A diaminopimelate dehydrogenase mutant and application thereof in synthesis of d-phenylglycine
By modifying the diaminopimelic acid dehydrogenase of Bacillus thermophilus, a mutant with high catalytic activity was obtained, solving the problem of low activity of D-amino acid dehydrogenases. This enabled the efficient catalytic synthesis of D-phenylglycine with high conversion rate and optical purity, making it suitable for industrial applications.
Patent Information
- Application Number
- CN202310659606.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-06-06
- Publication Date
- 2026-03-27
- Estimated Expiration
- 2043-06-06
AI Technical Summary
Existing D-amino acid dehydrogenases have low catalytic activity, making it difficult to efficiently catalyze the synthesis of sterically hindered D-amino acids such as D-phenylglycine. Furthermore, traditional chemical synthesis methods are complex, costly, and have low selectivity, failing to meet market demands.
By cloning diaminopimelic acid dehydrogenase from Bacillus thermophilus and employing error-prone PCR and site-directed saturation mutagenesis, a mutant of diaminopimelic acid dehydrogenase with high catalytic activity was obtained. Combined with a recombinant expression vector and host cells, this mutant efficiently catalyzes the asymmetric reductive amination reaction of benzoylformic acid.
The asymmetric reductive amination reaction of 300mM benzoylformic acid was achieved with high efficiency, and the conversion rate and optical purity of the product D-phenylglycine reached over 99%. It has high catalytic activity and environmental friendliness, making it suitable for industrial applications.
Smart Images

Figure CN116656639B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of bioengineering, and particularly relates to a diaminopimelate dehydrogenase mutant with D-amino acid dehydrogenase activity obtained by molecular modification from diaminopimelate dehydrogenase of Bacillus thermozeamaize, a nucleic acid encoding the diaminopimelate dehydrogenase mutant, a recombinant expression vector containing the nucleic acid, a recombinant expression transformant containing the recombinant expression vector, preparation of the mutant enzyme catalyst, and application of the mutant enzyme catalyst in catalyzing the asymmetric reductive amination of phenylglycolic acid to prepare D-phenylglycine. BACKGROUND
[0002] Most of the biochemical synthesis building blocks in nature are chiral molecules, which cannot coincide with their mirror images like shoes, screws and snail shells. Although chiral molecules have two configurations, nature generally only selects one as a synthesis building block, for example, only L-amino acids are used to synthesize proteins. This selection of nature endows D-amino acids with great potential as perfect synthesis building blocks for other special purposes. For example, D-amino acids have become key chiral building blocks for drugs such as β-lactam antibiotics, fertility drugs, anticoagulants and insecticides. Because most enzyme proteins, after billions of years of natural evolution, can only selectively degrade substances composed of L-amino acids, and have no degrading effect on substances composed of D-amino acids. Therefore, drugs synthesized from D-amino acids not only have better efficacy, but also have better stability in the body, and have broad application prospects. For example, D-phenylglycine is a key precursor of the semi-synthetic antibiotic ampicillin, with a global annual demand of nearly ten thousand tons.
[0003] Although there are currently a variety of methods for chemically synthesizing chiral amino acids, these methods often require the use of some expensive metal catalysts, harsh reaction conditions, complex synthesis routes, and low yield and selectivity, far from meeting the increasing demand for chiral amino acids in the pharmaceutical field. On the contrary, biological catalytic processes have the advantages of green environmental protection, high catalytic efficiency, good selectivity, and mild reaction conditions, and are an important means to replace or expand traditional chemical synthesis methods, and have even become the first choice for synthesizing some complex or multi-chiral center compounds.
