Recombinant kod polymerase

By modifying the KOD DNA polymerase with mutants, the problems of short read length and slow reaction rate in SBS sequencing were solved, achieving a faster catalytic reaction rate and shorter reaction time, thus improving sequencing efficiency and accuracy.

CN116547387BActive Publication Date: 2026-06-05SHENZHEN HUADA GENE INST
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202080106469.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2020-10-21
Publication Date
2026-06-05
Estimated Expiration
2040-10-21

AI Technical Summary

Technical Problem

Existing SBS sequencing technology suffers from short read lengths and slow reaction rates, especially when using KOD DNA polymerase.

Method used

By performing kinetic simulations and statistical inferences on the palm, finger, and thumb regions of KOD DNA polymerase, experimental protocols were designed, an enzyme variant library was constructed, and high-throughput screening was conducted to obtain DNA polymerase mutants with improved catalytic and physicochemical properties, suitable for chip-based DNB sequencing.

Benefits of technology

It improved the catalytic reaction rate of DNA polymerase, shortened the sequencing reaction time, and enhanced the efficiency and accuracy of sequencing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure GDA0004188134690000201
    Figure GDA0004188134690000201
  • Figure GDA0004188134690000211
    Figure GDA0004188134690000211
  • Figure GDA0004188134690000321
    Figure GDA0004188134690000321
Patent Text Reader

Abstract

A kind of recombinant KOD polymerase.A KOD polymerase mutant, a protein, as follows: for the amino acid residue in the 267, 326, 347, 349, 353, 375, 378, 379, 380, 385, 451, 452, 453, 454, 457, 461, 465, 470, 474, 477, 478, 479, 480, 482, 484, 485, 486, 493, 496, 497, 514, 574, 584, 605, 610, 630, 665, 666, 667, 674, 676, 680, 682, 698, 707, 718, 723 and 729 of KOD DNA polymerase GH78 amino acid sequence at least one of the 48 positions is modified, other amino acid sequences are unchanged, obtain the protein with DNA polymerase activity;Compared with KOD DNA polymerase GH78, the recombinant DNA polymerase shows stronger reaction rate, better catalytic efficiency, better affinity and other advantages in catalysis, improves the reaction rate of DNA polymerase in sequencing, increases reaction read length.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more particularly to a recombinant KOD polymerase. Background Technology

[0002] DNA polymerases rapidly and accurately replicate DNA, playing a crucial role in the precise transmission of genetic information and the maintenance of genetic material stability in living organisms. There are five types of DNA polymerases in *E. coli*, further classified into types A, B, and C based on sequence homology. The overall folded structure of DNA polymerases resembles a human hand, consisting of the palm, thumb, and fingers. While the structures of the finger and palm domains vary considerably among different types of DNA polymerases, the catalytic palm region shows relatively little difference. The main amino acid sequences of the active sites of DNA polymerases are conserved; however, these conserved active sites are also relatively easy to modify. Non-natural specific dNTPs can be added without significantly reducing DNA polymerase activity (see patent number PCT / CN2018 / 103764).

[0003] KOD DNA polymerase belongs to the B-family of DNA polymerases and is a heat-resistant DNA polymerase capable of rapid and accurate DNA replication. It has a wide range of applications, one of the most important being genome sequencing, such as SBS sequencing. SBS sequencing uses nucleotides modified with a 3' sugar hydroxyl group to block the addition of other nucleotides. Using nucleotides with a 3' blocking group allows for controlled incorporation of nucleotides into polynucleotide chains. After each nucleotide is added, the presence of the 3' blocking group prevents the addition of other nucleotides into the chain. After removing the blocking group, the naturally free 3' hydroxyl group is restored for the addition of the next nucleotide. However, SBS sequencing currently faces many technical challenges, such as short read lengths and slow reaction rates.

[0004] Invention disclosure

[0005] This invention aims to further accelerate biochemical reaction steps and shorten reaction time in sequencing. Building upon previous work, it further modifies the KOD DNA polymerase, protecting the original functional sites of the DNA polymerase B family in this region to ensure it can still perform its original basic functions. Based on kinetic simulations and statistical inferences of the palm, finger, and thumb regions of the KOD polymerase, this invention obtains mutation sites suitable for experimental screening. An experimental protocol was designed, employing semi-rational design, enzyme variant library construction, and high-throughput screening to improve the catalytic and physicochemical properties of the polymerase, developing a DNA polymerase suitable for DNB sequencing attached to the chip surface. Finally, the recombinant DNA polymerase was isolated and purified.

[0006] To obtain DNA polymerases with fast catalytic reaction rates or non-natural modified nucleotides with added 3' blocking groups in SBS sequencing, the present invention provides the following technical solutions:

[0007] One object of the present invention is to provide a KOD polymerase mutant.

[0008] The KOD polymerase mutant provided by this invention is a protein, as shown in A below, or a derivative thereof:

[0009] The protein shown in A) is obtained by modifying at least one amino acid residue from positions 267, 326, 347, 349, 353, 375, 378, 379, 380, 385, 451, 452, 453, 454, 457, 461, 465, 470, 474, 477, 478, 479, 480, 482, 484, 485, 486, 493, 496, 497, 514, 574, 584, 605, 610, 630, 665, 666, 667, 674, 676, 680, 682, 698, 707, 718, 723, and 729 of the amino acid sequence of KOD DNA polymerase GH78, while leaving the other amino acid sequences unchanged, to obtain a protein with DNA polymerase activity.

[0010] The amino acid sequence of the KOD DNA polymerase GH78 is sequence 1 in the sequence listing;

[0011] The derivative of the protein shown in A) is a protein derived from A) by adding a tag sequence to the end of the amino acid sequence of the protein shown in A) and having DNA polymerase activity.

[0012] Of the proteins mentioned above, the protein shown in A) can be as follows: [The text abruptly ends here, likely due to an incomplete sentence or missing information.] The GH78 amino acid sequence of DNA polymerase contains at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 1 amino acid sequence from the following 48 positions: 267, 326, 347, 349, 353, 375, 378, 379, 380, 385, 451, 452, 453, 454, 457, 461, 465, 470, 474, 477, 478, 479, 480, 482, 484, 485, 486, 493, 496, 497, 514, 574, 584, 605, 610, 630, 665, 666, 667, 674, 676, 680, 682, 698, 707, 718, 723, and 729. Modification with 0, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47 or all 48 amino acid residues yields a protein with DNA polymerase activity.

[0013] The modification is an amino acid substitution.

[0014] In the above protein, the various amino acid substitutions are as follows:

[0015] The 267th T is replaced with D;

[0016] The F in the 326th position is replaced with L;

[0017] The S at position 347 is replaced with D or V;

[0018] The 349th T is replaced with G;

[0019] The V in the 353rd position is replaced with D;

[0020] The K-amine at position 375 is replaced with I, A, or E;

[0021] The 378th A is replaced with E, Q, or K;

[0022] The 379th R is replaced with K, Q, E, H or Y;

[0023] The 380th R is replaced with E, D, S, G, N, or Y;

[0024] The 385th E is replaced with F or R;

[0025] The 451st position S is replaced with N, T, G, H, M, L, P, R, A, Q, or K;

[0026] The L at position 452 is replaced with V;

[0027] The L in the 453rd position is replaced with A, T, V or I;

[0028] The 454th bit G is replaced with Q;

[0029] The L at position 457 is replaced with M;

[0030] The Q at position 461 is replaced with either A or S;

[0031] The K at position 465 is replaced with Q;

[0032] The 470th position is T-permuted by S;

[0033] The L at position 474 is replaced with K, V, A, or T;

[0034] The 477th K is replaced with E;

[0035] The L at position 478 is mutated to I, V, Y, M, C, N, H, or G;

[0036] The L at position 479 mutates to M;

[0037] The D at position 480 is mutated to S, R, T, N, G, F, H, or E;

[0038] The R at position 482 mutates into K;

[0039] The R at position 484 is mutated to C, D, I, V, K, or G;

[0040] The E at position 485 mutates into I, C, or F;

[0041] The I at position 486 mutates into K or R;

[0042] The Y at position 493 mutates to F, H, or L;

[0043] The Y at position 496 mutates into either T or M;

[0044] The Y at position 497 mutates to L, F, M, I, or W;

[0045] The T at position 514 mutates into an A;

[0046] The A at position 574 mutates into L;

[0047] The K at position 584 mutates into T;

[0048] The T mutation at position 605 is either W or V;

[0049] The I at position 610 mutates to L or M;

[0050] The L at position 630 mutates to F;

[0051] The glutamic acid at position 665 is mutated to R, S, K, or C;

[0052] The asparagine at position 666 is mutated to A, N, Q, T, or K;

[0053] The T at position 667 is mutated to R, N, or S;

[0054] The K at position 674 is mutated to Q, M, I, E, or R;

[0055] The K mutation at position 676 is S, L, R, H, V, I, M, A, or T;

[0056] The M at position 680 is mutated to I, L, T, or A;

[0057] The V at position 682 mutates to M;

[0058] The V at position 698 mutates to I;

[0059] The S at position 707 is mutated to G, T, or K;

[0060] The D at position 718 mutates to Q;

[0061] The T mutation at position 723 is replaced by V, C, G, I, or F;

[0062] The A at position 729 mutates to T.

[0063] The protein mentioned above is any one of the following:

[0064] The names of KOD DNA polymerase mutants and their mutation locations are as follows:

[0065] Specifically, at least one amino acid residue from positions 267, 326, 347, 349, 353, 375, 378, 379, 380, 385, 451, 452, 453, 454, 457, 461, 465, 470, 474, 477, 478, 479, 480, 482, 484, 485, 486, 493, 496, 497, 514, 574, 584, 605, 610, 630, 665, 666, 667, 674, 676, 680, 682, 698, 707, 718, 723, and 729 in the amino acid sequence of the KOD DNA polymerase GH78 is modified, while the other amino acid sequences remain unchanged, to obtain a protein with DNA polymerase activity; an example is as follows:

[0066] The amino acid sequence of GH101 is obtained by mutating D to N at the 480th position of sequence 1, while keeping the other amino acid residues unchanged;

[0067] The amino acid sequence of GH102 is obtained by mutating K to H at position 676 of sequence 1, while keeping other amino acid residues unchanged;

[0068] The amino acid sequence of GH103 is obtained by mutating E to I at position 485 of sequence 1, while keeping other amino acid residues unchanged;

[0069] The amino acid sequence of GH104 is obtained by mutating Y to L at the 497th position of sequence 1, while keeping other amino acid residues unchanged;

[0070] The amino acid sequence of GH105 is obtained by mutating S to Q at the 451st position of sequence 1, while keeping other amino acid residues unchanged;

[0071] The amino acid sequence of GH106 is obtained by mutating R to K at the 482nd position of sequence 1, while keeping the other amino acid residues unchanged;

[0072] The amino acid sequence of GH107 is obtained by mutating L to V at position 453 of sequence 1, while keeping other amino acid residues unchanged.

[0073] The amino acid sequence of GH108 is obtained by mutating I to T at position 474 of sequence 1, while keeping other amino acid residues unchanged;

[0074] The amino acid sequence of GH109 is obtained by mutating T to D at position 267 of sequence 1, while keeping other amino acid residues unchanged;

[0075] The amino acid sequence of GH110 is obtained by mutating T to V at position 723 of sequence 1, while keeping other amino acid residues unchanged;

[0076] GH111 has an amino acid sequence in which the R at position 379 of sequence 1 is mutated to Y, while the other amino acid residues remain unchanged;

[0077] The amino acid sequence of GH112 is obtained by mutating L to I at position 453 of sequence 1, while keeping other amino acid residues unchanged;

[0078] The amino acid sequence of GH113 is obtained by mutating I to K at position 474 of sequence 1, while keeping other amino acid residues unchanged;

[0079] The amino acid sequence of GH114 is obtained by mutating V to D at position 353 of sequence 1, while keeping other amino acid residues unchanged;

[0080] The amino acid sequence of GH115 is obtained by mutating S to D at sequence 347 of sequence 1, while keeping other amino acid residues unchanged;

[0081] The amino acid sequence of GH116 is obtained by mutating K to Q at position 465 of sequence 1, while keeping other amino acid residues unchanged;

[0082] The amino acid sequence of GH117 is obtained by mutating R to D at the 380th position of sequence 1, while keeping other amino acid residues unchanged;

[0083] GH118 has an amino acid sequence in which the Q at position 461 of sequence 1 is mutated to A, while the other amino acid residues remain unchanged;

[0084] The amino acid sequence of GH119 is obtained by mutating I to L at the 610th position of sequence 1, while keeping the other amino acid residues unchanged;

[0085] The amino acid sequence of GH120 is obtained by mutating T to G at position 723 of sequence 1, while keeping other amino acid residues unchanged;

[0086] The amino acid sequence of GH121 is obtained by mutating Y to M at the 496th position of sequence 1, while keeping other amino acid residues unchanged;

[0087] The amino acid sequence of GH122 is obtained by mutating K to A at position 375 of sequence 1, while keeping other amino acid residues unchanged;

[0088] The amino acid sequence of GH123 is obtained by mutating Y to I at the 497th position of sequence 1, while keeping other amino acid residues unchanged;

[0089] The amino acid sequence of GH124 is obtained by mutating I to A at position 474 of sequence 1, while keeping other amino acid residues unchanged;

[0090] The amino acid sequence of GH125 is obtained by mutating S to G at position 707 of sequence 1, while keeping other amino acid residues unchanged;

[0091] The amino acid sequence of GH126 is obtained by mutating R to E at position 379 of sequence 1, while keeping other amino acid residues unchanged;

[0092] The amino acid sequence of GH127 is obtained by mutating T to I at position 723 of sequence 1, while keeping other amino acid residues unchanged;

[0093] The amino acid sequence of GH128 is obtained by mutating Q to S at position 461 of sequence 1, while keeping other amino acid residues unchanged;

[0094] The amino acid sequence of GH129 is obtained by mutating D to Q at position 718 of sequence 1, while keeping other amino acid residues unchanged;

[0095] The amino acid sequence of GH131 is obtained by mutating L to V at position 452 of sequence 1, while keeping other amino acid residues unchanged;

[0096] The amino acid sequence of GH132 is obtained by mutating R to Y at the 380th position of sequence 1, while keeping other amino acid residues unchanged;

[0097] The amino acid sequence of GH133 is obtained by mutating L to V at position 478 of sequence 1, while keeping other amino acid residues unchanged.

