A cell-ELISA kit for detecting chicken astrovirus type Ⅱ antibody and a preparation method thereof

By developing a Cell-ELISA kit based on infected chicken hepatocellular carcinoma cell lines, and directly using infected LMH cells as coating antigens, the detection steps were simplified, the complexity and cost issues of type II chicken astrovirus antibody detection were resolved, and rapid and inexpensive antibody detection results were achieved.

CN116593697BActive Publication Date: 2026-02-17YANGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310386227.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-04-11
Publication Date
2026-02-17
Estimated Expiration
2043-04-11

AI Technical Summary

Technical Problem

Currently, there is a lack of effective, inexpensive, and simple methods for detecting type II chicken astrovirus antibodies, especially in China, where existing technologies suffer from complex testing procedures and high costs.

Method used

A Cell-ELISA kit was developed based on a chicken hepatoma cell line infected with type II chicken astrovirus. The kit uses infected LMH cells as the coating antigen to directly measure protein changes in microplates, simplifying the operation process and eliminating the need for antigen purification.

Benefits of technology

It enables rapid, simple detection of chicken astrovirus antibodies with good specificity and sensitivity, suitable for epidemiological surveys and antibody monitoring, reducing detection time and cost.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116593697B_ABST
    Figure CN116593697B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biology and particularly relates to an ELISA kit for detecting chicken astrovirus type II antibodies and a preparation method. The Cell-ELISA experiment is carried out by using LMH cells infected with chicken astrovirus type II to detect the chicken astrovirus type II antibodies. The method has no cross reactivity with positive serum of Newcastle disease virus, avian influenza virus, chicken infectious anemia virus, avian leukosis virus, Marek's virus and chicken infectious bursal virus, which indicates that the method has good specificity. The Cell-ELISA method is used to detect the chicken serum sample to be detected by using whole virus infection, and is assembled into a kit for measuring chicken astrovirus antibodies in serum. The kit can be used for serological diagnosis of chicken astrovirus type II infection, monitoring of the level of antibodies, epidemiological investigation and the like, and provides a novel and effective detection means for prevention and treatment of chicken astrovirus type II.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological products, in particular to a Cell-ELISA kit for detecting chicken astrovirus type II antibodies and a preparation method of the kit, which is used for serological diagnosis of chicken astrovirus type II infection, monitoring of antibody levels, epidemiological investigation, etc. BACKGROUND

[0002] Chicken astrovirus (CAstV) is a non-enveloped, icosahedral, single-stranded RNA virus. Its structure shows a star-like overall structure under an electron microscope, with a genome size of about 7.5 kb, including a 5' non-coding region, three open reading frames (ORF1a, ORF1b, ORF2), a 3' non-coding region, and a polyadenylate tail. Chicken astrovirus is a new type of enteric pathogen found in chicken flocks with delayed growth and development. It can be horizontally transmitted through the fecal-oral route and vertically transmitted from hens to chicks, mainly affecting young chicks, causing delayed growth syndrome, white chick syndrome, and kidney gout in chicks.

[0003] The virus was identified as a new species in 2004. In 2011-2012, gout broke out in commercial chicken flocks in India, resulting in a mortality rate of up to 40% in broilers. Subsequently, white chick hatching syndrome characterized by reduced hatchability, weak and pale plumage in chicks, and increased mortality rate appeared in Europe and North America. In recent years, CAstV infection has shown an upward trend in China, and CAstV infection exists in most provinces. Initial infection may not be severe, but once it spreads and becomes prevalent, it can spread to the entire flock, causing large-scale outbreaks and greatly harming the healthy development of China's poultry industry.

[0004] Initially, the detection of astrovirus infection was identified by observing the characteristic structure of the virus particles, the five / six-pointed star, under an electron microscope (EM), but this method relies on the microscope observation of the test personnel and the culture and storage of the virus, and has many uncertainties. In 2015, Skibinska et al. established an ELISA method using capsid proteins produced by a baculovirus expression vector system as antigens, providing a serological tool for diagnosing infection of chicken astrovirus type I. In 2019, Wu Zongyi et al. established an absolute quantitative qRT-PCR detection method for chicken astrovirus type II. In 2022, Lu et al. established a multiplex detection method for simultaneously detecting CAstV, ANV, and IBV to determine the pathogen of gout in clinical chicken flocks.