[0004] In 1998, Kaneka Corporation of Japan used N-carbamoyl-D-amino acid amidohydrolase to hydrolyze N-carbamoyl-D-phenylglycine to synthesize D-phenylglycine (Bioscience, Biotechnology, and Biochemistry 1998, 62: 875-881). This method has low theoretical yield and the raw material is not easy to obtain, which limits its application and promotion. In the same year, Professor Righetti's group at the University of Verona in Italy used penicillin G acylase to kinetically resolve D,L-phenylglycine. In this synthesis method, penicillin G acylase can acylate L-phenylglycine with methyl p-hydroxyphenylacetate as an acylating agent to obtain D-phenylglycine (Biotechnology and Bioengineering 1998, 60: 454-461). In 2000, Professor Gardossi of the University of Trieste in Italy first reported the use of penicillin G acylase to kinetically resolve D,L-phenylglycine methyl ester to synthesize D-phenylglycine methyl ester in pure organic solvents. In this method, penicillin G acylase can selectively acylate the amino group of L-phenylglycine methyl ester, while it has no acylating activity for D-phenylglycine methyl ester, thereby achieving the purpose of resolving the two enantiomers (Tetrahedron: Asymmetry 2000, 11: 1789-1796). However, the above two methods have the limitation of a theoretical yield of only 50%, and the carboxyl group of phenylglycine needs to be protected in advance, which is a complicated process. In 2014, Professor Wei Dongzhi's group at East China University of Technology used nitrilase to kinetically resolve phenylglycine nitrile to synthesize D-phenylglycine. Although this method can break through the limitation of a theoretical yield of 50% in kinetic resolution, the raw material involved in this route is highly toxic cyanide, which is not green and environmentally friendly, and the optical purity of the product is not ideal, less than 97% ee (Tetrahedron Lett. 2014, 55: 1448-1451).
[0005] The method of amino acid dehydrogenase catalyzing the asymmetric amination reduction of keto acid to synthesize chiral amino acid not only has good atom economy and high theoretical yield, but also has great potential in the application of chiral amino acid synthesis, and has attracted widespread attention. However, there are very few naturally occurring D-amino acid dehydrogenases in nature, and they are in the form of membrane proteins, which is not conducive to large-scale preparation and industrial application. The only D-amino acid dehydrogenase that can be efficiently expressed in Escherichia coli is the key enzyme in the L-lysine synthesis pathway in vivo, meso-diaminopimelate dehydrogenase. It can catalyze the asymmetric amination of keto acid to produce chiral amino acid with NADPH as the coenzyme. However, the activity of meso-diaminopimelate dehydrogenase is very low, and the yield of chiral amino acid is very low. Therefore, it is necessary to improve the activity of meso-diaminopimelate dehydrogenase and to find new D-amino acid dehydrogenases. + / NADPH as coenzyme reversibly catalyzes the oxidation and deamination of the D-type chiral center of meso-diaminopimelic acid to generate L-2-amino-6-carbonyl heptanedioic acid. In 2006, Novick et al. mutated the amino acid residues of Corynebacterium glutamicum meso-diaminopimelic acid dehydrogenase that interact with the L-type chiral center of the substrate, and the obtained mutant could catalyze the synthesis of aliphatic D-amino acids with a carbon chain length similar to that of the natural substrate (C6-C8), but had no catalytic activity for large steric hindrance substrates such as benzoyl formic acid (Journal of the American Chemical Society 2006, 128: 10923-10929). In 2018, the research group of Zhu Dunming of the Institute of Industrial Microbiology of the Chinese Academy of Sciences carried out molecular modification on Symbiobacterium thermophilum meso-diaminopimelic acid dehydrogenase, and the obtained mutant first showed catalytic activity for benzoyl formic acid, but the activity was very low, only 240 mU / mg, and the product yield after 24 hours of reaction at a substrate concentration of 20 mM was only 75%, which still had a long way to go for practical application (Catalysis Science & Technology 2018, 8: 4994-5002). Therefore, it is urgent to develop D-amino acid dehydrogenase with better catalytic performance to meet the technical needs and market demand for the synthesis of large steric hindrance D-amino acids such as D-phenylglycine. SUMMARY
[0006] In order to overcome the low activity of D-amino acid dehydrogenase in the prior art, the present application provides a diaminoheptanedioate dehydrogenase mutant and its application in the synthesis of D-phenylglycine.
[0007] The present application provides a diaminoheptanedioate dehydrogenase mutant with significantly improved catalytic performance, a nucleic acid encoding the diaminoheptanedioate dehydrogenase mutant, a recombinant expression vector containing the nucleic acid, a recombinant expression transformant containing the recombinant expression vector, a diaminoheptanedioate dehydrogenase mutant catalyst, and the application of the diaminoheptanedioate dehydrogenase mutant catalyst in the synthesis of D-phenylglycine by asymmetric reduction and amination of the substrate benzoyl formic acid. It has the advantages of high substrate concentration, mild reaction conditions, environmental friendliness, and high yield.