[0098] The amino acid sequence of GH134 is obtained by mutating L to Y at the 478th position of sequence 1, while keeping the other amino acid residues unchanged;

[0099] The amino acid sequence of GH135 is obtained by mutating E to R at position 385 of sequence 1, while keeping other amino acid residues unchanged;

[0100] The amino acid sequence of GH136 is obtained by mutating I to V at position 474 of sequence 1, while keeping other amino acid residues unchanged;

[0101] The amino acid sequence of GH137 is obtained by mutating L to M at position 479 of sequence 1, while keeping other amino acid residues unchanged;

[0102] The amino acid sequence of GH138 is obtained by mutating M to L at position 680 of sequence 1, while keeping other amino acid residues unchanged;

[0103] The amino acid sequence of GH139 is obtained by mutating L to I at position 478 of sequence 1, while keeping other amino acid residues unchanged;

[0104] The amino acid sequence of GH140 is obtained by mutating T to C at position 723 of sequence 1, while keeping other amino acid residues unchanged;

[0105] The amino acid sequence of GH141 is obtained by mutating L to M at the 478th position of sequence 1, while keeping other amino acid residues unchanged;

[0106] The amino acid sequence of GH142 is obtained by mutating A to T at position 729 of sequence 1, while keeping other amino acid residues unchanged;

[0107] The amino acid sequence of GH143 is obtained by mutating I to M at the 610th position of sequence 1, while keeping other amino acid residues unchanged;

[0108] GH144 has an amino acid sequence in which the V at position 353 of sequence 1 is mutated to D, while the other amino acid residues remain unchanged.

[0109] The amino acid sequence of GH145 is obtained by mutating K to S at position 676 of sequence 1, while keeping other amino acid residues unchanged;

[0110] GH146 has an amino acid sequence in which F is mutated to L at position 326 of sequence 1, while other amino acid residues remain unchanged;

[0111] The amino acid sequence of GH147 is obtained by mutating A to L at the 574th position of sequence 1, while keeping the other amino acid residues unchanged;

[0112] GH148 has an amino acid sequence in which L is mutated to F at position 630 of sequence 1, while other amino acid residues remain unchanged;

[0113] The amino acid sequence of GH149 is obtained by mutating T to G at position 349 of sequence 1, while keeping other amino acid residues unchanged;

[0114] Specifically, at least two amino acid residues from positions 267, 326, 347, 349, 353, 375, 378, 379, 380, 385, 451, 452, 453, 454, 457, 461, 465, 470, 474, 477, 478, 479, 480, 482, 484, 485, 486, 493, 496, 497, 514, 574, 584, 605, 610, 630, 665, 666, 667, 674, 676, 680, 682, 698, 707, 718, 723, and 729 in the amino acid sequence of the KOD DNA polymerase GH78 are modified, while the other amino acid sequences remain unchanged, to obtain a protein with DNA polymerase activity; an example is as follows:

[0115] The amino acid sequence of KH222 is obtained by mutating E at position 485 of sequence 1 to I and S at position 451 to L, while keeping other amino acid residues unchanged.

[0116] KH223 has an amino acid sequence in which E at position 485 of sequence 1 is mutated to I, and serine at position 451 is mutated to threonine, while other amino acid residues remain unchanged.

[0117] The amino acid sequence of KH224 is obtained by mutating E at position 485 of sequence 1 to I and mutating D at position 484 to cysteine, while keeping other amino acid residues unchanged.

[0118] KH225 has an amino acid sequence in which E at position 485 of sequence 1 is mutated to I, and D at position 480 is mutated to threonine, while other amino acid residues remain unchanged.

[0119] KH226 has an amino acid sequence in which E at position 485 of sequence 1 is mutated to I, and serine at position 451 is mutated to glycine, while other amino acid residues remain unchanged.

[0120] The amino acid sequence of KH227 is obtained by mutating E at position 485 of sequence 1 to I and L at position 453 to A, while keeping other amino acid residues unchanged.

[0121] The amino acid sequence of KH228 is obtained by mutating E at position 485 of sequence 1 to C and mutating R at position 484 to V, while keeping other amino acid residues unchanged.

[0122] The amino acid sequence of KH229 is obtained by mutating E at position 485 of sequence 1 to C and S at position 451 to N, while keeping other amino acid residues unchanged.

[0123] The amino acid sequence of KH230 is obtained by mutating E at position 485 of sequence 1 to C and D at position 480 to N, while keeping other amino acid residues unchanged.

[0124] The amino acid sequence of KH232 is obtained by mutating E at position 485 of sequence 1 to C, and mutating R at position 484 to I, while keeping other amino acid residues unchanged.

[0125] The amino acid sequence of KH233 is obtained by mutating K at position 676 of sequence 1 to S and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0126] The amino acid sequence of KH234 is obtained by mutating E at position 485 of sequence 1 to C and I at position 486 to R, while keeping other amino acid residues unchanged.

[0127] KH235 has an amino acid sequence in which E at position 485 of sequence 1 is mutated to I, and D at position 480 is mutated to S, while other amino acid residues remain unchanged.

[0128] The amino acid sequence of KH236 is obtained by mutating Y at position 493 of sequence 1 to F and Y at position 497 to L, while keeping other amino acid residues unchanged.

[0129] The amino acid sequence of KH237 is obtained by mutating K at position 676 of sequence 1 to L and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0130] The amino acid sequence of KH238 is obtained by mutating E at position 485 of sequence 1 to I and D at position 480 to Q, while keeping other amino acid residues unchanged.

[0131] The amino acid sequence of KH239 is obtained by mutating E at position 485 of sequence 1 to I and D at position 480 to M, while keeping other amino acid residues unchanged.

[0132] The amino acid sequence of KH240 is obtained by mutating E at position 485 of sequence 1 to I and S at position 451 to K, while keeping other amino acid residues unchanged.

[0133] The amino acid sequence of KH241 is obtained by mutating E at position 485 of sequence 1 to I and D at position 480 to R, while keeping other amino acid residues unchanged.

[0134] The amino acid sequence of KH242 is obtained by mutating E at position 485 of sequence 1 to I and L at position 453 to N, while keeping other amino acid residues unchanged.

[0135] The amino acid sequence of KH243 is obtained by mutating K at position 676 of sequence 1 to R and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0136] The amino acid sequence of KH244 is obtained by mutating E at position 485 of sequence 1 to I and S at position 451 to M, while keeping other amino acid residues unchanged.

[0137] The amino acid sequence of KH245 is obtained by mutating E at position 485 of sequence 1 to I, and mutating K at position 477 to E, while keeping other amino acid residues unchanged.

[0138] The amino acid sequence of KH246 is obtained by mutating E at position 485 of sequence 1 to I and D at position 480 to W, while keeping other amino acid residues unchanged.

[0139] The amino acid sequence of KH247 is obtained by mutating E at position 485 of sequence 1 to I and D at position 480 to K, while keeping other amino acid residues unchanged.

[0140] KH248 has an amino acid sequence in which the E at position 485 of sequence 1 is mutated to I, and the S at position 451 is mutated to R, while the other amino acid residues remain unchanged.

[0141] The amino acid sequence of KH249 is obtained by mutating K at position 676 of sequence 1 to L, and mutating M at position 680 to L, while keeping other amino acid residues unchanged.

[0142] The amino acid sequence of KH250 is obtained by mutating E at position 485 of sequence 1 to I and Q at position 665 to R, while keeping other amino acid residues unchanged.

[0143] The amino acid sequence of KH251 is obtained by mutating E at position 485 of sequence 1 to I and Q at position 665 to S, while keeping other amino acid residues unchanged.

[0144] The amino acid sequence of KH252 is obtained by mutating E at position 485 of sequence 1 to I, and mutating D at position 480 to E, while keeping other amino acid residues unchanged.

[0145] The amino acid sequence of KH253 is obtained by mutating K at position 676 of sequence 1 to H and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0146] The amino acid sequence of KH254 is obtained by mutating E at position 485 of sequence 1 to I and Q at position 461 to A, while keeping other amino acid residues unchanged.

[0147] KH255 has an amino acid sequence in which the E at position 485 of sequence 1 is mutated to I, and the S at position 451 is mutated to A, while the other amino acid residues remain unchanged.

[0148] The amino acid sequence of KH256 is obtained by mutating E at position 485 of sequence 1 to I and S at position 451 to Q, while keeping other amino acid residues unchanged.

[0149] The amino acid sequence of KH257 is obtained by mutating E at position 485 of sequence 1 to I and mutating I at position 666 to Q, while keeping other amino acid residues unchanged.

[0150] The amino acid sequence of KH258 is obtained by mutating E at position 485 of sequence 1 to I and mutating I at position 666 to T, while keeping other amino acid residues unchanged.

[0151] The amino acid sequence of KH259 is obtained by mutating E at position 485 of sequence 1 to I and T at position 605 to W, while keeping other amino acid residues unchanged.

[0152] KH260 has an amino acid sequence in which the E at position 485 of sequence 1 is mutated to I, and the R at position 379 is mutated to Y, while the other amino acid residues remain unchanged.

[0153] KH261 has an amino acid sequence in which the E at position 485 of sequence 1 is mutated to I, and the L at position 453 is mutated to T, while the other amino acid residues remain unchanged.

[0154] The amino acid sequence of KH262 is obtained by mutating E at position 485 of sequence 1 to I and D at position 480 to C, while keeping other amino acid residues unchanged.

[0155] KH263 has an amino acid sequence in which the E at position 485 of sequence 1 is mutated to I, and the T at position 605 is mutated to V, while the other amino acid residues remain unchanged.

[0156] The amino acid sequence of KH264 is obtained by mutating E at position 485 of sequence 1 to I and D at position 480 to N, while keeping other amino acid residues unchanged.

[0157] KH266 has an amino acid sequence in which E at position 485 of sequence 1 is mutated to I, and D at position 480 is mutated to G, while other amino acid residues remain unchanged.

[0158] The amino acid sequence of KH267 is obtained by mutating K at position 465 of sequence 1 to Q and D at position 718 to Q, while keeping other amino acid residues unchanged.

[0159] KH268 has an amino acid sequence in which the E at position 485 of sequence 1 is mutated to I, and the R at position 379 is mutated to H, while the other amino acid residues remain unchanged.

[0160] The amino acid sequence of KH269 is obtained by mutating E at position 485 of sequence 1 to I and K at position 465 to Q, while keeping other amino acid residues unchanged.

[0161] KH270 has an amino acid sequence in which E at position 485 of sequence 1 is mutated to I, and D at position 480 is mutated to P, while other amino acid residues remain unchanged.

[0162] KH271 has an amino acid sequence in which E at position 485 of sequence 1 is mutated to I, and D at position 480 is mutated to F, while other amino acid residues remain unchanged.

[0163] The amino acid sequence of KH272 is obtained by mutating K at position 676 of sequence 1 to V and M at position 680 to L, while keeping other amino acid residues unchanged.

[0164] KH273 has an amino acid sequence in which E at position 485 of sequence 1 is mutated to I, and L at position 453 is mutated to V, while other amino acid residues remain unchanged.

[0165] The amino acid sequence of KH274 is obtained by mutating E at position 485 of sequence 1 to I and D at position 480 to H, while keeping other amino acid residues unchanged.

[0166] KH275 has an amino acid sequence in which the E at position 485 of sequence 1 is mutated to I, and the S at position 451 is mutated to P, while the other amino acid residues remain unchanged.

[0167] The amino acid sequence of KH276 is obtained by mutating E at position 485 of sequence 1 to I and Q at position 665 to K, while keeping other amino acid residues unchanged.

[0168] KH277 has an amino acid sequence in which the D at position 480 of sequence 1 is mutated to S, and the S at position 451 is mutated to Q, while the other amino acid residues remain unchanged.

[0169] KH278 has an amino acid sequence in which the 474th position I of sequence 1 is mutated to T, and the 478th position L is mutated to C, while the other amino acid residues remain unchanged.

[0170] The amino acid sequence of KH279 is obtained by mutating K at position 676 of sequence 1 to H and mutating M at position 680 to T, while keeping other amino acid residues unchanged.

[0171] KH280 has an amino acid sequence in which the E at position 485 of sequence 1 is mutated to I, and the S at position 347 is mutated to V, while the other amino acid residues remain unchanged.

[0172] KH281 has an amino acid sequence in which the D at position 480 of sequence 1 is mutated to N, and the L at position 453 is mutated to V, while the other amino acid residues remain unchanged.

[0173] The amino acid sequence of KH282 is obtained by mutating E at position 485 of sequence 1 to I, and mutating I at position 666 to A, while keeping other amino acid residues unchanged.

[0174] The amino acid sequence of KH283 is obtained by mutating K at position 676 of sequence 1 to V and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0175] The amino acid sequence of KH284 is obtained by mutating K at position 676 of sequence 1 to I and mutating M at position 680 to L, while keeping other amino acid residues unchanged.

[0176] The amino acid sequence of KH285 is obtained by mutating K at position 676 of sequence 1 to M, and mutating M at position 680 to A, while keeping other amino acid residues unchanged.

[0177] KH286 has an amino acid sequence in which the E at position 485 of sequence 1 is mutated to I, and the T at position 470 is mutated to S, while the other amino acid residues remain unchanged.

[0178] The amino acid sequence of KH287 is obtained by mutating K at position 676 of sequence 1 to L, and mutating M at position 680 to A, while keeping other amino acid residues unchanged.

[0179] KH288 has an amino acid sequence in which the R at position 379 of sequence 1 is mutated to K, and the R at position 380 is mutated to E, while the other amino acid residues remain unchanged.

[0180] The amino acid sequence of KH201 is obtained by mutating D at position 480 of sequence 1 to N and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0181] The amino acid sequence of KH202 is obtained by mutating I at position 474 of sequence 1 to T, and L at position 478 to N, while keeping other amino acid residues unchanged.

[0182] The amino acid sequence of KH203 is obtained by mutating I at position 474 of sequence 1 to T, and L at position 478 to H, while keeping other amino acid residues unchanged.

[0183] The amino acid sequence of KH204 is obtained by mutating E at position 485 of sequence 1 to I and mutating R at position 484 to K, while keeping other amino acid residues unchanged.

[0184] The amino acid sequence of KH205 is obtained by mutating Y at position 493 of sequence 1 to H and Y at position 497 to F, while keeping other amino acid residues unchanged.

[0185] The amino acid sequence of KH206 is obtained by mutating Y at position 493 of sequence 1 to F and Y at position 497 to M, while keeping other amino acid residues unchanged.

[0186] The amino acid sequence of KH207 is obtained by mutating T at position 514 of sequence 1 to A, and mutating K at position 584 to T, while keeping other amino acid residues unchanged.

[0187] The amino acid sequence of KH208 is obtained by mutating I at position 474 of sequence 1 to T, and L at position 478 to G, while keeping other amino acid residues unchanged.

[0188] The amino acid sequence of KH209 is obtained by mutating E at position 485 of sequence 1 to I and Q at position 665 to C, while keeping other amino acid residues unchanged.