[0005] The amino acid homology of the capsid protein of the current domestic isolates is quite different from the currently published foreign isolates, the main epidemic strain type in China is type II chicken astrovirus, the amino acid sequence of the capsid protein has high homology with the FP3 strain in the United Kingdom, can cause developmental retardation and kidney disease, and is widely distributed in Jiangsu, Guangdong, Hebei and other regions. The research on the biological characteristics and pathogenesis of the virus in China is still in its infancy, and there is still a lack of effective vaccine immunization and prevention and control measures, and the development of an antibody detection method for the domestic CAstV epidemic strain, type II chicken astrovirus, is still a blank, so it is of great significance to establish a cheap, simple and rapid chicken astrovirus antibody detection method. SUMMARY

[0006] The application establishes a Cell-ELISA detection kit for detecting type II chicken astrovirus antibodies and application based on ELISA experiments of chicken hepatoma cell lines infected with type II chicken astrovirus, which is used for serological diagnosis, epidemiological investigation and antibody monitoring of chicken astrovirus.

[0007] Compared with the traditional ELISA method, Cell-ELISA uses cells instead of soluble antigens to coat the 96-well cell culture plate, and can directly measure the protein changes in the microplate without lysing the cells, which is an effective method for immunological detection based on the principle of ELISA. It is suitable for cases where the antigen is located on the cell membrane and the characteristics of the corresponding antigen are not very clear or the antigen is difficult to purify. Cells are directly cultured in microplates, and in the operation process, there are no steps such as gel preparation, gel running, membrane transfer and exposure in traditional immunoblotting, and the operation is simple, multiple parallel and multiple repetitions can be easily realized, and the data obtained have statistical analysis significance. The application uses LMH cells infected with chicken astrovirus as coating antigens, solves the problem of difficult purification of chicken astrovirus antigens, saves the steps of preparation and purification of antigens, and greatly reduces the time and cost of the detection method.

[0008] To achieve the above application purposes, the application adopts the following technical solutions:

[0009] A Cell-ELISA detection kit for detecting type II chicken astrovirus antibodies, the detection kit comprises a cell microplate fixed with LMH cells infected with type II chicken astrovirus, and the GenBank number of the type II chicken astrovirus sequence is MK746105.1.

[0010] Further, the kit further comprises a positive control, a negative control, an enzyme-labeled reagent, a sample diluent, a color developing solution and a washing solution.

[0011] Further, the positive control is Balb / c mouse serum against type II chicken astrovirus, and the negative control is ICR mouse serum. Further, the positive control is Balb / c mouse serum against type II chicken astrovirus, and the negative control is ICR mouse serum. Further, the positive control is Balb / c mouse serum against type II chicken astrovirus, and the negative control is ICR mouse serum.

[0012] Further, the enzyme-labeled reagent is horseradish peroxidase-labeled goat anti-chicken IgG antibody and horseradish peroxidase-labeled goat anti-mouse IgG antibody, the sample diluent is PBS containing 3% FBS, the color developing solution is TMB color developing solution, the termination solution is 2M H2SO4, the washing solution is PBS containing 0.05% Tween-20, the blocking solution is PBS containing 3% FBS, and the blocking condition is 37°C for 2h.

[0013] Further, the dilution degree of the first antibody serum is 1:400, the serum action time is 37°C for 60min, the dilution degree of the second antibody serum is 1:20000, and the second antibody action time is 37°C for 60min; and the color developing condition is 37°C for 15min.

[0014] The application further provides a preparation method of the Cell-ELISA detection kit for detecting chicken astrovirus type II antibodies.