[0008] The object of the present application can be achieved by the following technical solutions:
[0009] In one aspect, the present application provides a diaminoheptanedioate dehydrogenase mutant with significantly improved catalytic performance.
[0010] The present application clones a diaminopimelate dehydrogenase (UniProt ID: OUM90926.1) from Bacillus thermozeamaize by gene database mining, which is named as BtDAPDH, and the amino acid sequence is shown as SEQ ID No. 2. Then, the diaminopimelate dehydrogenase mutants with significantly improved asymmetric reductive amination activity of benzoylformate are obtained by error-prone PCR, site-directed saturation mutagenesis and combination mutation and other directed evolution strategies.
[0011] The protein corresponding to the new amino acid sequence formed by replacing one or more of the amino acid residues at positions 98, 101, 129, 130, 134, 154, 160, 163, 164, 165, 177, 179, 189, 233, 235 and 237 of the amino acid sequence shown as SEQ ID No. 2 with other amino acid residues, wherein the protein exhibits significantly improved asymmetric reductive amination activity of benzoylformate.
[0012] Further, the diaminopimelate dehydrogenase mutant with high catalytic activity for benzoylformate provided by the present application is a protein having the following amino acid sequence:
[0013] (1) replacing the tryptophan at position 129 of the amino acid sequence shown as SEQ ID No. 2 with threonine, which is named as BtDAPDH W129T ;
[0014] (2) replacing the tryptophan at position 129 of the amino acid sequence shown as SEQ ID No. 2 with glycine, which is named as BtDAPDH W129G ;
[0015] (3) replacing the tryptophan at position 129 of the amino acid sequence shown as SEQ ID No. 2 with proline, which is named as BtDAPDH W129P ;
[0016] (4) replacing the phenylalanine at position 154 of the amino acid sequence shown as SEQ ID No. 2 with valine, which is named as BtDAPDH F154V ;
[0017] (5) replacing the threonine at position 179 of the amino acid sequence shown as SEQ ID No. 2 with valine, which is named as BtDAPDH T179V ;
[0018] (6) the arginine at position 189 of the amino acid sequence shown as SEQ ID No. 2 is replaced by phenylalanine, named BtDAPDH R189F ;
[0019] (7) the histidine at position 235 of the amino acid sequence shown as SEQ ID No. 2 is replaced by isoleucine, named BtDAPDH H235I ;
[0020] (8) the histidine at position 235 of the amino acid sequence shown as SEQ ID No. 2 is replaced by methionine, named BtDAPDH H235M ;
[0021] (9) the histidine at position 235 of the amino acid sequence shown as SEQ ID No. 2 is replaced by valine, named BtDAPDH H235V ;
[0022] (10) the histidine at position 235 of the amino acid sequence shown as SEQ ID No. 2 is replaced by serine, named BtDAPDH H235S ;
[0023] (11) the tryptophan at position 129 of the amino acid sequence shown as SEQ ID No. 2 is replaced by threonine, and the phenylalanine at position 154 is replaced by valine, named BtDAPDH W129T / F154V ;
[0024] (12) the tryptophan at position 129 of the amino acid sequence shown as SEQ ID No. 2 is replaced by proline, and the phenylalanine at position 154 is replaced by valine, named BtDAPDH W129P / F154V ;
[0025] (13) the phenylalanine at position 154 of the amino acid sequence shown as SEQ ID No. 2 is replaced by valine, and the threonine at position 179 is replaced by valine, named BtDAPDH F154V / T179V ;
[0026] (14) the phenylalanine at position 154 of the amino acid sequence shown as SEQ ID No. 2 is replaced by valine, and the arginine at position 189 is replaced by phenylalanine, named BtDAPDH F154V / R189F ;
[0027] (15) the phenylalanine at position 154 of the amino acid sequence shown as SEQ ID No. 2 is replaced by valine, and the histidine at position 235 is replaced by serine, named BtDAPDH F154V / H235S ;
[0028] (16) the phenylalanine at position 154 and the histidine at position 235 of the amino acid sequence shown in SEQ ID No. 2 are replaced by valine and isoleucine, respectively, and designated as BtDAPDH F154V / H235I ;