[0189] The amino acid sequence of KH210 is obtained by mutating K at position 465 of sequence 1 to Q and K at position 584 to T, while keeping other amino acid residues unchanged.

[0190] The amino acid sequence of KH211 is obtained by mutating K at position 676 of sequence 1 to M, and mutating M at position 680 to L, while keeping other amino acid residues unchanged.

[0191] The amino acid sequence of KH212 is obtained by mutating Y at position 493 of sequence 1 to H and Y at position 497 to L, while keeping other amino acid residues unchanged.

[0192] The amino acid sequence of KH213 is obtained by mutating L at position 457 of sequence 1 to M and Q at position 461 to A, while keeping other amino acid residues unchanged.

[0193] The amino acid sequence of KH214 is obtained by mutating K at position 676 of sequence 1 to S and mutating M at position 680 to A, while keeping other amino acid residues unchanged.

[0194] The amino acid sequence of KH125 is obtained by mutating E at position 485 of sequence 1 to F and I at position 486 to K, while keeping other amino acid residues unchanged.

[0195] The amino acid sequence of KH126 is obtained by mutating D at position 480 of sequence 1 to N and K at position 584 to T, while keeping other amino acid residues unchanged.

[0196] The amino acid sequence of KH217 is obtained by mutating K at position 375 of sequence 1 to E, and mutating A at position 378 to K, while keeping other amino acid residues unchanged.

[0197] The amino acid sequence of KH218 is obtained by mutating Y at position 493 of sequence 1 to F and Y at position 497 to I, while keeping other amino acid residues unchanged.

[0198] The amino acid sequence of KH219 is obtained by mutating I at position 474 of sequence 1 to K and L at position 478 to H, while keeping the other amino acid residues unchanged.

[0199] The amino acid sequence of KH220 is obtained by mutating V at position 353 of sequence 1 to D and Y at position 496 to T, while keeping other amino acid residues unchanged.

[0200] The amino acid sequence of KH221 is obtained by mutating R at position 379 of sequence 1 to Q and mutating R at position 380 to D, while keeping other amino acid residues unchanged.

[0201] The amino acid sequence of QH349 is obtained by mutating K at position 676 of sequence 1 to A and mutating M at position 680 to L, while keeping other amino acid residues unchanged.

[0202] The amino acid sequence of QH350 is obtained by mutating D at position 480 of sequence 1 to N and mutating R at position 482 to K, while keeping other amino acid residues unchanged.

[0203] The amino acid sequence of QH351 is obtained by mutating S to Q at position 451 of sequence 1 and L to V at position 453, while keeping other amino acid residues unchanged.

[0204] The amino acid sequence of QH352 is obtained by mutating I at position 474 of sequence 1 to K and L at position 478 to Y, while keeping other amino acid residues unchanged.

[0205] The amino acid sequence of QH353 is obtained by mutating D to N at position 480 of sequence 1 and mutating T to D at position 267, while keeping other amino acid residues unchanged.

[0206] The amino acid sequence of QH354 is obtained by mutating K at position 676 of sequence 1 to L and M at position 680 to T, while keeping other amino acid residues unchanged.

[0207] The amino acid sequence of QH355 is obtained by mutating E at position 485 of sequence 1 to I and mutating G at position 454 to Q, while keeping other amino acid residues unchanged.

[0208] The amino acid sequence of QH356 is obtained by mutating K at position 676 of sequence 1 to V, and mutating V at position 682 to M, while keeping other amino acid residues unchanged.

[0209] The amino acid sequence of QH357 is obtained by mutating K at position 465 of sequence 1 to Q and S at position 707 to G, while keeping the other amino acid residues unchanged.

[0210] The amino acid sequence of QH358 is obtained by mutating K at position 676 of sequence 1 to I and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0211] The amino acid sequence of QH359 is obtained by mutating I at position 474 of sequence 1 to K and L at position 478 to G, while keeping other amino acid residues unchanged.

[0212] QH360 has an amino acid sequence in which the R at position 379 of sequence 1 is mutated to E, and the R at position 380 is mutated to S, while the other amino acid residues remain unchanged.

[0213] The amino acid sequence of QH361 is obtained by mutating K at position 375 of sequence 1 to I and mutating A at position 378 to Q, while keeping other amino acid residues unchanged.

[0214] The amino acid sequence of QH362 is obtained by mutating Y at position 493 of sequence 1 to H and Y at position 497 to M, while keeping other amino acid residues unchanged.

[0215] The amino acid sequence of QH363 is obtained by mutating K at position 676 of sequence 1 to A and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0216] The amino acid sequence of QH329 is obtained by mutating E at position 485 of sequence 1 to I and mutating R at position 484 to G, while keeping other amino acid residues unchanged.

[0217] The amino acid sequence of QH364 is obtained by mutating K at position 676 of sequence 1 to I and mutating M at position 680 to T, while keeping other amino acid residues unchanged.

[0218] QH365 has an amino acid sequence in which I is mutated to K at position 474 of sequence 1 and L is mutated to V at position 478, while other amino acid residues remain unchanged.

[0219] The amino acid sequence of QH366 is obtained by mutating R at position 379 of sequence 1 to K and mutating R at position 380 to G, while keeping other amino acid residues unchanged.

[0220] The amino acid sequence of QH367 is obtained by mutating R at position 379 of sequence 1 to Q and mutating R at position 380 to S, while keeping other amino acid residues unchanged.

[0221] The amino acid sequence of QH368 is obtained by mutating R at position 379 of sequence 1 to Q and mutating R at position 380 to N, while keeping other amino acid residues unchanged.

[0222] The amino acid sequence of QH369 is obtained by mutating E at position 485 of sequence 1 to I and S at position 451 to Q, while keeping other amino acid residues unchanged.

[0223] The amino acid sequence of QH370 is obtained by mutating E at position 485 of sequence 1 to I and mutating I at position 666 to Q, while keeping other amino acid residues unchanged.

[0224] The amino acid sequence of QH371 is obtained by mutating E at position 485 of sequence 1 to I and mutating I at position 666 to R, while keeping other amino acid residues unchanged.

[0225] Specifically, at least three amino acid residues from positions 267, 326, 347, 349, 353, 375, 378, 379, 380, 385, 451, 452, 453, 454, 457, 461, 465, 470, 474, 477, 478, 479, 480, 482, 484, 485, 486, 493, 496, 497, 514, 574, 584, 605, 610, 630, 665, 666, 667, 674, 676, 680, 682, 698, 707, 718, 723, and 729 in the amino acid sequence of the KOD DNA polymerase GH78 are modified, while the other amino acid sequences remain unchanged, to obtain a protein with DNA polymerase activity; an example is as follows:

[0226] The amino acid sequence of QH303 is as follows: K at position 676 of sequence 1 is mutated to L; M at position 680 is mutated to T; V at position 689 is mutated to I, and other amino acid residues remain unchanged.

[0227] The amino acid sequence of QH304 is obtained by mutating L at position 457 of sequence 1 to M; mutating Q at position 461 to A; and mutating T at position 267 to D, while keeping other amino acid residues unchanged.

[0228] The amino acid sequence of QH305 is obtained by mutating K at position 465 of sequence 1 to Q; mutating K at position 584 to T; and mutating E at position 485 to I, while keeping other amino acid residues unchanged.

[0229] The amino acid sequence of QH306 is obtained by mutating K at position 465 of sequence 1 to Q; mutating D at position 718 to Q; and mutating E at position 485 to I, while keeping other amino acid residues unchanged.

[0230] The amino acid sequence of QH307 is obtained by mutating L at position 457 of sequence 1 to M; mutating Q at position 461 to A; and mutating E at position 485 to I, while keeping other amino acid residues unchanged.

[0231] The amino acid sequence of QH308 is as follows: K at position 676 of sequence 1 is mutated to S; M at position 680 is mutated to I; E at position 485 is mutated to I, and other amino acid residues remain unchanged.

[0232] The amino acid sequence of QH309 is obtained by mutating Y at position 493 of sequence 1 to F; mutating Y at position 497 to L; and mutating E at position 485 to I, while keeping other amino acid residues unchanged.

[0233] The amino acid sequence of QH310 is obtained by mutating D at position 480 of sequence 1 to N; mutating S at position 451 to Q; and mutating D at position 718 to Q, while keeping other amino acid residues unchanged.

[0234] The amino acid sequence of QH311 is obtained by mutating D at position 480 of sequence 1 to N; mutating K at position 674 to M; and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0235] The amino acid sequence of QH312 is obtained by mutating D at position 480 of sequence 1 to N; mutating S at position 451 to Q; and mutating E at position 485 to I, while keeping other amino acid residues unchanged.

[0236] The amino acid sequence of QH313 is obtained by mutating D at position 480 of sequence 1 to N; mutating K at position 465 to Q; and mutating D at position 718 to Q, while keeping other amino acid residues unchanged.

[0237] The amino acid sequence of QH314 is obtained by mutating D at position 480 of sequence 1 to N; mutating S at position 451 to Q; and mutating Q at position 461 to A, while keeping other amino acid residues unchanged.

[0238] Specifically, at least four amino acid residues from positions 267, 326, 347, 349, 353, 375, 378, 379, 380, 385, 451, 452, 453, 454, 457, 461, 465, 470, 474, 477, 478, 479, 480, 482, 484, 485, 486, 493, 496, 497, 514, 574, 584, 605, 610, 630, 665, 666, 667, 674, 676, 680, 682, 698, 707, 718, 723, and 729 in the amino acid sequence of the KOD DNA polymerase GH78 are modified, while the other amino acid sequences remain unchanged, to obtain a protein with DNA polymerase activity; an example is as follows:

[0239] The amino acid sequence of QH315 is obtained by mutating K at position 465 of sequence 1 to Q; mutating D at position 718 to Q; mutating L at position 457 to M; and mutating Q at position 461 to A, while keeping other amino acid residues unchanged.

[0240] The amino acid sequence of QH316 is obtained by mutating K at position 465 of sequence 1 to Q; mutating D at position 718 to Q; mutating D at position 480 to N; and mutating E at position 485 to I, while keeping other amino acid residues unchanged.

[0241] Specifically, at least three amino acid residues from positions 267, 326, 347, 349, 353, 375, 378, 379, 380, 385, 451, 452, 453, 454, 457, 461, 465, 470, 474, 477, 478, 479, 480, 482, 484, 485, 486, 493, 496, 497, 514, 574, 584, 605, 610, 630, 665, 666, 667, 674, 676, 680, 682, 698, 707, 718, 723, and 729 in the amino acid sequence of the KOD DNA polymerase GH78 are modified, while the other amino acid sequences remain unchanged, to obtain a protein with DNA polymerase activity; an example is as follows:

[0242] The amino acid sequence of QH317 is obtained by mutating D at position 480 of sequence 1 to N; mutating S at position 451 to Q; and mutating R at position 379 to Y, while keeping other amino acid residues unchanged.

[0243] The amino acid sequence of QH318 is obtained by mutating L at position 457 of sequence 1 to M; mutating Q at position 461 to A; and mutating K at position 465 to Q, while keeping other amino acid residues unchanged.

[0244] The amino acid sequence of QH319 is obtained by mutating D at position 480 of sequence 1 to N; mutating K at position 674 to Q; and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0245] The amino acid sequence of QH320 is obtained by mutating D at position 480 of sequence 1 to N; mutating K at position 674 to R; and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0246] The amino acid sequence of QH321 is obtained by mutating D at position 480 of sequence 1 to N; mutating S at position 451 to Q; and mutating K at position 465 to Q, while keeping other amino acid residues unchanged.

[0247] The amino acid sequence of QH322 is obtained by mutating M at position 680 of sequence 1 to I; mutating K at position 676 to H; and mutating E at position 485 to I, while keeping other amino acid residues unchanged.

[0248] The amino acid sequence of QH323 is obtained by mutating K at position 465 of sequence 1 to Q; mutating D at position 718 to Q; and mutating T at position 267 to D, while keeping other amino acid residues unchanged.

[0249] The amino acid sequence of QH324 is obtained by mutating S to Q at position 451 of sequence 1; mutating L to V at position 452; and mutating L to V at position 453, while keeping other amino acid residues unchanged.

[0250] The amino acid sequence of QH325 is obtained by mutating S at position 451 of sequence 1 to Q; mutating K at position 674 to M; and mutating K at position 676 to T, while keeping other amino acid residues unchanged.

[0251] The amino acid sequence of QH326 is obtained by mutating K at position 465 of sequence 1 to Q; mutating D at position 718 to Q; and mutating R at position 379 to Y, while keeping other amino acid residues unchanged.

[0252] The amino acid sequence of QH326 is obtained by mutating K at position 465 of sequence 1 to Q; mutating D at position 718 to Q; and mutating L at position 453 to V, while keeping other amino acid residues unchanged.

[0253] The amino acid sequence of QH328 is obtained by mutating D at position 480 of sequence 1 to N; mutating K at position 674 to I; and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0254] The amino acid sequence of QH331 is obtained by mutating K at position 465 of sequence 1 to Q; mutating K at position 584 to T; and mutating L at position 453 to V, while keeping other amino acid residues unchanged.

[0255] The amino acid sequence of QH332 is obtained by mutating K at position 465 of sequence 1 to Q; mutating D at position 718 to Q; and mutating S at position 707 to G, while keeping other amino acid residues unchanged.

[0256] The amino acid sequence of QH333 is obtained by mutating K at position 465 of sequence 1 to Q; mutating K at position 584 to T; and mutating R at position 379 to Y, while keeping other amino acid residues unchanged.

[0257] The amino acid sequence of QH334 is obtained by mutating S at position 451 of sequence 1 to Q; mutating R at position 482 to K; and mutating K at position 676 to T, while keeping other amino acid residues unchanged.

[0258] The amino acid sequence of QH335 is obtained by mutating K at position 465 of sequence 1 to Q; mutating K at position 584 to T; and mutating T at position 267 to D, while keeping other amino acid residues unchanged.

[0259] The amino acid sequence of QH336 is obtained by mutating E at position 485 of sequence 1 to I; mutating K at position 676 to L; and mutating M at position 680 to L, while keeping other amino acid residues unchanged.

[0260] Specifically, at least four amino acid residues from positions 267, 326, 347, 349, 353, 375, 378, 379, 380, 385, 451, 452, 453, 454, 457, 461, 465, 470, 474, 477, 478, 479, 480, 482, 484, 485, 486, 493, 496, 497, 514, 574, 584, 605, 610, 630, 665, 666, 667, 674, 676, 680, 682, 698, 707, 718, 723, and 729 in the amino acid sequence of the KOD DNA polymerase GH78 are modified, while the other amino acid sequences remain unchanged, to obtain a protein with DNA polymerase activity; an example is as follows:

[0261] The amino acid sequence of QH338 is obtained by mutating D at position 480 of sequence 1 to N; mutating T at position 667 to R; mutating K at position 674 to Q; and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0262] The amino acid sequence of QH339 is as follows: the D at position 480 of sequence 1 is mutated to N; the T at position 667 is mutated to N; the K at position 674 is mutated to M; and the M at position 680 is mutated to I, while the other amino acid residues remain unchanged.