[0015] Further, after the plaque-purified chicken astrovirus type II CAstV / NJ1701 strain infects the LMH cells, the LMH cells are identified by RT-PCR, and the primer sequences used are as follows:

[0016] Primer name Primer sequence Product size

[0017] CAstV-ORF1b-F ATTGCATGGCTTCACCGTAATCA 513bp

[0018] CAstV-ORF1b-R CGGTCCATCCCTCTACCAGATTT

[0019] Further, the concentration of the LMH cell line cells is 3×10 4 cells / mL, 100ul per well.

[0020] Further, the infection amount of the chicken astrovirus type II CAstV / NJ1701 strain is MOI=3.0.

[0021] Further, the LMH cell line is cultured in a 96-well cell plate for 14-16h, then the CAstV / NJ1701 strain is added for infection, 24h later, the culture supernatant is discarded, the cells are fixed by using 4% paraformaldehyde for 20min, the cells are permeabilized by using 0.25% Triton-X-100 / PBS, the cells are washed 5 times by using PBST containing 0.05% Tween, the 96-well cell plate is sealed by using a sealing film, and the 96-well cell plate is stored at 4°C for standby.

[0022] The application of the Cell-ELISA detection kit in the epidemiological investigation of the chicken astrovirus type II is also within the protection scope of the application.

[0023] Further, the detection method comprises the following steps:

[0024] (1) cell fixation and permeation: the infected LMH cells are harvested, the cells are fixed with 4% paraformaldehyde for 20 min, the cells are permeated with 0.25% Triton-X-100 / PBS, and washing is performed with PBST containing 0.05% Tween;

[0025] (2) blocking: 3% fetal bovine serum is diluted with PBS as a blocking solution, 400ul / well, and after blocking at 37 DEG C for 2h, the cells are shaken dry and washed with PBST;

[0026] (3) serum action condition: 3% fetal bovine serum is diluted with PBS as a buffer solution, 1:400 dilution, 100ul / well, and after incubation at 37 DEG C for 1h, the cells are shaken dry and washed with PBST;

[0027] (4) adding enzyme-labeled antibody: HRP goat anti-chicken antibody is diluted with PBST at 1:20000, 100ul / well, and after incubation at 37 DEG C for 1h, the cells are shaken dry and washed with PBST;

[0028] (5) substrate color development: TMB substrate color development liquid is 100ul / L / well, and color development is performed at 37 DEG C for 10 min in the dark;

[0029] (6) reaction termination: 50ul of termination liquid 2mol / L H2SO4 is added to each well to terminate the color development reaction; and the data are read at an absorbance of 450nm by using an enzyme label instrument;

[0030] (7) determination of positive and negative critical values: according to the formula: positive and negative critical values = negative sample OD450 average value + standard deviation 3SD, the positive and negative critical values are obtained; and when OD450 is above 0.232, it is determined to be positive.

[0031] Beneficial effects

[0032] The chicken astrovirus type II is used for infecting LMH cells, and the infected cells are used as a coated antigen to assemble the Cell-ELISA kit for detecting the chicken astrovirus type II antibody. The detection result shows that the ELISA kit for detecting the chicken astrovirus type II antibody has good chicken astrovirus specificity and sensitivity, can effectively detect the chicken astrovirus antibody, and can be used for the epidemiological investigation of the chicken astrovirus. BRIEF DESCRIPTION OF DRAWINGS

[0033] Figure 1 is a plaque purification result;

[0034] Figure 2 is a comparison chart of different plating densities of LMH cells;

[0035] Figure 3 is a specific identification result of an ELISA kit for detecting chicken astrovirus type II antibodies. DETAILED DESCRIPTION

[0036] The application will be further explained in connection with the drawings and the specific embodiments, but it should be noted that the specific embodiments are only used to illustrate and explain the application, and are not used to limit the scope of the application.