[0029] (17) the tryptophan at position 129, the phenylalanine at position 154 and the histidine at position 235 of the amino acid sequence shown in SEQ ID No. 2 are replaced by threonine, valine and isoleucine, respectively, and designated as BtDAPDH W129T / F154V / H235I ;
[0030] (18) the tryptophan at position 129, the phenylalanine at position 154 and the threonine at position 179 of the amino acid sequence shown in SEQ ID No. 2 are replaced by threonine, valine and valine, respectively, and designated as BtDAPDH W129T / F154V / T179V ;
[0031] (19) the serine at position 98, the tryptophan at position 129, the phenylalanine at position 154 and the histidine at position 235 of the amino acid sequence shown in SEQ ID No. 2 are replaced by isoleucine, threonine, valine and isoleucine, respectively, and designated as BtDAPDH S98I / W129T / F154V / H235I ;
[0032] (20) the serine at position 98, the tryptophan at position 129, the phenylalanine at position 154 and the histidine at position 235 of the amino acid sequence shown in SEQ ID No. 2 are replaced by asparagine, threonine, valine and isoleucine, respectively, and designated as BtDAPDH S98N / W129T / F154V / H235I ;
[0033] (21) the serine at position 98, the tryptophan at position 129, the phenylalanine at position 154 and the histidine at position 235 of the amino acid sequence shown in SEQ ID No. 2 are replaced by proline, threonine, valine and isoleucine, respectively, and designated as BtDAPDH S98P / W129T / F154V / H235I ;
[0034] (22) the serine at position 98, the tryptophan at position 129, the phenylalanine at position 154 and the histidine at position 235 of the amino acid sequence shown in SEQ ID No. 2 are replaced by cysteine, threonine, valine and isoleucine, respectively, and designated as BtDAPDH S98C / W129T / F154V / H235I ;
[0035] (23) the serine at position 98, the tryptophan at position 129, the phenylalanine at position 154 and the histidine at position 235 of the amino acid sequence shown in SEQ ID No. 2 are replaced by valine, threonine, valine and isoleucine, respectively, and designated as BtDAPDHS98V / W129T / F154V / H235I ;
[0036] (24) Replace the tryptophan at position 129, the aspartic acid at position 130, the phenylalanine at position 154, the histidine at position 235 of the amino acid sequence shown as SEQ ID No. 2 with threonine, serine, valine and isoleucine, respectively, designated as BtDAPDH W129T / D130S / F154V / H235I ;
[0037] (25) Replace the tryptophan at position 129, the proline at position 134, the phenylalanine at position 154, the histidine at position 235 of the amino acid sequence shown as SEQ ID No. 2 with threonine, cysteine, valine and isoleucine, respectively, designated as BtDAPDH W129T / P134C / F154V / H235I ;
[0038] (26) Replace the tryptophan at position 129, the proline at position 134, the phenylalanine at position 154, the histidine at position 235 of the amino acid sequence shown as SEQ ID No. 2 with threonine, isoleucine, valine and isoleucine, respectively, designated as BtDAPDH W129T / P134I / F154V / H235I ;
[0039] (27) Replace the tryptophan at position 129, the proline at position 134, the phenylalanine at position 154, the histidine at position 235 of the amino acid sequence shown as SEQ ID No. 2 with threonine, methionine, valine and isoleucine, respectively, designated as BtDAPDH W129T / P134M / F154V / H235I ;
[0040] (28) Replace the tryptophan at position 129, the proline at position 134, the phenylalanine at position 154, the histidine at position 235 of the amino acid sequence shown as SEQ ID No. 2 with threonine, leucine, valine and isoleucine, respectively, designated as BtDAPDH W129T / P134L / F154V / H235I ;
[0041] (29) Replace the tryptophan at position 129, the proline at position 134, the phenylalanine at position 154, the histidine at position 235 of the amino acid sequence shown as SEQ ID No. 2 with threonine, serine, valine and isoleucine, respectively, designated as BtDAPDH W129T / P134S / F154V / H235I ;
