERG12.

[0163] First, TS-DPP1-gda-ura3-ERG8-ERG12 was digested with ApaI. After thorough digestion, it was recovered using a PCR cleaning kit and then digested with BlnI to obtain fragment 7, which was used as a vector. TS-HO-IDI1-MVD1 was amplified by PCR using primers ADH-R1 and CYC1-F1 to obtain fragment 8. Fragment 8 was digested with ApaI and BlnI to remove sticky ends, and then ligated to fragment 7 to construct the plasmid TS-DPP1-gda-ura3-ERG8-ERG12-IDI1-MVD1. The plasmid TS-DPP1-gda-ura3-ERG8-ERG12-IDI1-MVD1 was digested with BssHII to obtain the integration frame DPP-gda-ura3-P. TEF1 -MVD1-T ADH1- P TDH3 -IDI1-T CYC1 -P TEF1 -ERG12-ADH1-P TDH3 -ERG8-T CYC1 -DP P.

[0164] (3) Construction of Module III

[0165] The plasmid TS-HO was double-digested with BamHI and XhoI, and the 8.8 kb fragment was then recovered by gel electrophoresis and ligated with the gene ERG20ww to obtain the recombinant plasmid TS-HO-gda-ura3-ERG20ww. The plasmid TS-HO-gda-ura3-ERG20ww was then double-digested with NotI and SacI, and the 8.5 kb fragment was then recovered by gel electrophoresis and ligated with the gene tLS to obtain the target plasmid TS-HO-gda-ura3-ERG20ww-tLS. The target plasmid TS-HO-gda-ura3-ERG20ww-tLS was then double-digested with SalI and SpeI to obtain the integration frame HO-gda-ura3-P. TEF1 -tLS-T ADH1 -P TDH3 -ERG20ww-T CYC1 -HO.

[0166] The primer sequences involved are shown in Table 2:

[0167] Table 2: Primer sequences

[0168]

[0169]

[0170] The PCR reaction system is shown in Table 3:

[0171] Table 3: Preparation of PCR system

[0172]

[0173] Example 6: The effects of compartmentalization and modularization on limonene

[0174] For specific construction methods, please refer to the Chinese invention patent application text with publication number CN114277040A.

[0175] The specific steps are as follows:

[0176] The expression cassette of module III prepared in Example 5 was concentrated by ethanol precipitation and then transferred into *S. cerevisiae* BY4741 via lithium acetate conversion. The cassette was plated on MM solid medium and incubated at 30°C for 2–3 days. The correctly verified strains were named *S. cerevisiae* Lim01 (located in the cytoplasm) and *S. cerevisiae* Lim02 (located in the peroxisome). Using *S. cerevisiae* Lim01 as the starting strain, overexpression of module I in the cytoplasm yielded the recombinant strain *S. cerevisiae* Lim03; overexpression of module II yielded strain S. cerevisiae* Lim05; and overexpression of both modules I and II yielded the recombinant strain S. cerevisiae* Lim07. Starting with S. cerevisiae Lim02, recombinant strain S. cerevisiae Lim04 was obtained by overexpressing module I in peroxisomes; strain S. cerevisiae Lim06 was obtained by overexpressing module II; and recombinant strain S. cerevisiae Lim08 was obtained by overexpressing both modules I and II.