[0037] Example 1 Plaque purification of chicken astrovirus

[0038] 1. The well-grown LMH cells were digested with 0.25% trypsin and evenly plated in a 6-well plate. After the cells grew into a monolayer, the culture medium was removed, and the CAstV / NJ1701 strain virus stock solution was diluted by 10 times, a total of 5 gradients (10 2 , 10 3 , 10 4 , 10 5 , 10 6 ), and a blank control was prepared. The diluted virus solution was added to each well, and the plate was incubated at 37°C for 5 hours, and then the supernatant was discarded.

[0039] 2. 2% low-melting-point agarose was prepared using 1% F12, and after high pressure, it was taken out and placed in a 55°C water bath for use. Agarose was mixed with 2x maintenance solution (1:1), and 2ml was added to each well of the culture plate, allowing it to cool and solidify into a cover layer. After 20 minutes, the cell culture plate was inverted and incubated in a constant-temperature incubator at 37°C with 5% CO2 for 48 hours.

[0040] 3. A 1% neutral red solution was prepared and filtered with a 0.22μm sterile filter to remove bacteria, and stored at 4°C for standby. The neutral red solution was then diluted with sterile ultrapure water to a 0.25% neutral red solution, which was evenly added to the solidified cell plate, 300μl / well, and left for 15-20 minutes. Then the neutral red diluent was aspirated and the plate was left in a constant-temperature incubator at 37°C with 5% CO2 for 2 hours. A 1.5ml centrifuge tube was prepared and 500μl of 1% F12 was added. The stained cell wells showed obvious single plaques, and the plaque purification results are shown in Figure 1 . A single plaque was picked up in the centrifuge tube and stored at -20°C for standby.

[0041] 4. LMH cells were pre-cultured into 6-well plates. After the cells reached a confluent monolayer, the old culture medium was discarded, and 2 ml of 1% F12 was added to each well, along with a single empty plaque picked in step 3. A blank control group was also included. The plates were incubated at 37°C with 5% CO2 for 5 hours. The culture medium was then discarded, and 1% F12 was added. The plates were then incubated at 37°C with 5% CO2 for another 72 hours. During this period, cell changes were observed, and the viral supernatant was collected. RT-PCR identification was performed using primers designed in Table 1. Simultaneously, chicken astrovirus monoclonal antibody was used as the primary antibody for IFA identification. After three consecutive generations of culture, stable purified chicken astrovirus was obtained, which was used as the virus for subsequent experiments.

[0042] Table 1 Primer sequences for RT-PCR detection of chicken astrovirus

[0043]

[0044] Example 2: Chicken astrovirus infection of LMH cell lines and optimization of infection conditions

[0045] 1. Cells, virus strains, reagents

[0046] The virus strain used in this embodiment was CAstV / NJ1701 (GenBank: MK746105.1) isolated and identified in our laboratory and stored at -80℃; the LMH cell line was obtained from our laboratory; and the trypsin and DMEM / F12 medium were purchased from Gibco.

[0047] 2. Steps for infecting LMH cells with chicken astrovirus

[0048] (1) Digest LMH cells with 0.05% trypsin, resuspend them and add them to DMEM / F12 medium containing 10% FBS. Then, plate them in a 96-well cell culture microplate and incubate overnight at 37°C in a 5% CO2 incubator.

[0049] (2) The purified CAstV / NJ1701 virus was diluted with DMEM / F12 medium containing 1% FBS (MOI=3), the original culture medium of the cells was removed, and 100 μl of virus dilution solution was added to each well. After infection for 24 h, the cells were fixed.

[0050] 3. Optimization of cell density.

[0051] LMH cells were arranged in a density gradient of 2×10⁻⁶. 4 / 3×10 4 / 4×10 4 / 5×10 4The cells were seeded at 3x10 Figure 2 The results showed that when the cell seeding density was 3x10 4 cells / well, the cell density was uniform and not stacked after 12h, and the cell pathology was obvious and less shedding after 24h of infection, and 3x10 4 cells / well was the best seeding density.