[0042] (30) Replace the tryptophan at position 129, the proline at position 134, the phenylalanine at position 154, the histidine at position 235 of the amino acid sequence shown as SEQ ID No. 2 with threonine, threonine, valine and isoleucine, respectively, designated as BtDAPDH W129T / P134T / F154V / H235I ;
[0043] (31) the tryptophan at position 129, the proline at position 134, the phenylalanine at position 154, the histidine at position 235 of the amino acid sequence shown in SEQ ID No. 2 are replaced by threonine, alanine, valine, isoleucine, respectively, designated as BtDAPDH W129T / P134A / F154V / H235I ;
[0044] (32) the tryptophan at position 129, the phenylalanine at position 154, the methionine at position 160, the histidine at position 235 of the amino acid sequence shown in SEQ ID No. 2 are replaced by threonine, valine, leucine, isoleucine, respectively, designated as BtDAPDH W129T / F154V / M160L / H235I ;
[0045] (33) the tryptophan at position 129, the phenylalanine at position 154, the serine at position 163, the histidine at position 235 of the amino acid sequence shown in SEQ ID No. 2 are replaced by threonine, valine, threonine, isoleucine, respectively, designated as BtDAPDH W129T / F154V / S163T / H235I ;
[0046] (34) the isoleucine at position 101, the tryptophan at position 129, the proline at position 134, the phenylalanine at position 154, the histidine at position 235 of the amino acid sequence shown in SEQ ID No. 2 are replaced by glutamine, threonine, cysteine, valine, isoleucine, respectively, designated as BtDAPDH I101Q / W129T / P134C / F154V / H235I ;
[0047] (35) the tryptophan at position 129, the proline at position 134, the phenylalanine at position 154, the valine at position 164, the histidine at position 235 of the amino acid sequence shown in SEQ ID No. 2 are replaced by threonine, cysteine, valine, arginine, isoleucine, respectively, designated as BtDAPDH W129T / P134C / F154V / V164R / H235I ;
[0048] (36) the tryptophan at position 129, the proline at position 134, the phenylalanine at position 154, the alanine at position 165, the histidine at position 235 of the amino acid sequence shown in SEQ ID No. 2 are replaced by threonine, cysteine, valine, valine, isoleucine, respectively, designated as BtDAPDH W129T / P134C / F154V / A165V / H235I ;
[0049] (37) the tryptophan at position 129, the proline at position 134, the phenylalanine at position 154, the serine at position 177, the histidine at position 235 of the amino acid sequence shown in SEQ ID No. 2 are replaced by threonine, cysteine, valine, glycine, isoleucine, respectively, designated as BtDAPDH W129T / P134C / F154V / S177G / H235I ;
[0050] (38) The 129th tryptophan, the 134th proline, the 154th phenylalanine, the 177th serine, the 235th histidine of the amino acid sequence shown as SEQ ID No. 2 are replaced by threonine, cysteine, valine, alanine, isoleucine respectively, named as BtDAPDH W129T / P134C / F154V / S177A / H235I ;
[0051] (39) The 129th tryptophan, the 134th proline, the 154th phenylalanine, the 177th serine, the 235th histidine of the amino acid sequence shown as SEQ ID No. 2 are replaced by threonine, cysteine, valine, proline, isoleucine respectively, named as BtDAPDH W129T / P134C / F154V / S177P / H235I ;
[0052] (40) The 129th tryptophan, the 134th proline, the 154th phenylalanine, the 233th arginine, the 235th histidine of the amino acid sequence shown as SEQ ID No. 2 are replaced by threonine, cysteine, valine, leucine, isoleucine respectively, named as BtDAPDH W129T / P134C / F154V / R233L / H235I ;
[0053] (41) The 129th tryptophan, the 134th proline, the 154th phenylalanine, the 235th histidine, the 237th valine of the amino acid sequence shown as SEQ ID No. 2 are replaced by threonine, cysteine, valine, isoleucine, leucine respectively, named as BtDAPDH W129T / P134C / F154V / H235I / V237L .