[0263] The amino acid sequence of QH340 is obtained by mutating D at position 480 of sequence 1 to N; mutating T at position 667 to S; mutating K at position 674 to M; and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0264] The amino acid sequence of QH341 is obtained by mutating S at position 451 of sequence 1 to Q; mutating D at position 480 to N; mutating K at position 674 to Q; and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0265] The amino acid sequence of QH342 is as follows: E at position 485 of sequence 1 is mutated to I; K at position 676 is mutated to L; M at position 680 is mutated to T; V at position 698 is mutated to I, and other amino acid residues remain unchanged.

[0266] The amino acid sequence of QH343 is obtained by mutating D at position 480 of sequence 1 to N; mutating T at position 667 to N; mutating K at position 674 to Q; and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0267] The amino acid sequence of QH344 is as follows: K at position 676 of sequence 1 is mutated to S; M at position 680 is mutated to I; Y at position 493 is mutated to F; Y at position 497 is mutated to L, and other amino acid residues remain unchanged.

[0268] The amino acid sequence of QH345 is obtained by mutating S at position 451 of sequence 1 to Q; mutating R at position 482 to K; mutating K at position 674 to Q; and mutating M at position 680 to L, while keeping other amino acid residues unchanged.

[0269] Specifically, at least five amino acid residues from positions 267, 326, 347, 349, 353, 375, 378, 379, 380, 385, 451, 452, 453, 454, 457, 461, 465, 470, 474, 477, 478, 479, 480, 482, 484, 485, 486, 493, 496, 497, 514, 574, 584, 605, 610, 630, 665, 666, 667, 674, 676, 680, 682, 698, 707, 718, 723, and 729 in the amino acid sequence of the KOD DNA polymerase GH78 are modified, while the other amino acid sequences remain unchanged, to obtain a protein with DNA polymerase activity; an example is as follows:

[0270] The amino acid sequence of QH346 is as follows: the S at position 451 of sequence 1 is mutated to Q; the R at position 482 is mutated to K; the K at position 674 is mutated to M; the M at position 680 is mutated to L; and the L at position 479 is mutated to M, while the other amino acid residues remain unchanged.

[0271] The amino acid sequence of QH347 is obtained by mutating S at position 451 of sequence 1 to Q; mutating L at position 453 to I; mutating D at position 480 to N; mutating K at position 674 to Q; and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0272] Specifically, at least six amino acid residues from positions 267, 326, 347, 349, 353, 375, 378, 379, 380, 385, 451, 452, 453, 454, 457, 461, 465, 470, 474, 477, 478, 479, 480, 482, 484, 485, 486, 493, 496, 497, 514, 574, 584, 605, 610, 630, 665, 666, 667, 674, 676, 680, 682, 698, 707, 718, 723, and 729 in the amino acid sequence of the KOD DNA polymerase GH78 are modified, while the other amino acid sequences remain unchanged, to obtain a protein with DNA polymerase activity; an example is as follows:

[0273] The amino acid sequence of QH348 is obtained by mutating S at position 451 of sequence 1 to Q; mutating R at position 482 to K; mutating K at position 674 to Q; mutating M at position 680 to L; mutating L at position 452 to V; and mutating D at position 480 to N, while keeping other amino acid residues unchanged.

[0274] The nucleic acid molecules encoding the above proteins are also within the scope of protection of this invention.

[0275] The above-mentioned nucleic acid molecule is the DNA molecule or its derivative shown in B below:

[0276] The DNA molecule shown in B) is the KOD. The nucleotide sequence encoding the DNA polymerase mutant GH78 requires at least one, at least two, at least three, at least four, at least five, at least six, or at least seven amino acids from positions 267, 326, 347, 349, 353, 375, 378, 379, 380, 385, 451, 452, 453, 454, 457, 461, 465, 470, 474, 477, 478, 479, 480, 482, 484, 485, 486, 493, 496, 497, 514, 574, 584, 605, 610, 630, 665, 666, 667, 674, 676, 680, 682, 698, 707, 718, 723, and 729 of the corresponding amino acid sequence. Nucleic acid obtained by performing amino acid codon substitution on at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, or all 48 amino acid codons;

[0277] The nucleotide sequence of the gene encoding the KOD DNA polymerase mutant GH78 is sequence 2 in the sequence listing;

[0278] The derivative of the DNA molecule shown in B) is a nucleic acid molecule in which a tag sequence is added to the end of the nucleotide sequence of the DNA molecule shown in B) and encodes a protein with DNA polymerase activity.

[0279] Expression cassettes, recombinant vectors, recombinant bacteria, or transgenic cell lines containing the aforementioned DNA molecules are also within the scope of protection of this invention.

[0280] The use of the above-mentioned protein in at least one of the following 1)-5) is also within the scope of protection of this invention:

[0281] 1) As a DNA polymerase;

[0282] 2) Catalyzes DNA replication and / or DNA amplification;

[0283] 3) Perform nucleic acid sequencing;

[0284] 4) Prepare products for catalyzing DNA replication and / or DNA amplification;

[0285] 5) Prepare products for nucleic acid sequencing.

[0286] The use of the above-mentioned DNA molecule or the above-mentioned expression cassette, recombinant vector, recombinant bacteria or transgenic cell line in at least one of the following 1)-6) is also within the scope of protection of this invention:

[0287] 1) Preparation of DNA polymerase;

[0288] 2) Catalyzes DNA replication and / or DNA amplification;

[0289] 3) Perform nucleic acid sequencing;

[0290] 4) Preparation of DNA polymerase products;

[0291] 5) Prepare products for catalyzing DNA replication and / or DNA amplification;

[0292] 6) Prepare products for nucleic acid sequencing.

[0293] In the above applications, the sequencing is SBS sequencing;

[0294] The nucleic acid is DNA, RNA, or the entire genome.

[0295] In the above applications, the product is a reagent kit. Attached Figure Description

[0296] Figure 1 This is a schematic diagram of the recombinant KOD DNA polymerase structure, where 1 is the signal peptide pelB; 2 is the fusion protein purification tag His; and 3 is the KOD DNA polymerase GH78.

[0297] Figure 2 Purity determination of wild-type KOD DNA polymerase fusion protein. Detailed Implementation

[0298] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0299] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0300] Example 1: Preparation of KOD DNA polymerase mutant

[0301] In this invention, KOD DNA polymerase and its mutants are used with DNA 2.0 Electra. TM The expression vector was constructed using the CloningReagents Kit, and Ni column affinity purification was performed using the His tag.

[0302] I. Preparation of KOD DNA polymerase GH78

[0303] The amino acid sequence of KOD DNA polymerase GH78 is sequence 1 in the following sequence listing, and its coding gene sequence is sequence 2 in the following sequence listing.

[0304] 1. Construction of GH78 expression vector pD441-WT

[0305] The recombinant expression vector pD441-78 is used to express the gene encoding the KOD DNA polymerase GH78 fused with the his tag according to Electra. TM Following the instructions of the Cloning Reagents Kit (DNA2.0, EKT-02), the DNA was recombined into the vector pD441-pelB (DNA2.0, pD441-pelB). The resulting vector was fused with the His-tagged KOD DNA polymerase GH78 encoding gene and expressed through a signal peptide on the pD441-pelB vector.

[0306] The nucleotide sequence of the KOD DNA polymerase GH78 encoding gene with His tag is the sequence obtained by adding 6 His tag codons to the 3' end of sequence 2.

[0307] The amino acid sequence of the KOD DNA polymerase GH78 fusion protein is obtained by linking six His tags to the N-terminus of the amino acids shown in Sequence 1, as follows: Figure 1 1 is the signal peptide pelB; 2 is the fusion protein purification tag His; 3 is the KOD DNA polymerase GH78 (sequence 1).

[0308] 2. Construction of recombinant bacteria

[0309] The recombinant expression vector pD441-78 was introduced into *E. coli* BL21 competent cells (purchased from TransGen Biotech Co., Ltd.) and plated on plates containing 50 μg / ml kanamycin to screen for positive colonies. Three to five positive colonies were selected and identified by PCR using primers Cloning-F and Cloning-R. A fragment of approximately 2800 bp, consistent with the expected theoretical value, was obtained. Sequencing results confirmed this as a positive clone, named BL21 / pD441-78.

[0310] Cloning-F: 5'GGTTTTTTTATGGGGGGAGTTTAGG 3' (sequence 3)

[0311] Cloning-R: 5'CATCTCATCTGTAACATCATTGGCA 3'(Sequence 4)

[0312] 3. Expression and purification of KOD DNA polymerase GH78 fusion protein

[0313] Single colonies of BL21 / pD441-78 were picked and cultured overnight in 50 ml of LB broth (containing 50 μg / ml Kan) at 37°C and 220 rpm / min. The next day, the culture was diluted 1:100 and transferred to 1 L of LB broth (containing 50 μg / ml Kan), and cultured at 37°C and 220 rpm / min until the OD600 reached 0.8. IPTG was then added to a final concentration of 0.5 mM, and the culture was incubated overnight at 25°C to induce fusion protein expression, yielding the induced BL21 / pD441-78 bacterial culture. The blank control group did not receive IPTG.

[0314] The BL21 / pD441-78 bacterial culture was centrifuged at 8000 rpm for 10 min, the supernatant was discarded, and the precipitated bacterial cells were collected. The cells were resuspended in a buffer (50 mM KPO4, 500 mM NaCl, 10 mM imidazole, 5% (v / v) Glycerol, pH 7.0, balance water), and PMSF (final concentration 0.5 mM) was added. The cells were then disrupted using an ultrasonic disruptor for 40 min at 200 W, with a 1-second sonication cycle and a 2-second pause, and an alarm temperature of 15°C. After ultrasonic disruption, the cell disruption solution was incubated in an 80°C water bath for 20 min, ensuring even heating by mixing periodically. The mixture was then centrifuged at 12000 rpm for 30 min at 4°C. The supernatant was filtered through a 0.22 μm filter membrane, and the filtrate was collected as the crude cell extract.

[0315] The crude cell extract was subjected to Ni column affinity chromatography (HisTrap FF pre-packed affinity chromatography column, 5 ml, GE Healthcare) at an appropriate flow rate. After loading, the column was equilibrated with buffer 1 for 5 CV; eluted with 3% buffer 2 (50 ml MkPO4, 1 M NaCl, 5% Glycerol, pH 7.0) for 5 CV; eluted with 50% buffer 2 for 5 CV, and the Ni column affinity chromatography eluent corresponding to peak values ​​greater than or equal to 100 mAU was collected.

[0316] The eluent corresponding to the peak value of ≥100mAU was subjected to ion exchange chromatography (HiTrap Q HP ion exchange pre-packed column, 5ml, GE Healthcare) at a certain flow rate. After loading, the column was equilibrated with 5CV using buffer 2, followed by linear elution with 0% buffer 2-60% buffer 2. The ion exchange chromatography eluent corresponding to the peak value of ≥100mAU was collected.

[0317] The ion exchange chromatography eluent corresponding to a peak of ≥100 mAU was subjected to gel chromatography (HiTrap SPHP, 5 ml, GE Healthcare). The eluent was first washed with 20% ethanol for 3 CV, then washed with water for 3 CV. After equilibration with 100% buffer 3 (20 mM Tris, 200 mM KCl, 0.2 mM EDTA, 10% Glycerol, pH 7.4) for 3 CV, the sample was loaded. Then, the sample was eluted with buffer 3 for 1.5 CV. The eluent was collected as the purified KOD DNA polymerase GH78 fusion protein.

[0318] The purified KOD DNA polymerase GH78 fusion protein was subjected to SDS-PAGE (5% stacking gel and 12% separating gel). The protein sample was mixed with loading buffer (5X) and treated at 95℃ for 5 min before loading.

[0319] The results are as follows Figure 2 As shown, 1 is the protein marker (PageRuler Prestained Protein Ladder, 26616, Thermo Scientific), 2 is 10 μl of purified KOD DNA polymerase GH78 fusion protein at 1 mg / ml, and 3 is 10 μl of purified KOD DNA polymerase GH78 fusion protein diluted 20-fold at 0.05 mg / ml. The protein electrophoresis results show that the protein size in lanes 2 and 3 is approximately 91.5 kDa, consistent with the reported molecular weight in the literature.

[0320] The purity of the protein gel after electrophoresis was analyzed using Quantity One software. The purity of the purified KOD DNA polymerase GH78 fusion protein reached 95% or higher.

[0321] The target protein of approximately 91.5 kDa was not obtained from the uninduced BL21 / pD441-78 bacterial culture.

[0322] In the control group, the empty vector pD441-pelB was introduced into E. coli BL21 to obtain BL21 / pD441-pelB. Expression and purification of the protein using the above method also failed to yield the target protein of approximately 91.5 kDa.

[0323] II. Preparation of KOD DNA polymerase mutant fusion protein

[0324] The KOD DNA polymerase mutant is formed by modifying the amino acid sequence of GH78 (Sequence 1) at positions 267, 326, 347, 349, 353, 375, 378, 379, 380, 385, 451, 452, 453, 454, 457, 461, 465, 470, 474, 477, 478, 479, 480, 482, 484, 485, 48... 6, 493, 496, 497, 514, 574, 584, 605, 610, 630, 665, 666, 667, 674, 676, 680, 682, 698, 707, 718, 723, and 729, with at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, up to The protein obtained by replacing at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, or all 48 amino acids is obtained; if only one amino acid is replaced, the protein obtained is KOD. A single-point mutant of DNA polymerase is obtained by replacing two amino acids, resulting in a two-point combination mutant of KOD DNA polymerase; if three amino acids are replaced, it results in a three-point combination mutant of KOD DNA polymerase, and so on.

[0325] The KOD DNA polymerase mutant encodes a gene that... The nucleotide sequence (Sequence 2) encoding the gene of the DNA polymerase mutant GH78 is defined according to at least one, at least two, at least three, at least four, at least five, at least six, or at least seven amino acids from positions 267, 326, 347, 349, 353, 375, 378, 379, 380, 385, 451, 452, 453, 454, 457, 461, 465, 470, 474, 477, 478, 479, 480, 482, 484, 485, 486, 493, 496, 497, 514, 574, 584, 605, 610, 630, 665, 666, 667, 674, 676, 680, 682, 698, 707, 718, 723, and 729 of the corresponding amino acid sequence 1. Nucleic acid is obtained by replacing amino acid codons with at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, or all 48 amino acid codons.

[0326] Table 1 shows examples of mutation locations and mutation information for KOD DNA polymerase single-point mutants.