[0052] Example 3 Optimization of the Cell-ELISA antibody detection method for type II chicken astrovirus 1. Steps of Cell-ELISA for type II chicken astrovirus

[0053] (1) Cell fixation and permeabilization: discard the culture supernatant of chicken hepatoma cell line infected with chicken astrovirus, fix the cells with 4% paraformaldehyde for 20 min, permeabilize the cells with 0.25% Triton-X-100 / PBS, and wash 5 times with PBST containing 0.05% Tween;

[0054] (2) Blocking: add 400ul / well of blocking solution, block at 37°C for 2h, and wash the plate 3 times with PBST;

[0055] (3) Primary antibody incubation: add 100ul / well of diluted serum to be tested, incubate at 37°C for 1h, and wash the plate 3 times with PBST;

[0056] (4) Secondary antibody incubation: add 100ul / well of diluted HRP-labeled goat anti-mouse IgG antibody, incubate at 37°C for 1h, and wash the plate 5 times with PBST;

[0057] (5) Substrate color development: TMB substrate color development solution 100ul / well, 37°C, avoid light for 15min;

[0058] (6) Reaction termination: add 50ul / well of termination solution 2mol / L H2SO4 to terminate the color development reaction;

[0059] (7) Reading: use the enzyme label to read the data at absorbance 450nm;

[0060] (8) Determination of positive and negative critical values.

[0061] Based on the above basic procedures, the reaction conditions of Cell-ELISA for type II chicken astrovirus were optimized.

[0062] 2. Optimization of Cell-ELISA reaction conditions for type II chicken astrovirus

[0063] (1) Determination of optimal cell density and serum dilution

[0064] The chessboard titration method was used to explore the cell spreading density and serum dilution. The cell density was 2 x 105cells / well, 3 x 105cells / well, 4 x 105cells / well, 5 x 105cells / well, and 6 x 105cells / well, respectively, and the serum dilution was 1:200, 1:400, and 1:800, respectively. The other steps were performed according to the conventional procedure. The OD450 reading was obtained by the enzyme label instrument, and the results were analyzed. The P / N value of the positive and negative serum was calculated to determine the optimal coating concentration and serum dilution. The analysis showed that when the cell density was 3 x 105cells / well and the serum dilution was 1:400, the P / N value was the largest, which was the optimal cell density and serum dilution. As shown in Table 1: 4 2 x 105cells / well, 3 x 105cells / well, 4 x 105cells / well, 5 x 105cells / well, and 6 x 105cells / well, respectively, and the serum dilution was 1:200, 1:400, and 1:800, respectively. The other steps were performed according to the conventional procedure. The OD450 reading was obtained by the enzyme label instrument, and the results were analyzed. The P / N value of the positive and negative serum was calculated to determine the optimal coating concentration and serum dilution. The analysis showed that when the cell density was 3 x 105cells / well and the serum dilution was 1:400, the P / N value was the largest, which was the optimal cell density and serum dilution. As shown in Table 1: 4 2 x 105cells / well, 3 x 105cells / well, 4 x 105cells / well, 5 x 105cells / well, and 6 x 105cells / well, respectively, and the serum dilution was 1:200, 1:400, and 1:800, respectively. The other steps were performed according to the conventional procedure. The OD450 reading was obtained by the enzyme label instrument, and the results were analyzed. The P / N value of the positive and negative serum was calculated to determine the optimal coating concentration and serum dilution. The analysis showed that when the cell density was 3 x 105cells / well and the serum dilution was 1:400, the P / N value was the largest, which was the optimal cell density and serum dilution. As shown in Table 1: 4 2 x 105cells / well, 3 x 105cells / well, 4 x 105cells / well, 5 x 105cells / well, and 6 x 105cells / well, respectively, and the serum dilution was 1:200, 1:400, and 1:800, respectively. The other steps were performed according to the conventional procedure. The OD450 reading was obtained by the enzyme label instrument, and the results were analyzed. The P / N value of the positive and negative serum was calculated to determine the optimal coating concentration and serum dilution. The analysis showed that when the cell density was 3 x 105cells / well and the serum dilution was 1:400, the P / N value was the largest, which was the optimal cell density and serum dilution. As shown in Table 1: 4 2 x 105cells / well, 3 x 105cells / well, 4 x 105cells / well, 5 x 105cells / well, and 6 x 105cells / well, respectively, and the serum dilution was 1:200, 1:400, and 1:800, respectively. The other steps were performed according to the conventional procedure. The OD450 reading was obtained by the enzyme label instrument, and the results were analyzed. The P / N value of the positive and negative serum was calculated to determine the optimal coating concentration and serum dilution. The analysis showed that when the cell density was 3 x 105cells / well and the serum dilution was 1:400, the P / N value was the largest, which was the optimal cell density and serum dilution. As shown in Table 1: 4 2 x 105cells / well, 3 x 105cells / well, 4 x 105cells / well, 5 x 105cells / well, and 6 x 105cells / well, respectively, and the serum dilution was 1:200, 1:400, and 1:800, respectively. The other steps were performed according to the conventional procedure. The OD450 reading was obtained by the enzyme label instrument, and the results were analyzed. The P / N value of the positive and negative serum was calculated to determine the optimal coating concentration and serum dilution. The analysis showed that when the cell density was 3 x 105cells / well and the serum dilution was 1:400, the P / N value was the largest, which was the optimal cell density and serum dilution. As shown in Table 1:

[0065] Table 2 Exploration results of cell density and serum dilution

[0066]

[0067] (2) Determination of the optimal blocking time and blocking liquid

[0068] The action time was set to 60 min, 90 min, and 120 min, respectively, and the blocking liquid was selected to be 3% FBS / PBS, 1% FBS / PBS, 3% BSA / PBST, and 1% BSA / PBST, respectively. ELISA detection was performed to select the P / N maximum value. The analysis showed that when the blocking liquid was 3% FBS / PBS and the blocking time was 120 min, the P / N value was the largest, which was the optimal blocking time and blocking liquid. As shown in Table 2.

[0069] Table 3 Exploration results of blocking time and blocking liquid

[0070]

[0071]

[0072] (3) Determination of the optimal serum diluent and serum action time

[0073] The action time was set to 30 min, 60 min, and 90 min, respectively, and the diluent was selected to be 3% FBS / PBS, LMH cell lysate supernatant, 3% FBS / LMH cell lysate supernatant, and 1% FBS, respectively. ELISA detection was performed to select the P / N maximum value. The analysis showed that when the primary antibody diluent was 3% FBS / PBS and the action time was 60 min, the P / N value was the largest, which was the optimal serum diluent and serum action time. As shown in Table 3.

[0074] Table 4 Exploration results of serum diluent and serum action time

[0075]

[0076] (4) Determination of optimal secondary antibody dilution and secondary antibody incubation time

[0077] The incubation time was set at 30 min, 60 min, and 90 min, respectively, and the dilution was selected as 1:20,000, 1:40,000, 1:80,000, and 1:160,000, respectively, for ELISA detection, and the maximum P / N value was selected. Analysis showed that the optimal secondary antibody dilution and incubation time were 1:20,000 and 60 min, respectively, as shown in Table 4.

[0078] Table 5 Exploration results of secondary antibody dilution and incubation time

[0079]

[0080] (5) Determination of optimal color development time

[0081] 100 μl of TMB color development solution was added to each well for color development in the dark at 37°C, and the color development time was set at 5 min, 10 min, 15 min, and 20 min. 50 μl / well of 2M H2SO4 was used as a stop solution, and the optimal color development time was determined according to the maximum P / N value. The optimal substrate reaction time was 15 min, as shown in Table 5.

[0082] Table 6 Exploration results of color development time

[0083]

[0084] Therefore, the finally determined optimal reaction conditions were as follows: cell plating density of 3 x 104 cells / well, primary antibody dilution of 1:400, blocking solution of 3% FBS / PBS, blocking time of 60 min, primary antibody dilution solution of 3% FBS / PBS, primary antibody incubation time of 60 min, secondary antibody dilution of 1:20,000, secondary antibody incubation time of 60 min, substrate TMB reaction time of 15 min at room temperature, and stop solution of 2M H2SO4.