[0054] The second technical solution of the present application provides a nucleic acid encoding the diaminopimelate dehydrogenase mutant as described in the first technical solution of the present application.
[0055] The gene expression encodes the diaminopimelate dehydrogenase mutant as described in the first technical solution, which is derived from cloning the gene sequence of the series of diaminopimelate dehydrogenase mutants as described in the first technical solution by genetic engineering technology.
[0056] The third technical solution of the present application provides a recombinant expression vector comprising the nucleic acid as described in the second technical solution of the present application.
[0057] The recombinant expression vector can be constructed by linking the nucleic acid encoding the diaminopimelate dehydrogenase mutant of the present application to various suitable vectors by conventional methods in the art. The vector can be various conventional vectors in the art, as long as the recombinant expression vector can normally replicate in the corresponding expression host and express the diaminopimelate dehydrogenase mutant. The diaminopimelate dehydrogenase mutant gene can be operably linked downstream of a suitable regulatory sequence in the vector to achieve constitutive or inducible expression of the diaminopimelate dehydrogenase mutant. For an E. coli host, the plasmid vector is preferably a pET-28a(+) plasmid.
[0058] The fourth technical solution of the present application provides a recombinant expression transformant comprising the diaminopimelate dehydrogenase mutant gene of the present application.
[0059] The recombinant expression transformant can be prepared by transforming the recombinant expression vector that has been constructed into a host cell by conventional techniques in the art. The host cell is various conventional host cells in the art, as long as the recombinant expression vector can stably replicate itself and effectively express the diaminopimelate dehydrogenase mutant gene after induction by an inducer. The present application first prefers E. coli as the host cell, and more preferably E. coli BL21(DE3) for efficient expression of the diaminopimelate dehydrogenase mutant of the present application.
[0060] The fifth technical solution of the present application provides a recombinant diaminopimelate dehydrogenase mutant catalyst.
[0061] The recombinant diaminopimelate dehydrogenase mutant catalyst is in any of the following forms:
[0062] (1) culturing the recombinant expression transformant of the present application, and isolating the transformant cells containing the diaminopimelate dehydrogenase mutant;
[0063] (2) culturing the recombinant expression transformant of the present application, isolating the transformant cells containing the diaminopimelate dehydrogenase mutant, and crushing the transformant cells containing the diaminopimelate dehydrogenase mutant to obtain a cell crushing solution;
[0064] (3) culturing the recombinant expression transformant of the present application, isolating the transformant cells containing the diaminopimelate dehydrogenase mutant, crushing the transformant cells containing the diaminopimelate dehydrogenase mutant to obtain a cell crushing solution, and freeze-drying the diaminopimelate dehydrogenase mutant cell crushing solution to obtain a freeze-dried enzyme powder.
[0065] The culture method and condition of the recombinant expression transformant are conventional methods and conditions in the art, and different preferred culture methods and conditions are used for the recombinant expression transformants constructed using different hosts, as long as the recombinant expression transformant can grow and efficiently produce the diaminopimelic acid dehydrogenase mutant of the present application.
[0066] For the recombinant E. coli, the preferred culture medium is LB medium: 10 g / L of proteose peptone, 5 g / L of yeast extract, 10 g / L of NaCl, pH 6.5-7.0. The preferred culture method is as follows: the recombinant E. coli as described above is inoculated into LB medium containing kanamycin and cultured at 37℃ with 180 rpm shaking overnight. The seed liquid is inoculated into a 5L fermenter containing 3L of LB medium (containing kanamycin), and the dissolved oxygen (DO) is controlled to be above 30% by adjusting the stirring speed, supplementing carbon and nitrogen sources. When the OD600 of the culture solution reaches 8-10, isopropyl-β-D-thiogalactopyranoside (IPTG) is added as an inducer at a final concentration of 0.1-0.5 mmol / L, and the culture is induced at 16-25℃ for 8-24 h. The culture solution is centrifuged to collect the cells, which are then washed twice with physiological saline to obtain the recombinant expression transformant cells. The harvested recombinant expression transformant cells are freeze-dried to obtain freeze-dried cells containing the diaminopimelic acid dehydrogenase mutant. The harvested recombinant expression transformant cells are suspended in 5-10 times the volume (w / v) of buffer, sonicated, and the supernatant is collected by centrifugation to obtain the cell lysate of the recombinant diaminopimelic acid dehydrogenase mutant. The collected cell lysate is frozen at -80℃, and then low-temperature dried using a vacuum freeze dryer to obtain freeze-dried enzyme powder of the recombinant diaminopimelic acid dehydrogenase mutant. The obtained freeze-dried enzyme powder is stored in a 4℃ refrigerator and can be conveniently used.