[0327] Table 1 shows the mutation locations and mutation information of KOD DNA polymerase single-point mutants.

[0328]

[0329]

[0330] For example, the mutation locations and mutation information in Table 1 above are described as follows: KOD DNA polymerase mutant GH101 is a protein obtained by mutating aspartic acid (D) at amino acid sequence 480 of KOD DNA polymerase GH78 (Sequence 1) to asparagine (N).

[0331] The KOD DNA polymerase mutant GH101 encodes a gene obtained by mutating the codon for aspartic acid (D) at position 480 of the nucleotide sequence (Sequence 2) of the KOD DNA polymerase GH78 enzyme encoding gene to the codon for asparagine (N).

[0332] Based on the KOD-type DNA polymerase GH78, two site mutations were performed to create a double-site combination mutant. The specific mutation sites and methods of the double-site combination mutant are as follows:

[0333] The amino acid sequence of KH222 is obtained by mutating E at position 485 of sequence 1 to I; and mutating S at position 451 to L, while keeping other amino acid residues unchanged;

[0334] The amino acid sequence of KH223 is obtained by mutating E at position 485 of sequence 1 to I; and by mutating serine at position 451 to threonine, while keeping other amino acid residues unchanged.

[0335] The amino acid sequence of KH224 is obtained by mutating E at position 485 of sequence 1 to I; and by mutating D at position 484 to cysteine, while keeping other amino acid residues unchanged.

[0336] The amino acid sequence of KH225 is obtained by mutating E at position 485 of sequence 1 to I; and mutating D at position 480 to threonine, while keeping other amino acid residues unchanged;

[0337] The amino acid sequence of KH226 is obtained by mutating E at position 485 of sequence 1 to I; and by mutating serine at position 451 to glycine, while keeping other amino acid residues unchanged.

[0338] The amino acid sequence of KH227 is obtained by mutating E at position 485 of sequence 1 to I; and mutating L at position 453 to A, while keeping other amino acid residues unchanged;

[0339] The amino acid sequence of KH228 is obtained by mutating E at position 485 of sequence 1 to C; and mutating R at position 484 to V, while keeping other amino acid residues unchanged;

[0340] The amino acid sequence of KH229 is obtained by mutating E at position 485 of sequence 1 to C; and mutating S at position 451 to N, while keeping other amino acid residues unchanged;

[0341] The amino acid sequence of KH230 is obtained by mutating E at position 485 of sequence 1 to C; and mutating D at position 480 to N, while keeping other amino acid residues unchanged;

[0342] The amino acid sequence of KH232 is obtained by mutating E at position 485 of sequence 1 to C; and mutating R at position 484 to I, while keeping other amino acid residues unchanged;

[0343] The amino acid sequence of KH233 is obtained by mutating K at position 676 of sequence 1 to S; and mutating M at position 680 to I, while keeping other amino acid residues unchanged;

[0344] The amino acid sequence of KH234 is obtained by mutating E at position 485 of sequence 1 to C; and mutating I at position 486 to R, while keeping other amino acid residues unchanged;

[0345] The amino acid sequence of KH235 is obtained by mutating E at position 485 of sequence 1 to I; and mutating D at position 480 to S.

[0346] The amino acid sequence of KH236 is obtained by mutating Y at position 493 of sequence 1 to F; and mutating Y at position 497 to L, while keeping other amino acid residues unchanged;

[0347] The amino acid sequence of KH237 is obtained by mutating K at position 676 of sequence 1 to L; and mutating M at position 680 to I, while keeping other amino acid residues unchanged;

[0348] The amino acid sequence of KH238 is obtained by mutating E at position 485 of sequence 1 to I; and mutating D at position 480 to Q, while keeping other amino acid residues unchanged;

[0349] The amino acid sequence of KH239 is obtained by mutating E at position 485 of sequence 1 to I; and mutating D at position 480 to M, while keeping other amino acid residues unchanged;

[0350] The amino acid sequence of KH240 is obtained by mutating E at position 485 of sequence 1 to I; and mutating S at position 451 to K, while keeping other amino acid residues unchanged;

[0351] The amino acid sequence of KH241 is obtained by mutating E at position 485 of sequence 1 to I; and mutating D at position 480 to R, while keeping other amino acid residues unchanged;

[0352] The amino acid sequence of KH242 is obtained by mutating E at position 485 of sequence 1 to I; and mutating L at position 453 to N, while keeping other amino acid residues unchanged;

[0353] The amino acid sequence of KH243 is obtained by mutating K at position 676 of sequence 1 to R; and mutating M at position 680 to I, while keeping other amino acid residues unchanged;

[0354] The amino acid sequence of KH244 is obtained by mutating E at position 485 of sequence 1 to I; and mutating S at position 451 to M, while keeping other amino acid residues unchanged;

[0355] The amino acid sequence of KH245 is obtained by mutating E at position 485 of sequence 1 to I; and mutating K at position 477 to E, while keeping other amino acid residues unchanged;

[0356] The amino acid sequence of KH246 is obtained by mutating E at position 485 of sequence 1 to I; and mutating D at position 480 to W, while keeping other amino acid residues unchanged;

[0357] The amino acid sequence of KH247 is obtained by mutating E at position 485 of sequence 1 to I; and mutating D at position 480 to K, while keeping other amino acid residues unchanged;

[0358] The amino acid sequence of KH248 is obtained by mutating E at position 485 of sequence 1 to I; and mutating S at position 451 to R, while keeping other amino acid residues unchanged;

[0359] The amino acid sequence of KH249 is obtained by mutating K at position 676 of sequence 1 to L; and mutating M at position 680 to L, while keeping other amino acid residues unchanged;

[0360] The amino acid sequence of KH250 is obtained by mutating E at position 485 of sequence 1 to I; and mutating Q at position 665 to R, while keeping other amino acid residues unchanged;

[0361] The amino acid sequence of KH251 is obtained by mutating E at position 485 of sequence 1 to I; and mutating Q at position 665 to S, while keeping other amino acid residues unchanged;

[0362] The amino acid sequence of KH252 is obtained by mutating E at position 485 of sequence 1 to I; and mutating D at position 480 to E, while keeping other amino acid residues unchanged;

[0363] The amino acid sequence of KH253 is obtained by mutating K at position 676 of sequence 1 to H; and mutating M at position 680 to I, while keeping other amino acid residues unchanged;

[0364] The amino acid sequence of KH254 is obtained by mutating E at position 485 of sequence 1 to I; and mutating Q at position 461 to A, while keeping other amino acid residues unchanged;

[0365] The amino acid sequence of KH255 is obtained by mutating E at position 485 of sequence 1 to I; and mutating S at position 451 to A, while keeping other amino acid residues unchanged;

[0366] The amino acid sequence of KH256 is obtained by mutating E at position 485 of sequence 1 to I; and mutating S at position 451 to Q, while keeping other amino acid residues unchanged;

[0367] The amino acid sequence of KH257 is obtained by mutating E at position 485 of sequence 1 to I; and mutating I at position 666 to Q, while keeping other amino acid residues unchanged;

[0368] The amino acid sequence of KH258 is obtained by mutating E at position 485 of sequence 1 to I; and mutating I at position 666 to T, while keeping other amino acid residues unchanged;

[0369] The amino acid sequence of KH259 is obtained by mutating E at position 485 of sequence 1 to I; and mutating T at position 605 to W, while keeping other amino acid residues unchanged;

[0370] The amino acid sequence of KH260 is obtained by mutating E at position 485 of sequence 1 to I; and mutating R at position 379 to Y, while keeping other amino acid residues unchanged;

[0371] The amino acid sequence of KH261 is obtained by mutating E at position 485 of sequence 1 to I; and mutating L at position 453 to T, while keeping other amino acid residues unchanged;

[0372] The amino acid sequence of KH262 is obtained by mutating E at position 485 of sequence 1 to I; and mutating D at position 480 to C, while keeping other amino acid residues unchanged;

[0373] The amino acid sequence of KH263 is obtained by mutating E at position 485 of sequence 1 to I; and mutating T at position 605 to V, while keeping other amino acid residues unchanged;

[0374] The amino acid sequence of KH264 is obtained by mutating E at position 485 of sequence 1 to I; and mutating D at position 480 to N, while keeping other amino acid residues unchanged;

[0375] The amino acid sequence of KH266 is obtained by mutating E at position 485 of sequence 1 to I; and mutating D at position 480 to G, while keeping other amino acid residues unchanged;

[0376] The amino acid sequence of KH267 is obtained by mutating K at position 465 of sequence 1 to Q; and mutating D at position 718 to Q, while keeping other amino acid residues unchanged;

[0377] The amino acid sequence of KH268 is obtained by mutating E at position 485 of sequence 1 to I; and mutating R at position 379 to H, while keeping other amino acid residues unchanged;

[0378] The amino acid sequence of KH269 is obtained by mutating E at position 485 of sequence 1 to I; and mutating K at position 465 to Q, while keeping other amino acid residues unchanged;

[0379] The amino acid sequence of KH270 is obtained by mutating E at position 485 of sequence 1 to I; and mutating D at position 480 to P, while keeping other amino acid residues unchanged;

[0380] The amino acid sequence of KH271 is obtained by mutating E at position 485 of sequence 1 to I; and mutating D at position 480 to F, while keeping other amino acid residues unchanged;

[0381] The amino acid sequence of KH272 is obtained by mutating K at position 676 of sequence 1 to V; and mutating M at position 680 to L, while keeping other amino acid residues unchanged;

[0382] The amino acid sequence of KH273 is obtained by mutating E at position 485 of sequence 1 to I; and mutating L at position 453 to V, while keeping other amino acid residues unchanged;

[0383] The amino acid sequence of KH274 is obtained by mutating E at position 485 of sequence 1 to I; and mutating D at position 480 to H, while keeping other amino acid residues unchanged;

[0384] The amino acid sequence of KH275 is obtained by mutating E at position 485 of sequence 1 to I; and mutating S at position 451 to P, while keeping other amino acid residues unchanged;

[0385] The amino acid sequence of KH276 is obtained by mutating E at position 485 of sequence 1 to I; and mutating Q at position 665 to K, while keeping other amino acid residues unchanged;

[0386] The amino acid sequence of KH277 is obtained by mutating D at position 480 of sequence 1 to S; and mutating S at position 451 to Q, while keeping other amino acid residues unchanged;

[0387] The amino acid sequence of KH278 is obtained by mutating I at position 474 of sequence 1 to T; and mutating L at position 478 to C, while keeping other amino acid residues unchanged;

[0388] The amino acid sequence of KH279 is obtained by mutating K at position 676 of sequence 1 to H; and mutating M at position 680 to T, while keeping other amino acid residues unchanged;

[0389] The amino acid sequence of KH280 is obtained by mutating E at position 485 of sequence 1 to I; and mutating S at position 347 to V, while keeping other amino acid residues unchanged;

[0390] The amino acid sequence of KH281 is obtained by mutating D at position 480 of sequence 1 to N; and mutating L at position 453 to V, while keeping other amino acid residues unchanged;

[0391] The amino acid sequence of KH282 is obtained by mutating E at position 485 of sequence 1 to I; and mutating I at position 666 to A, while keeping other amino acid residues unchanged;

[0392] The amino acid sequence of KH283 is obtained by mutating K at position 676 of sequence 1 to V; and mutating M at position 680 to I, while keeping other amino acid residues unchanged;

[0393] The amino acid sequence of KH284 is obtained by mutating K at position 676 of sequence 1 to I; and mutating M at position 680 to L, while keeping other amino acid residues unchanged;

[0394] The amino acid sequence of KH285 is obtained by mutating K at position 676 of sequence 1 to M; and mutating M at position 680 to A, while keeping other amino acid residues unchanged;

[0395] The amino acid sequence of KH286 is obtained by mutating E at position 485 of sequence 1 to I; and mutating T at position 470 to S, while keeping other amino acid residues unchanged;

[0396] The amino acid sequence of KH287 is obtained by mutating K at position 676 of sequence 1 to L; and mutating M at position 680 to A, while keeping other amino acid residues unchanged;

[0397] The amino acid sequence of KH288 is obtained by mutating R at position 379 of sequence 1 to K; and mutating R at position 380 to E, while keeping other amino acid residues unchanged;

[0398] The amino acid sequence of KH201 is obtained by mutating D at position 480 of sequence 1 to N; and mutating M at position 680 to I, while keeping other amino acid residues unchanged;

[0399] The amino acid sequence of KH202 is obtained by mutating I at position 474 of sequence 1 to T; and mutating L at position 478 to N, while keeping other amino acid residues unchanged;

[0400] The amino acid sequence of KH203 is obtained by mutating I at position 474 of sequence 1 to T; and mutating L at position 478 to H, while keeping other amino acid residues unchanged;

[0401] The amino acid sequence of KH204 is obtained by mutating E at position 485 of sequence 1 to I; and mutating R at position 484 to K, while keeping other amino acid residues unchanged;

[0402] The amino acid sequence of KH205 is obtained by mutating Y at position 493 of sequence 1 to H; and mutating Y at position 497 to F, while keeping other amino acid residues unchanged;

[0403] The amino acid sequence of KH206 is obtained by mutating Y at position 493 of sequence 1 to F; and mutating Y at position 497 to M, while keeping other amino acid residues unchanged;

[0404] The amino acid sequence of KH207 is obtained by mutating T at position 514 of sequence 1 to A; and mutating K at position 584 to T, while keeping other amino acid residues unchanged;

[0405] The amino acid sequence of KH208 is obtained by mutating I at position 474 of sequence 1 to T; and mutating L at position 478 to G, while keeping other amino acid residues unchanged;

[0406] The amino acid sequence of KH209 is obtained by mutating E at position 485 of sequence 1 to I; and mutating Q at position 665 to C, while keeping other amino acid residues unchanged;

[0407] The amino acid sequence of KH210 is obtained by mutating K at position 465 of sequence 1 to Q; and mutating K at position 584 to T, while keeping other amino acid residues unchanged;

[0408] The amino acid sequence of KH211 is obtained by mutating K at position 676 of sequence 1 to M; and mutating M at position 680 to L, while keeping other amino acid residues unchanged;

[0409] The amino acid sequence of KH212 is obtained by mutating Y at position 493 of sequence 1 to H; and mutating Y at position 497 to L, while keeping other amino acid residues unchanged;

[0410] The amino acid sequence of KH213 is obtained by mutating L at position 457 of sequence 1 to M; and mutating Q at position 461 to A, while keeping other amino acid residues unchanged;

[0411] The amino acid sequence of KH214 is obtained by mutating K at position 676 of sequence 1 to S; and mutating M at position 680 to A, while keeping other amino acid residues unchanged;

[0412] The amino acid sequence of KH125 is obtained by mutating E at position 485 of sequence 1 to F; and mutating I at position 486 to K, while keeping other amino acid residues unchanged;

[0413] The amino acid sequence of KH126 is obtained by mutating D at position 480 of sequence 1 to N; and mutating K at position 584 to T, while keeping other amino acid residues unchanged;

[0414] The amino acid sequence of KH217 is obtained by mutating K at position 375 of sequence 1 to E; and mutating A at position 378 to K, while keeping other amino acid residues unchanged;

[0415] The amino acid sequence of KH218 is obtained by mutating Y at position 493 of sequence 1 to F; and mutating Y at position 497 to I, while keeping other amino acid residues unchanged;

[0416] The amino acid sequence of KH219 is obtained by mutating I at position 474 of sequence 1 to K; and mutating L at position 478 to H, while keeping other amino acid residues unchanged;

[0417] The amino acid sequence of KH220 is obtained by mutating V at position 353 of sequence 1 to D; and mutating Y at position 496 to T, while keeping other amino acid residues unchanged;

[0418] The amino acid sequence of KH221 is obtained by mutating R at position 379 of sequence 1 to Q; and mutating R at position 380 to D, while keeping other amino acid residues unchanged;

[0419] The amino acid sequence of QH349 is obtained by mutating K at position 676 of sequence 1 to A; and mutating M at position 680 to L, while keeping other amino acid residues unchanged;

[0420] The amino acid sequence of QH350 is obtained by mutating D at position 480 of sequence 1 to N; and mutating R at position 482 to K, while keeping other amino acid residues unchanged;

[0421] The amino acid sequence of QH351 is obtained by mutating S to Q at position 451 of sequence 1 and mutating L to V at position 453, while keeping other amino acid residues unchanged.