[0177] Limonene production such as Figure 1As shown, the limonene yield of S. cerevisiae Lim01 was 0.02 mg / L, and that of S. cerevisiae Lim02 was 0.038 mg / L. This indicates that the peroxisome compartmentalized expression genes ERG20ww and tLS promote limonene synthesis in S. cerevisiae. Overexpression of module I increased the limonene yield of strain S. cerevisiae Lim03 by 13-fold compared to the control strain S. cerevisiae Lim01, and the limonene yield of strain S. cerevisiae Lim04 by 16.78-fold compared to the control strain S. cerevisiae Lim02. Overexpression of module II increased the limonene yield of strain S. cerevisiae Lim05 by 6.80-fold compared to the control strain S. cerevisiae Lim01, and the limonene yield of strain S. cerevisiae Lim06 by 11.47-fold compared to the control strain S. cerevisiae Lim02. Meanwhile, overexpression of modules I and II increased the limonene yield of strain S. cerevisiae Lim06 by 22 times compared to the control strain S. cerevisiae Lim01. The limonene yield of strain S. cerevisiae Lim08 reached 1.14 mg / L, a 30-fold increase compared to the control strain S. cerevisiae Lim02. This indicates that expression of both modules I and II promotes limonene yield, but the promoting effect of module I is superior to that of module II. This may be because the HMGR gene, as the rate-limiting step in the MVA pathway, can effectively increase the synthesis of the precursor geranyl pyrophosphate (GPP) by expressing a truncated 3-hydroxy-3-methylglutaryl-Co reductase (gene tHMGR).

[0178] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A recombinant brewing yeast, characterized in that, The recombinant Saccharomyces cerevisiae was based on Saccharomyces cerevisiae BY4741, which integrated the cytochrome P450 oxidase CYP71A76 gene and the cytochrome P450 oxidase coenzyme CPR gene from Salvia miltiorrhiza into its genome, with the GAL80 gene and URA3 gene knocked out from the genome of the chassis cells. The following genes, with the nucleotide sequence shown in SEQ ID NO. 6 linked to the 3' end of each gene respectively, were overexpressed: acetyl-CoA thiolase gene ERG10, HMG-CoA synthase gene ERG13, HMG-CoA reductase gene tHMGR, mevalonate kinase gene ERG12, mevalonate phosphate kinase gene ERG8, mevalonate diphosphate kinase MVD1, isopentenyl pyrophosphate isomerase IDI1, and farnesyl pyrophosphate synthase ERG20ww from *Saccharomyces cerevisiae*, and a truncated limonene synthase tLS from *Spearmintum*; the acetyl-CoA thiolase gene ERG10 is numbered 856079 in NCBI; the HMG-CoA synthase... The NCBI accession number for gene ERG13 is 854913; the NCBI accession number for HMG-CoA reductase gene tHMGR is 851171; the NCBI accession number for mevalonate kinase gene ERG12 is 855248; the NCBI accession number for mevalonate phosphate kinase gene ERG8 is 855260; the NCBI accession number for mevalonate diphosphate kinase MVD1 is 855779; the NCBI accession number for isopentenyl pyrophosphate isomerase IDI1 is 855986; and the NCBI accession number for cytochrome P450 oxidase coenzyme CPR is 829144. The farnesyl pyrophosphate synthase mutant gene ERG20ww is formed by mutating phenylalanine at position 95 and asparagine at position 126 of ERG20 to tryptophan. The NCBI number for ERG20 is 853272. The truncated limonene synthase tLS is NCBI number JX555965. The nucleotide sequence encoding the cytochrome P450 oxidase CYP71A76 is shown in SEQ ID NO.

1. The recombinant Saccharomyces cerevisiae was expressed using pESC plasmid as the expression vector; the genes ERG13 and ERG10 were fused using GGGSLinker; and the fusion was performed in the order of ERG10-ERG13.

2. A method for producing perillic acid, characterized in that, The method involves adding the recombinant brewing yeast of claim 1 to a reaction system containing glucose, and fermenting to prepare perilla acid.

3. The method according to claim 2, characterized in that, The method involves inoculating recombinant Saccharomyces cerevisiae seed culture into a 250 mL Erlenmeyer flask containing 30 mL of SG liquid culture medium at an inoculation rate of OD=0.5, and culturing at 30℃ and 200 r / min for 120 h to prepare perillic acid through fermentation.

4. The use of the recombinant brewing yeast of claim 1 in the preparation of perillic acid or products containing perillic acid.

Citation Information

Patent Citations

  • Construction method and application of strain for efficiently synthesizing beta-carotene

    CN114277040A

  • Method for generating perillic acid by converting limonene with yarrowia lipolytica

    CN113801899A

  • Yeast for producing D-limonene and application thereof

    CN114606146A