[0067] Sixth, the present application provides a method for determining the activity of the diaminopimelic acid dehydrogenase mutant, specifically, 990 μL of reaction solution (400 mM ammonium formate buffer, pH 9.0) containing 10 μL of benzoylformic acid (final concentration 10 mM) and 20 μL of coenzyme NADPH (final concentration 0.2 mM) is preheated to 60℃, then 10 μL of appropriately diluted diaminopimelic acid dehydrogenase mutant is added, and the absorbance change of NADPH at 340 nm is detected by spectrophotometer. One unit of enzyme activity (U) is defined as the amount of enzyme required to catalyze the oxidation of 1 μmol of NADPH per minute under the above conditions.
[0068] The application provides application of the diaminopimelate dehydrogenase mutant or the recombinant diaminopimelate dehydrogenase mutant catalyst in catalyzing preparation of D-phenylglycine through asymmetric reduction and amination of benzoylformic acid. + .
[0069] Further, the in-situ regeneration of the coenzyme NADPH can be realized through reaction coupling with the formic acid oxidation reaction catalyzed by the formate dehydrogenase, with ammonium formate as a co-substrate.
[0070] Alternatively, the in-situ regeneration of the coenzyme NADPH can be realized through reaction coupling with the glucose oxidation reaction catalyzed by the glucose dehydrogenase, with glucose as a co-substrate.
[0071] In the application, the concentration of the benzoylformic acid substrate can be 10-300 mM. The amount of NADP + in the reaction solution is 0.1-0.5 mM. During the reaction, ammonium formate or glucose can be used as a co-substrate, and the oxidation reaction of formate ions or glucose catalyzed by the formate dehydrogenase or the glucose dehydrogenase is used to realize the cyclic regeneration of the NADPH coenzyme in the reaction system. The ammonia / formic acid ammonium buffer (but not limited to the ammonia / formic acid ammonium buffer) required in the asymmetric reduction reaction is a conventional buffer in the field, and the concentration thereof is preferably 400 mM. The asymmetric reduction reaction is carried out under oscillation or stirring. The temperature of the asymmetric reduction reaction is 30-50 DEG C. The reaction time is the time when the substrate is completely converted or the reaction is self-terminated, and the reaction time is preferably less than 24 h.
[0072] After the reaction is completed, the reduced product D-phenylglycine in the reaction solution is separated and purified through a strong acid cation exchange resin by using a conventional method, the ammonia eluent collected is freeze-dried, and the target product is obtained.
[0073] Compared with the prior art, the technical effects of the application mainly embody the following aspects:
[0074] The application provides a diaminopimelate dehydrogenase mutant with better catalytic performance, which can efficiently catalyze the asymmetric reduction and amination reaction of benzoylformic acid to prepare optically pure D-phenylglycine.
[0075] The diaminopimelic acid dehydrogenase mutant of the application can catalyze the asymmetric reductive amination reaction of 300 mM phenylglycolic acid, achieve a conversion rate of more than 99%, and an optical purity of more than 99% ee. Compared with the wild-type diaminopimelic acid dehydrogenase, the diaminopimelic acid dehydrogenase mutant obtained by the application has the advantages of high catalytic activity, high substrate concentration, and high space-time yield, and therefore has good industrial application prospects. BRIEF DESCRIPTION OF DRAWINGS
[0076] Figure 1 A schematic diagram for preparing D-phenylglycine by the diaminopimelic acid dehydrogenase mutant catalyzing the asymmetric reductive amination reaction of phenylglycolic acid. DETAILED DESCRIPTION
[0077] The application will be described in detail below with reference to the accompanying drawings and specific examples.