[0422] The amino acid sequence of QH352 is obtained by mutating I at position 474 of sequence 1 to K; and mutating L at position 478 to Y, while keeping other amino acid residues unchanged;

[0423] The amino acid sequence of QH353 is obtained by mutating D to N at position 480 of sequence 1 and mutating T to D at position 267, while keeping other amino acid residues unchanged.

[0424] The amino acid sequence of QH354 is obtained by mutating K at position 676 of sequence 1 to L; and mutating M at position 680 to T, while keeping other amino acid residues unchanged;

[0425] The amino acid sequence of QH355 is obtained by mutating E at position 485 of sequence 1 to I; and mutating G at position 454 to Q, while keeping other amino acid residues unchanged;

[0426] The amino acid sequence of QH356 is obtained by mutating K at position 676 of sequence 1 to V; and mutating V at position 682 to M, while keeping other amino acid residues unchanged;

[0427] The amino acid sequence of QH357 is obtained by mutating K at position 465 of sequence 1 to Q; and mutating S at position 707 to G, while keeping other amino acid residues unchanged;

[0428] The amino acid sequence of QH358 is obtained by mutating K at position 676 of sequence 1 to I; and mutating M at position 680 to I, while keeping other amino acid residues unchanged;

[0429] The amino acid sequence of QH359 is obtained by mutating I at position 474 of sequence 1 to K; and mutating L at position 478 to G, while keeping other amino acid residues unchanged;

[0430] The amino acid sequence of QH360 is obtained by mutating R at position 379 of sequence 1 to E; and mutating R at position 380 to S, while keeping other amino acid residues unchanged;

[0431] The amino acid sequence of QH361 is obtained by mutating K at position 375 of sequence 1 to I; and mutating A at position 378 to Q, while keeping other amino acid residues unchanged;

[0432] The amino acid sequence of QH362 is obtained by mutating Y at position 493 of sequence 1 to H; and mutating Y at position 497 to M, while keeping other amino acid residues unchanged;

[0433] The amino acid sequence of QH363 is obtained by mutating K at position 676 of sequence 1 to A; and mutating M at position 680 to I, while keeping other amino acid residues unchanged;

[0434] The amino acid sequence of QH329 is obtained by mutating E at position 485 of sequence 1 to I; and mutating R at position 484 to G, while keeping other amino acid residues unchanged;

[0435] The amino acid sequence of QH364 is obtained by mutating K at position 676 of sequence 1 to I; and mutating M at position 680 to T, while keeping other amino acid residues unchanged;

[0436] The amino acid sequence of QH365 is obtained by mutating I at position 474 of sequence 1 to K; and mutating L at position 478 to V, while keeping other amino acid residues unchanged;

[0437] The amino acid sequence of QH366 is obtained by mutating R at position 379 of sequence 1 to K; and mutating R at position 380 to G, while keeping other amino acid residues unchanged;

[0438] The amino acid sequence of QH367 is obtained by mutating R at position 379 of sequence 1 to Q; and mutating R at position 380 to S, while keeping other amino acid residues unchanged;

[0439] The amino acid sequence of QH368 is obtained by mutating R at position 379 of sequence 1 to Q; and mutating R at position 380 to N, while keeping other amino acid residues unchanged;

[0440] The amino acid sequence of QH369 is obtained by mutating E at position 485 of sequence 1 to I; and mutating S at position 451 to Q, while keeping other amino acid residues unchanged;

[0441] The amino acid sequence of QH370 is obtained by mutating E at position 485 of sequence 1 to I; and mutating I at position 666 to Q, while keeping other amino acid residues unchanged;

[0442] The amino acid sequence of QH371 is obtained by mutating E at position 485 of sequence 1 to I; and mutating I at position 666 to R, while keeping other amino acid residues unchanged.

[0443] Based on the KOD-type DNA polymerase GH78, three mutations were performed at different positions to create a three-point combination mutant. The specific mutation locations and methods of the three-point combination mutant are as follows:

[0444] The amino acid sequence of QH303 is obtained by mutating K at position 676 of sequence 1 to L; mutating M at position 680 to T; and mutating V at position 689 to I, while keeping other amino acid residues unchanged.

[0445] The amino acid sequence of QH304 is obtained by mutating L at position 457 of sequence 1 to M; mutating Q at position 461 to A; and mutating T at position 267 to D, while keeping other amino acid residues unchanged.

[0446] The amino acid sequence of QH305 is obtained by mutating K at position 465 of sequence 1 to Q; mutating K at position 584 to T; and mutating E at position 485 to I, while keeping other amino acid residues unchanged.

[0447] The amino acid sequence of QH306 is obtained by mutating K at position 465 of sequence 1 to Q; mutating D at position 718 to Q; and mutating E at position 485 to I, while keeping other amino acid residues unchanged.

[0448] The amino acid sequence of QH307 is obtained by mutating L at position 457 of sequence 1 to M; mutating Q at position 461 to A; and mutating E at position 485 to I, while keeping other amino acid residues unchanged.

[0449] The amino acid sequence of QH308 is obtained by mutating K at position 676 of sequence 1 to S; mutating M at position 680 to I; and mutating E at position 485 to I, while keeping other amino acid residues unchanged.

[0450] The amino acid sequence of QH309 is obtained by mutating Y at position 493 of sequence 1 to F; mutating Y at position 497 to L; and mutating E at position 485 to I, while keeping other amino acid residues unchanged.

[0451] The amino acid sequence of QH310 is obtained by mutating D at position 480 of sequence 1 to N; mutating S at position 451 to Q; and mutating D at position 718 to Q, while keeping other amino acid residues unchanged.

[0452] The amino acid sequence of QH311 is obtained by mutating D at position 480 of sequence 1 to N; mutating K at position 674 to M; and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0453] The amino acid sequence of QH312 is obtained by mutating D at position 480 of sequence 1 to N; mutating S at position 451 to Q; and mutating E at position 485 to I, while keeping other amino acid residues unchanged.

[0454] The amino acid sequence of QH313 is obtained by mutating D at position 480 of sequence 1 to N; mutating K at position 465 to Q; and mutating D at position 718 to Q, while keeping other amino acid residues unchanged.

[0455] The amino acid sequence of QH314 is obtained by mutating D at position 480 of sequence 1 to N; mutating S at position 451 to Q; and mutating Q at position 461 to A, while keeping other amino acid residues unchanged.

[0456] The amino acid sequence of QH315 is obtained by mutating K at position 465 of sequence 1 to Q; mutating D at position 718 to Q; mutating L at position 457 to M; and mutating Q at position 461 to A, while keeping other amino acid residues unchanged.

[0457] Based on the KOD-type DNA polymerase GH78, four mutations were performed at four positions to create a four-point combination mutant. The specific mutation locations and methods of the four-point combination mutant are as follows:

[0458] The amino acid sequence of QH316 is obtained by mutating K at position 465 of sequence 1 to Q; mutating D at position 718 to Q; mutating D at position 480 to N; and mutating E at position 485 to I, while keeping other amino acid residues unchanged.

[0459] Based on the KOD-type DNA polymerase GH78, three mutations were performed at three positions to create a three-point combination mutant. The specific mutation locations and methods of the three-point combination mutant are as follows:

[0460] The amino acid sequence of QH317 is obtained by mutating D at position 480 of sequence 1 to N; mutating S at position 451 to Q; and mutating R at position 379 to Y, while keeping other amino acid residues unchanged.

[0461] The amino acid sequence of QH318 is obtained by mutating L at position 457 of sequence 1 to M; mutating Q at position 461 to A; and mutating K at position 465 to Q, while keeping other amino acid residues unchanged.

[0462] The amino acid sequence of QH319 is obtained by mutating D at position 480 of sequence 1 to N; mutating K at position 674 to Q; and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0463] The amino acid sequence of QH320 is obtained by mutating D at position 480 of sequence 1 to N; mutating K at position 674 to R; and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0464] The amino acid sequence of QH321 is obtained by mutating D at position 480 of sequence 1 to N; mutating S at position 451 to Q; and mutating K at position 465 to Q, while keeping other amino acid residues unchanged.

[0465] The amino acid sequence of QH322 is obtained by mutating M at position 680 of sequence 1 to I; mutating K at position 676 to H; and mutating E at position 485 to I, while keeping other amino acid residues unchanged.

[0466] The amino acid sequence of QH323 is obtained by mutating K at position 465 of sequence 1 to Q; mutating D at position 718 to Q; and mutating T at position 267 to D, while keeping other amino acid residues unchanged.

[0467] The amino acid sequence of QH324 is obtained by mutating S to Q at position 451 of sequence 1; mutating L to V at position 452; and mutating L to V at position 453, while keeping other amino acid residues unchanged.

[0468] The amino acid sequence of QH325 is obtained by mutating S at position 451 of sequence 1 to Q; mutating K at position 674 to M; and mutating K at position 676 to T, while keeping other amino acid residues unchanged.

[0469] The amino acid sequence of QH326 is obtained by mutating K at position 465 of sequence 1 to Q; mutating D at position 718 to Q; and mutating R at position 379 to Y, while keeping other amino acid residues unchanged.

[0470] The amino acid sequence of QH326 is obtained by mutating K at position 465 of sequence 1 to Q; mutating D at position 718 to Q; and mutating L at position 453 to V, while keeping other amino acid residues unchanged.

[0471] The amino acid sequence of QH328 is obtained by mutating D at position 480 of sequence 1 to N; mutating K at position 674 to I; and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0472] The amino acid sequence of QH331 is obtained by mutating K at position 465 of sequence 1 to Q; mutating K at position 584 to T; and mutating L at position 453 to V, while keeping other amino acid residues unchanged.

[0473] The amino acid sequence of QH332 is obtained by mutating K at position 465 of sequence 1 to Q; mutating D at position 718 to Q; and mutating S at position 707 to G, while keeping other amino acid residues unchanged.

[0474] The amino acid sequence of QH333 is obtained by mutating K at position 465 of sequence 1 to Q; mutating K at position 584 to T; and mutating R at position 379 to Y, while keeping other amino acid residues unchanged.

[0475] The amino acid sequence of QH334 is obtained by mutating S at position 451 of sequence 1 to Q; mutating R at position 482 to K; and mutating K at position 676 to T, while keeping other amino acid residues unchanged.

[0476] The amino acid sequence of QH335 is obtained by mutating K at position 465 of sequence 1 to Q; mutating K at position 584 to T; and mutating T at position 267 to D, while keeping other amino acid residues unchanged.

[0477] The amino acid sequence of QH336 is obtained by mutating E at position 485 of sequence 1 to I; mutating K at position 676 to L; and mutating M at position 680 to L, while keeping other amino acid residues unchanged.

[0478] Based on the KOD-type DNA polymerase GH78, four mutations were performed at different positions to create a four-point combination mutant. The specific mutation locations and methods of the four-point combination mutant are as follows:

[0479] The amino acid sequence of QH338 is obtained by mutating D at position 480 of sequence 1 to N; mutating T at position 667 to R; mutating K at position 674 to Q; and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0480] The amino acid sequence of QH339 is obtained by mutating D at position 480 of sequence 1 to N; mutating T at position 667 to N; mutating K at position 674 to M; and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0481] The amino acid sequence of QH340 is obtained by mutating D at position 480 of sequence 1 to N; mutating T at position 667 to S; mutating K at position 674 to M; and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0482] The amino acid sequence of QH341 is obtained by mutating S at position 451 of sequence 1 to Q; mutating D at position 480 to N; mutating K at position 674 to Q; and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0483] The amino acid sequence of QH342 is obtained by mutating E at position 485 of sequence 1 to I; mutating K at position 676 to L; mutating M at position 680 to T; and mutating V at position 698 to I, while keeping other amino acid residues unchanged.

[0484] The amino acid sequence of QH343 is obtained by mutating D at position 480 of sequence 1 to N; mutating T at position 667 to N; mutating K at position 674 to Q; and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0485] The amino acid sequence of QH344 is obtained by mutating K at position 676 of sequence 1 to S; mutating M at position 680 to I; mutating Y at position 493 to F; and mutating Y at position 497 to L, while keeping other amino acid residues unchanged.

[0486] The amino acid sequence of QH345 is obtained by mutating S at position 451 of sequence 1 to Q; mutating R at position 482 to K; mutating K at position 674 to Q; and mutating M at position 680 to L, while keeping other amino acid residues unchanged.

[0487] Five mutations were performed at five positions on the KOD-type DNA polymerase GH78 to create a five-point combination mutant. The specific mutation positions and methods of the five-point combination mutant are as follows:

[0488] The amino acid sequence of QH346 is obtained by mutating S at position 451 of sequence 1 to Q; mutating R at position 482 to K; mutating K at position 674 to M; mutating M at position 680 to L; and mutating L at position 479 to M, while keeping other amino acid residues unchanged.

[0489] The amino acid sequence of QH347 is obtained by mutating S at position 451 of sequence 1 to Q; mutating L at position 453 to I; mutating D at position 480 to N; mutating K at position 674 to Q; and mutating M at position 680 to I, while keeping other amino acid residues unchanged.