[0085] Determination of criteria in Example 4

[0086] According to the determined conditions, 44 SPF chicken negative sera were detected, two replicates were set for each sample, the serum antibody OD450nm value was detected, and statistical analysis was performed on the results to obtain the average value (X) and standard deviation (S) of OD450nm, which were used as the determination of the critical value of the ELISA method positive and negative serum criteria, as shown in Table 6.

[0087] Table 7 Exploration results of criteria

[0088]

[0089] The calculation showed that the average value of the 44 SPF chicken negative serum samples was X = 0.115, the standard deviation was SD = 0.039, and the ELISA positive / negative cutoff value was X + 3SD = 0.232. Therefore, the OD450nm value of 0.232 was used as the cutoff value between CAstV positive and negative serum.

[0090] Example 5 Sensitivity Test

[0091] The established ELISA system was used to detect CAstV positive sera at different dilutions. The results are shown in Table 7. When the ELISA was used to detect positive sera at a dilution of 1:12800, the OD450nm value of positive sera was 0.302, indicating a positive result. This means that the lowest detection titer for positive sera by ELISA is 1:12800, and the established ELISA detection method has good sensitivity.

[0092] Table 8. Results of the sensitivity test

[0093]

[0094] Example 6 Specificity Test

[0095] Under the same conditions, positive sera for CAstV, Newcastle disease virus, avian influenza virus, chicken infectious anemia virus, avian leukosis virus, Marek's virus, infectious bursal disease virus, and SPF chicken serum were tested, and the results are as follows: Figure 3 As shown. From Figure 3 As can be seen, the kit only reacts with CAstV positive serum, and does not react with other virus-positive serum or SPF serum, indicating that the kit of the present invention has good specificity.

Claims

1. A method for preparing a Cell-ELISA detection kit for detecting antibodies against chicken astrovirus type II, characterized in that, The detection kit comprises a cell microwell plate fixed with LMH cells infected with chicken astrovirus type II, the GenBank number of the chicken astrovirus type II sequence is MK746105.1, and the chicken astrovirus type II is a plaque-purified chicken astrovirus type II; the plaque-purified chicken astrovirus type II CAstV / NJ1701 strain is used to infect LMH cells, and the cells are fixed, washed and permeabilized after 24 hours; The preparation method comprises the following steps: after the plaque-purified chicken astrovirus type II CAstV / NJ1701 strain is used to infect LMH cells, the infection amount of the chicken astrovirus type II CAstV / NJ1701 strain is MOI=3.0; and RT-PCR identification is performed, and the primer sequence used is as follows: The kit further comprises a positive control, a negative control, an enzyme-labeled reagent, a sample diluent, a color developing solution and a washing solution; the positive control is a Balb / c mouse serum against the chicken astrovirus type II, the negative control is an ICR mouse serum, the enzyme-labeled reagent is a horseradish peroxidase-labeled goat anti-chicken IgG antibody and a horseradish peroxidase-labeled goat anti-mouse IgG antibody, the sample diluent is a PBS containing 3% FBS, the color developing solution is a TMB color developing solution, the termination solution is 2M H2SO4, and the washing solution is a PBS containing 0.05% Tween-20; the blocking solution is a PBS containing 3% FBS, and the blocking condition is 37°C for 2 hours. The dilution of the first antibody serum was 1:400, and the serum was incubated for 60 min at 37°C. The dilution of the second antibody serum was 1:20,000, and the second antibody was incubated for 60 min at 37°C. The color developing condition was 15 min at 37°C. The concentration of the LMH cell line was 3 x 10 4 The dilution of the first antibody serum was 1:400, and the serum was incubated for 60 min at 37°C. The dilution of the second antibody serum was 1:20,000, and the second antibody was incubated for 60 min at 37°C. The color developing condition was 15 min at 37°C. The concentration of the LMH cell line was 3 x 10