[0490] Based on the KOD-type DNA polymerase GH78, six mutations were performed at six positions to create a six-point combination mutant. The specific mutation locations and methods of the six-point combination mutant are as follows:

[0491] The amino acid sequence of QH348 is obtained by mutating S at position 451 of sequence 1 to Q; mutating R at position 482 to K; mutating K at position 674 to Q; mutating M at position 680 to L; mutating L at position 452 to V; and mutating D at position 480 to N, while keeping other amino acid residues unchanged.

[0492] KOD DNA polymerase mutants can be obtained by site-directed mutagenesis of KOD-type DNA polymerase GH78, or by other existing methods.

[0493] 1. Preparation of recombinant vectors expressing KOD-type DNA polymerase mutants

[0494] Recombinant vectors expressing different KOD-type DNA polymerase mutants are prepared by using Electra to encode the protein-coding genes of different KOD-type DNA polymerase mutants fused with His tags. TM Following the instructions of the Cloning Reagents Kit (DNA2.0, EKT-02), the DNA was recombined into the vector pD441-pelB. The resulting vector was fused with protein-encoding genes of different His-tagged point mutants, and expression was guided by the signal peptide on the vector pD441-pelB.

[0495] The amino acid sequence of each KOD-type DNA polymerase mutant fusion protein is obtained by linking 6 His tags to the N-terminus of the KOD-type DNA polymerase mutant amino acid sequence.

[0496] The nucleotide sequences of the protein-coding genes of different KOD-type DNA polymerase mutants fused with His tags are obtained by linking six His tag codons to the 3' end of the protein-coding genes of different KOD-type DNA polymerase mutants.

[0497] 2. Construction of recombinant bacteria

[0498] Similar to method 2 in section 1 above, the recombinant vectors expressing different KOD-type DNA polymerase mutants prepared in section 1 above were introduced into BL21 to obtain recombinant bacteria expressing different KOD-type DNA polymerase mutant fusion proteins.

[0499] 3. Expression and purification of mutants

[0500] Similar to the above-mentioned expression and purification method for wild-type KOD DNA polymerase fusion protein, the recombinant bacteria expressing different KOD DNA polymerase mutant fusion proteins prepared in step 2 were expressed and purified to obtain different KOD DNA polymerase mutant fusion proteins.

[0501] Different KOD-type DNA polymerase mutant fusion proteins were subjected to SDS-PAGE (5% stacking gel, 12% separating gel) to obtain the target proteins. Protein purity was analyzed using Quantity One software, and the purity of the different KOD-type DNA polymerase mutant fusion proteins all reached 95% or higher.

[0502] Example 2: Performance testing of recombinant KOD DNA polymerase mutant fusion protein

[0503] The polymerization activity of the recombinant KOD DNA polymerase mutant fusion protein to the incorporation of modified single bases was detected. The polymerase activity was detected according to the method of Nishioka, M., et al. (2001. J. Biotechnol. 88). One unit of enzyme activity was defined as the amount of acid-insoluble substance generated by the polymerization of 10 nmol dNTPs by a unit of enzyme in a 50 μl reaction system at 75°C for 30 min.

[0504] This embodiment utilizes dATP (modified) labeled with Cy3 fluorescent dye (5' end) and DNA strands labeled with Cy5 fluorescent dye (5' end) (DNA-Cy5). These DNA strands are obtained by annealing single-stranded DNA molecules shown in sequence 5 and sequence 6 (sequences 5 and 6 are partially inversely complementary, with 25 bp of complementarity). Modified nucleotides are incorporated during the SBS sequencing process, and a microplate reader is used to detect the relative reaction rates of recombinant KOD DNA polymerase mutants. The Michaelis-Menten kinetic curves for each mutant are approximated, and Kcat / Km is calculated. The specific experimental methods are as follows:

[0505] Reaction Buffer: 20 mM Tris-HCl, 10 mM (NH4)2SO4, 10 mM KCl, 2 mM MgSO4, balance water, pH 8.5.

[0506] The reaction system consisted of 1 μg KOD polymerase mutant fusion protein, 2 μM dATP (modified), and different concentrations (0.2 μM to 4 μM) of DNA-Cy5 and reaction buffer mixed together.

[0507] Reaction temperature: 40℃

[0508] Reaction time: 1 hour.

[0509] After the reaction is complete, the data table and enzyme activity curve can be directly exported. The reaction rate with relative fluorescence value can be approximately calculated. Then, the kinetic curve can be fitted according to the Michaelis equation to calculate Vmax and Km.

[0510] KOD DNA polymerase fusion protein GH78 was used as a control.

[0511] The kinetic parameters of the KOD DNA polymerase mutant fusion protein are shown in Table 2. It can be seen that the KOD DNA polymerase mutant exhibits higher polymerization activity compared to GH78. The mutant shows greater potential compared to GH78. During sequencing, the faster the catalytic efficiency of the enzyme reaction, the larger the Kcat / km value, which can accelerate the reaction and shorten the sequencing time to some extent. The experimental results show that the KOD DNA polymerase mutants KH222, KH223, and KH224 all exhibit significantly improved catalytic efficiency.

[0512] Table 2. Kinetic test results of KOD DNA polymerase mutants

[0513]

[0514]

[0515]

[0516] Relative Kcat / km: Compare to GH78 (the Kcat / km value of the mutant is compared to the Kcat / km value of GH78). The larger the ratio of Kcat / km, the faster the enzyme converts the substrate.

[0517] Industrial applications

[0518] Experiments of this invention demonstrate that, based on previous work, this invention further modifies the KOD DNA polymerase to achieve improvements such as extending sequencing read length and shortening reaction time. The original functional sites of the DNA polymerase B family in this region are protected, ensuring that it can still perform its original basic functions, thereby increasing the reaction rate and read length of the DNA polymerase during sequencing. Compared to KOD DNA polymerase GH78, the recombinant DNA polymerase exhibits advantages in catalysis, including a stronger reaction rate, better catalytic efficiency, and better affinity, further improving the reaction rate and increasing the read length of the DNA polymerase during sequencing. sequence list <110> Shenzhen BGI Life Science Research Institute <120> Recombinant KOD polymerase <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 774 <212> PRT <213> Artificial sequence <400> 1 Met Ile Leu Asp Thr Asp Tyr Ile Thr Glu Asp Gly Lys Pro Val Ile 1 5 10 15 Arg Ile Phe Lys Lys Glu Asn Gly Glu Phe Lys Ile Glu Tyr Asp Arg 20 25 30 Thr Phe Glu Pro Tyr Phe Tyr Ala Leu Leu Lys Asp Asp Ser Ala Ile 35 40 45 Glu Glu Val Lys Lys Ile Thr Ala Glu Arg His Gly Thr Val Val Thr 50 55 60 Val Lys Arg Val Glu Lys Val Gln Lys Lys Phe Leu Gly Arg Pro Val 65 70 75 80 Glu Val Trp Lys Leu Tyr Phe Thr His Pro Gln Asp Val Pro Ala Ile 85 90 95 Arg Asp Lys Ile Arg Glu His Pro Ala Val Ile Asp Ile Tyr Glu Tyr 100 105 110 Asp Ile Pro Phe Ala Lys Arg Tyr Leu Ile Asp Lys Gly Leu Val Pro 115 120 125 Met Glu Gly Asp Glu Glu Leu Lys Met Leu Ala Phe Ala Ile Ala Thr 130 135 140 Leu Tyr His Glu Gly Glu Glu Phe Ala Glu Gly Pro Ile Leu Met Ile 145 150 155 160 Ser Tyr Ala Asp Glu Glu Gly Ala Arg Val Ile Thr Trp Lys Asn Val 165 170 175 Asp Leu Pro Tyr Val Asp Val Val Ser Thr Glu Arg Glu Met Ile Lys 180 185 190 Arg Phe Leu Arg Val Val Lys Glu Lys Asp Pro Asp Val Leu Ile Thr 195 200 205 Tyr Asn Gly Asp Asn Phe Asp Phe Ala Tyr Leu Lys Lys Arg Cys Glu 210 215 220 Lys Leu Gly Ile Asn Phe Ala Leu Gly Arg Asp Gly Ser Glu Pro Lys 225 230 235 240 Ile Gln Arg Met Gly Asp Arg Phe Ala Val Glu Val Lys Gly Arg Ile 245 250 255 His Phe Asp Leu Tyr Pro Val Ile Arg Arg Thr Ile Asn Leu Pro Thr 260 265 270 Tyr Thr Leu Glu Ala Val Tyr Glu Ala Val Phe Gly Gln Pro Lys Glu 275 280 285 Lys Val Tyr Ala Glu Glu Ile Thr Thr Ala Trp Glu Thr Gly Glu Asn 290 295 300 Leu Glu Arg Val Ala Arg Tyr Ser Met Glu Asp Ala Lys Val Thr Tyr 305 310 315 320 Glu Leu Gly Lys Glu Phe Leu Pro Met Glu Ala Gln Leu Ser Arg Leu 325 330 335 Ile Gly Gln Ser Leu Trp Asp Val Ser Arg Ser Ser Thr Gly Asn Leu 340 345 350 Val Glu Trp Phe Leu Leu Arg Lys Ala Tyr Glu Arg Asn Glu Leu Ala 355 360 365 Pro Asn Lys Pro Asp Glu Lys Glu Leu Ala Arg Arg Arg Gln Thr Phe 370 375 380 Glu Gly Gly Tyr Ile Lys Glu Pro Glu Arg Gly Leu Trp Glu Asn Ile 385 390 395 400 Val Tyr Leu Asp Phe Arg Ser Ile Ala Pro Ser Ile Ile Ile Thr His 405 410 415 Asn Val Ser Pro Asp Thr Leu Asn Arg Glu Gly Cys Lys Glu Tyr Asp 420 425 430 Val Ala Pro Gln Val Gly His Arg Phe Cys Lys Asp Phe Pro Gly Phe 435 440 445 Ile Pro Ser Leu Leu Gly Asp Leu Leu Glu Glu Arg Gln Lys Ile Lys 450 455 460 Lys Lys Met Lys Ala Thr Ile Asp Pro Ile Glu Arg Lys Leu Leu Asp 465 470 475 480 Tyr Arg Gln Arg Glu Ile Lys Ile Leu Ala Asn Ser Tyr Tyr Gly Tyr 485 490 495 Tyr Gly Tyr Ala Arg Ala Arg Trp Tyr Cys Lys Glu Cys Ala Glu Ser 500 505 510 Val Thr Ala Trp Gly Arg Glu Tyr Ile Thr Met Thr Ile Lys Glu Ile 515 520 525 Glu Glu Lys Tyr Gly Phe Lys Val Ile Tyr Ser Asp Thr Asp Gly Phe 530 535 540 Phe Ala Thr Ile Pro Gly Ala Asp Ala Glu Thr Val Lys Lys Lys Ala 545 550 555 560 Met Glu Phe Leu Lys Tyr Ile Asn Ala Lys Leu Pro Gly Ala Leu Glu 565 570 575 Leu Glu Tyr Glu Gly Phe Tyr Lys Arg Gly Phe Phe His Thr Lys Lys 580 585 590 Lys Tyr Ala Val Ile Asp Glu Glu Gly Lys Ile Thr Thr Arg Gly Leu 595 600 605 Glu Ile Val Arg Arg Asp Trp Ser Glu Ile Ala Lys Glu Thr Gln Ala 610 615 620 Arg Val Leu Glu Ala Leu Leu Lys Asp Gly Asp Val Glu Lys Ala Val 625 630 635 640 Arg Ile Val Lys Glu Val Thr Glu Lys Leu Ser Lys Tyr Glu Val Pro 645 650 655 Pro Glu Lys Leu Val Ile His Glu Gln Ile Thr Arg Asp Leu Lys Asp 660 665 670 Tyr Lys Ala Lys Gly Pro His Met Ala Val Ala Lys Arg Leu Ala Ala 675,680,685 Arg Gly Val Lys Ile Arg Pro Gly Thr Val Ile Ser Tyr Ile Val Leu 690,695,700 Lys Gly Ser Gly Arg Ile Gly Asp Arg Ala Ile Pro Phe Asp Glu Phe 705 710 715 720 Asp Pro Thr Lys His Lys Tyr Asp Ala Glu Tyr Tyr Ile Glu Asn Gln 725 730 735 Val Leu Pro Ala Val Glu Arg Ile Leu Arg Ala Phe Gly Tyr Arg Lys 740,745,750 Glu Asp Leu Arg Gln Lys Thr Gln Arg Val Gly Leu Ser Ala Trp 755,760,765 Leu Lys Pro Lys Gly Thr 770 <210> 2 <211> 2325 <212> DNA <213> Artificial sequence <400> 2 atgattctgg acaccgatta catcaccgaa gatggcaagc cagttatccg cattttcaa 60 aaagagaatg gtgaattca gatcgaat gatcgtacct tcgagccgta cttctatgct 120 ctgctgaaag acgatagcgc gattgaggag gtcaagaaa tcaccgcgga gcgtcacggt 180 acggttgtta ccgtgaaacg cgtggagaaa gtccagaaga aatttctggg tcgcccggtt 240 gaagtgtgga agctgtactt tacgcatccg caagatgttc cggcgattcg cgataagatt 300 cgtgagcacc cggcagtcat tgacatctac gagtatgaca ttccgttcgc caagcgttat 360 ctgatcgata agggtctggt cccgatggag ggtgacgaag aactgaagat gctggcgttc 420 gccatcgcca ctctgtacca cgagggtgaa gagtttgccg agggtccgat cttgatgatt 480 tcctacgcgg acgaagaggg cgcacgtgtt atcacgtgga aaaatgttga tctgccgtat 540 gttgacgtcg taagcaccga gcgtgagatg atcaaacgtt ttctgcgcgt tgttaaagaa 600 aaagatcctg acgtgctgat cacctacaac ggtgacaatt tcgatttcgc gtacctgaag 660 aaacgttgcg aaaaactggg tattaacttc gcgctgggtc gcgatggctc tgaaccgaag 720 atccagcgca tgggtgatcg ttttgcggtc gaggtgaagg gtcgcattca tttcgacctg 780 tacccggtga ttcgtcgtac catcaacttg ccgacttaca ccctggaagc cgtctatgaa 840 gctgtatttg gtcaaccgaa agaaaaagtg tacgctgagg aaattacgac ggcgtgggaa 900 accggtgaga acctggagcg cgttgcacgt tattctatgg aggacgcgaa agttacctac 960 gaactgggta aagagttcct gccgatggag gcccaactgt cccgtctgat cggccaaagc 1020 ctgtgggacg ttagccgcag cagcaccggt aacttagttg aatggttctt gctgcgtaag 1080 gcatacgaac gcaatgagct ggcgccgaac aaaccggacg agaaagaatt ggcgcgtcgc 1140 cgccagacct ttgagggtgg ttatatcaaa gaaccggagc gcggcttgtg ggagaacatc 1200 gtctatttgg atttcgtag cattgcaccg agcatcatta tcacgcataa tgtgagcccg 1260 gatacgttga atcgtgaggg ctgtaaggaa tacgacgtgg cgcctcaggt tggccaccgt 1320 ttctgcaagg actttccggg ctttatcccg agcctgctgg gtgatttgct ggaggaacgt 1380 cagaaaatca agaagaagat gaaagcaacc attgatccga tcgagcgcaa attactggac 1440 taccgtcaac gtgaaatcaa gatcctggcg aattcgtatt atggttacta tggctacgcg 1500 cgtgcgcgct ggtattgcaa agagtgtgcc gagagcgtga ccgcttgggg tcgtgagtac 1560 attaccatga cgatcaaaga gattgaagag aatacggct ttaaggttat ctatagcgac 1620 accgacggtt tctttgcaac tatccctggc gcagacgcag aaaccgttaa gaaaaaggca 1680 atggagtttc tgaagtatat caacgcgaag ttgccaggcg ccctggaact ggagtacgag 1740 ggcttctaca agcgtggctt tttccatacg aaaaagaaat acgctgttat tgatgaagag 1800 ggcaagatca cgacccgtgg cctggaaatt gtgcgccgtg attggagcga aattgcaaaa 1860 gaaacgcaag cgcgtgtgct ggaagcgctg ctgaaggacg gcgacgtcga aaaagctgtg 1920 cgtattgtta aagaggtcac cgagaagctg agcaaatacg aggtcccgcc agagaaattg 1980 gtgattcacg aacagattac gcgtgacctg aaagactata aggccaaagg tccgcatatg 2040 gcagtggcga agcgcctggc ggctcgcggt gtgaagatcc gtccgggtac cgtcattagc 2100 tatatcgtgc tgaagggcag cggtcgtatc ggcgaccgtg cgattccgtt cgacgaattt 2160 gatccgacca aacacaaata tgatgcggaa tactatattg agaaccaagt gctgccagcc 2220 gttgagcgta ttctgcgcgc cttcggttac cgcaaggaag atctgcgtta ccagaaaact 2280 cgtcaggcg gtctgtccgc atggctgaaa ccgaagggca cctga 2325 <210> 3 <211> 25 <212> DNA <213> Artificial sequence <400> 3 ggttttttta tggggggagt ttagg 25 <210> 4 <211> 25 <212> DNA <213> Artificial sequence <400> 4 catctcatct gtaacatcat tggca 25 <210> 5 <211> 37 <212> DNA <213> Artificial sequence <400> 5 cgtgtatgcg taataggatc ccgactcact atggacg 37 <210> 6 <211> 37 <212> DNA <213> Artificial sequence <400> 6 cgtgtatcgt ccatagtgag tcgggatcct attacgc 37

Claims

1. A protein, which is the protein shown in A) below or a derivative thereof: The protein shown in A) is obtained by modifying the amino acid residue at position 485 of the KOD DNA polymerase GH78 amino acid sequence to obtain a protein with DNA polymerase activity; the amino acid sequence of the KOD DNA polymerase GH78 is sequence 1 in the sequence listing. The derivative of the protein shown in A) is a protein derived from A) by adding a tag sequence to the end of the amino acid sequence of the protein shown in A) and possessing DNA polymerase activity. The modification mentioned therein is an amino acid substitution. Wherein the amino acid residue at position 485 is replaced by I or C, the protein is any of the following KOD DNA polymerase mutants: The names of the KOD DNA polymerase mutants and their substitution positions are as follows: The amino acid sequence of GH103 is obtained by replacing E with I at position 485 of sequence 1, while keeping the other amino acid residues unchanged. The amino acid sequence of KH222 is obtained by replacing E at position 485 with I and S at position 451 with L, while keeping the other amino acid residues unchanged. KH223 has an amino acid sequence in which the E at position 485 of sequence 1 is replaced with I, and the serine at position 451 is replaced with threonine, while the other amino acid residues remain unchanged. The amino acid sequence of KH224 is formed by replacing E at position 485 with I and D at position 484 with cysteine, while keeping the other amino acid residues unchanged. KH225 has an amino acid sequence in which the E at position 485 of sequence 1 is replaced with I, and the D at position 480 is replaced with threonine, while the other amino acid residues remain unchanged. The amino acid sequence of KH226 is formed by replacing E at position 485 of sequence 1 with I, and replacing serine at position 451 with glycine, while keeping the other amino acid residues unchanged. The amino acid sequence of KH227 is formed by replacing E at position 485 with I and L at position 453 with A, while keeping the other amino acid residues unchanged. The amino acid sequence of KH228 is formed by replacing E at position 485 with C and R at position 484 with V, while keeping the other amino acid residues unchanged. The amino acid sequence of KH229 is formed by replacing E at position 485 with C and S at position 451 with N, while keeping the other amino acid residues unchanged. The amino acid sequence of KH230 is formed by replacing E at position 485 with C and D at position 480 with N, while keeping the other amino acid residues unchanged. The amino acid sequence of KH232 is obtained by replacing E at position 485 with C and R at position 484 with I, while keeping the other amino acid residues unchanged. The amino acid sequence of KH234 is obtained by replacing E at position 485 with C and I at position 486 with R, while keeping the other amino acid residues unchanged. KH235 has an amino acid sequence in which the E at position 485 of sequence 1 is replaced with I, and the D at position 480 is replaced with S, while the other amino acid residues remain unchanged. The amino acid sequence of KH238 is formed by replacing E at position 485 with I and D at position 480 with Q, while keeping the other amino acid residues unchanged. The amino acid sequence of KH239 is formed by replacing E at position 485 with I and D at position 480 with M, while keeping the other amino acid residues unchanged. The amino acid sequence of KH240 is obtained by replacing E at position 485 with I and S at position 451 with K, while keeping the other amino acid residues unchanged. The amino acid sequence of KH241 is formed by replacing E at position 485 with I and D at position 480 with R, while keeping the other amino acid residues unchanged. The amino acid sequence of KH242 is formed by replacing E at position 485 with I and L at position 453 with N, while keeping the other amino acid residues unchanged. The amino acid sequence of KH244 is formed by replacing E at position 485 with I and S at position 451 with M, while keeping the other amino acid residues unchanged. The amino acid sequence of KH245 is obtained by replacing E at position 485 of sequence 1 with I and K at position 477 with E, while keeping the other amino acid residues unchanged. The amino acid sequence of KH246 is formed by replacing E at position 485 with I and D at position 480 with W, while keeping the other amino acid residues unchanged. The amino acid sequence of KH247 is formed by replacing E at position 485 with I and D at position 480 with K, while keeping the other amino acid residues unchanged. The amino acid sequence of KH248 is formed by replacing E at position 485 with I and S at position 451 with R, while keeping the other amino acid residues unchanged. The amino acid sequence of KH250 is formed by replacing E at position 485 with I and Q at position 665 with R, while keeping the other amino acid residues unchanged. The amino acid sequence of KH251 is formed by replacing E at position 485 with I and Q at position 665 with S, while keeping the other amino acid residues unchanged. The amino acid sequence of KH252 is obtained by replacing E at position 485 of sequence 1 with I and replacing D at position 480 with E, while keeping the other amino acid residues unchanged. The amino acid sequence of KH254 is obtained by replacing E at position 485 with I and Q at position 461 with A, while keeping the other amino acid residues unchanged. KH255 has an amino acid sequence in which the E at position 485 of sequence 1 is replaced with I, and the S at position 451 is replaced with A, while the other amino acid residues remain unchanged. The amino acid sequence of KH256 is obtained by replacing E at position 485 with I and S at position 451 with Q, while keeping the other amino acid residues unchanged. The amino acid sequence of KH257 is formed by replacing E at position 485 with I and I at position 666 with Q, while keeping the other amino acid residues unchanged. The amino acid sequence of KH258 is formed by replacing E at position 485 with I and I at position 666 with T, while keeping the other amino acid residues unchanged. The amino acid sequence of KH259 is formed by replacing E at position 485 with I and T at position 605 with W, while keeping the other amino acid residues unchanged. The amino acid sequence of KH260 is formed by replacing E at position 485 with I and R at position 379 with Y, while keeping the other amino acid residues unchanged. The amino acid sequence of KH261 is formed by replacing E at position 485 with I and L at position 453 with T, while keeping the other amino acid residues unchanged. The amino acid sequence of KH262 is formed by replacing E at position 485 with I and D at position 480 with C, while keeping the other amino acid residues unchanged. The amino acid sequence of KH263 is formed by replacing E at position 485 with I and T at position 605 with V, while keeping the other amino acid residues unchanged. The amino acid sequence of KH264 is formed by replacing E at position 485 with I and D at position 480 with N, while keeping the other amino acid residues unchanged. KH266 has an amino acid sequence in which the E at position 485 of sequence 1 is replaced with I, and the D at position 480 is replaced with G, while the other amino acid residues remain unchanged. The amino acid sequence of KH268 is formed by replacing E at position 485 with I and R at position 379 with H, while keeping the other amino acid residues unchanged. The amino acid sequence of KH269 is formed by replacing E at position 485 with I and K at position 465 with Q, while keeping the other amino acid residues unchanged. KH270 has an amino acid sequence in which the E at position 485 of sequence 1 is replaced with I, and the D at position 480 is replaced with P, while the other amino acid residues remain unchanged. KH271 has an amino acid sequence in which the E at position 485 of sequence 1 is replaced with I, and the D at position 480 is replaced with F, while the other amino acid residues remain unchanged. The amino acid sequence of KH273 is obtained by replacing E at position 485 with I and L at position 453 with V, while keeping the other amino acid residues unchanged. The amino acid sequence of KH274 is formed by replacing E at position 485 with I and D at position 480 with H, while keeping the other amino acid residues unchanged. KH275 has an amino acid sequence in which the E at position 485 of sequence 1 is replaced with I, and the S at position 451 is replaced with P, while the other amino acid residues remain unchanged. The amino acid sequence of KH276 is formed by replacing E at position 485 with I and Q at position 665 with K, while keeping the other amino acid residues unchanged. KH280 has an amino acid sequence in which the E at position 485 of sequence 1 is replaced with I, and the S at position 347 is replaced with V, while the other amino acid residues remain unchanged. The amino acid sequence of KH282 is formed by replacing E at position 485 with I and I at position 666 with A, while keeping the other amino acid residues unchanged. KH286 has an amino acid sequence in which the E at position 485 of sequence 1 is replaced with I, and the T at position 470 is replaced with S, while the other amino acid residues remain unchanged. The amino acid sequence of KH204 is obtained by replacing E at position 485 with I and R at position 484 with K, while keeping the other amino acid residues unchanged. The amino acid sequence of KH209 is formed by replacing E at position 485 with I and Q at position 665 with C, while keeping the other amino acid residues unchanged. The amino acid sequence of QH355 is obtained by replacing E at position 485 with I and G at position 454 with Q, while keeping the other amino acid residues unchanged. The amino acid sequence of QH329 is formed by replacing E at position 485 with I and R at position 484 with G, while keeping the other amino acid residues unchanged. The amino acid sequence of QH369 is obtained by replacing E at position 485 with I and S at position 451 with Q, while keeping the other amino acid residues unchanged. The amino acid sequence of QH370 is formed by replacing E at position 485 with I and I at position 666 with Q, while keeping the other amino acid residues unchanged. The amino acid sequence of QH371 is formed by replacing E at position 485 with I and I at position 666 with R, while keeping the other amino acid residues unchanged. The amino acid sequence of QH305 is obtained by replacing K at position 465 with Q, K at position 584 with T, and E at position 485 with I, while keeping the other amino acid residues unchanged. The amino acid sequence of QH306 is obtained by replacing K at position 465 with Q, D at position 718 with Q, and E at position 485 with I, while keeping the other amino acid residues unchanged. The amino acid sequence of QH307 is as follows: L at position 457 of sequence 1 is replaced with M; Q at position 461 is replaced with A; and E at position 485 is replaced with I, while the other amino acid residues remain unchanged. The amino acid sequence of QH308 is as follows: K at position 676 of sequence 1 is replaced with S; M at position 680 is replaced with I; E at position 485 is replaced with I, and the other amino acid residues remain unchanged. The amino acid sequence of QH309 is as follows: the Y at position 493 of sequence 1 is replaced with F; the Y at position 497 is replaced with L; and the E at position 485 is replaced with I, while the other amino acid residues remain unchanged. The amino acid sequence of QH312 is obtained by replacing D at position 480 with N, S at position 451 with Q, and E at position 485 with I, while keeping the other amino acid residues unchanged. The amino acid sequence of QH316 is as follows: K at position 465 of sequence 1 is replaced with Q; D at position 718 is replaced with Q; D at position 480 is replaced with N; and E at position 485 is replaced with I, while other amino acid residues remain unchanged. The amino acid sequence of QH322 is as follows: M at position 680 of sequence 1 is replaced with I; K at position 676 is replaced with H; and E at position 485 is replaced with I, while the other amino acid residues remain unchanged. The amino acid sequence of QH336 is as follows: E at position 485 of sequence 1 is replaced with I; K at position 676 is replaced with L; M at position 680 is replaced with L, and the other amino acid residues remain unchanged. The amino acid sequence of QH342 is as follows: E at position 485 of sequence 1 is replaced with I; K at position 676 is replaced with L; M at position 680 is replaced with T; and V at position 698 is replaced with I, while the other amino acid residues remain unchanged.

2. A DNA molecule encoding the protein of any one of claims 1.

3. An expression cassette, recombinant vector, or recombinant bacteria containing the DNA molecule of claim 2.

4. A transgenic cell line containing the DNA molecule of claim 2.

5. The use of the protein of claim 1 in at least one of the following: 1)-5) 1) As a DNA polymerase; 2) Catalyzes DNA replication and / or DNA amplification; 3) Perform nucleic acid sequencing; 4) Prepare products for catalyzing DNA replication and / or DNA amplification; 5) Prepare products for nucleic acid sequencing.

6. The use of the DNA molecule of claim 2, or the expression cassette, recombinant vector, or recombinant bacteria of claim 3, or the transgenic cell line of claim 4, in at least one of the following 1)-6): 1) Preparation of DNA polymerase; 2) Catalyzes DNA replication and / or DNA amplification; 3) Perform nucleic acid sequencing; 4) Preparation of DNA polymerase products; 5) Prepare products for catalyzing DNA replication and / or DNA amplification; 6) Prepare products for nucleic acid sequencing.

7. The application according to claim 5 or 6, characterized in that: The sequencing was SBS sequencing. The nucleic acid is DNA, RNA, or the entire genome.

Citation Information

Patent Citations

  • Recombinant KOD polymerase

    WO2020047695A1