[0078] The reaction or detection conditions described in the summary of the application can be combined or modified according to common sense in the art and can be verified by experiments.
[0079] The technical solutions and technical effects in the application will be described clearly and completely below with reference to specific examples, but the protection scope of the application is not limited to these examples, and any changes or equivalent substitutions that do not deviate from the concept of the application are included in the protection scope of the application.
[0080] The materials in the following examples are from:
[0081] The recombinant plasmid pET28a-BtDAPDH contains the nucleic acid sequence shown in SEQ ID No. 1 of the sequence listing and is constructed by the inventors themselves.
[0082] The empty plasmid vector pET-28a is purchased from Novagen Company.
[0083] The E. coli BL21(DE3) competent cells, 2xTaq PCR MasterMix, and agarose gel DNA recovery kit are all purchased from Beijing Tiangen Biotech Co., Ltd.
[0084] The restriction endonucleases Hind III and Xho I are commercially available products of New England Biolabs (NEB) Company.
[0085] In the examples, mM is the abbreviation of mmol / L.
[0086] Unless otherwise specified, the specific experiments in the following examples are carried out according to the conventional methods and conditions in the art, or in accordance with the product instructions of the kit.
[0087] Example 1 Random mutation screening of diaminopimelate dehydrogenase mutants with improved activity
[0088] Random mutation was performed on the nucleotide sequence encoding diaminopimelate dehydrogenase BtDAPDH shown in SEQ ID No. 1 by using error-prone PCR.
[0089] The primers used were as follows:
[0090] The sequence of the upstream primer was as follows: AAGCTT GCATGAGCGAAATCAGGACAGAACGA (shown in SEQ ID No. 3)
[0091] The sequence of the downstream primer was as follows: CTCGAG TTATACCAAACGGCGAATCAGCTC (shown in SEQ ID No. 4)
[0092] Among them, the sequence AAGCTT in the upstream primer is the enzyme cutting site of Hind III, and the sequence CTCGAG in the downstream primer is the enzyme cutting site of Xho I.
[0093] The random mutant library was constructed by using rTaq DNA polymerase for error-prone PCR with pET28a-BtDAPDH as the template. The PCR system (50 μL) was as follows: rTaq DNA polymerase 1 μL, 10×PCR buffer (Mg 2+ Plus) 5.0 μL, dNTP Mixture (2.0 mM each) 4.0 μL, MnCl2 with a final concentration of 150 μmol / L, pET28a-BtDAPDH plasmid 50 ng, upstream and downstream primers (10 μM) each 1 μL, and sterilized distilled water to make up to 50 μL. The PCR reaction program was as follows: (1) 95 ℃ pre-denaturation for 5 min; (2) 94 ℃ denaturation for 30 s; (3) 58 ℃ annealing for 30 s; (4) 72 ℃ extension for 1 min; steps (2)-(4) were performed for 30 cycles; finally 72 ℃ extension for 10 min, and the product was stored at 4 ℃. After the PCR product was analyzed by agarose gel electrophoresis, the gel was cut and recovered for purification. The recovered target gene DNA fragment and empty plasmid pET-28a were respectively double-digested with restriction enzymes Hind III and Xho I at 37 ℃ for 6 h. After the double-digested product was analyzed by agarose gel electrophoresis, the gel was cut and recovered for purification. The linearized pET-28a plasmid and the purified target gene DNA fragment were placed in 16 ℃ for ligation overnight by using T4 DNA ligase. The ligation product was transformed into E. coli BL21 (DE3) competent cells, and uniformly coated on LB agar plates containing 50 μg / mL kanamycin, and placed in a 37 ℃ incubator for about 12 h.
[0094] The transformants on the transformation plate were picked with sterilized toothpicks into 96-well deep well plates and incubated at 37°C, 220 rpm overnight. 50 μL of the bacterial solution was transferred from the primary plate into the secondary plate and incubated at 37°C, 220 rpm for 2-3 h. Then IPTG was added to a final concentration of 0.2 mM and the plates were incubated at 16°C for 24 h. The cells were then centrifuged at 4°C, 3500 x g for 10 min and the supernatant was discarded. 200 μL of lysozyme solution (750 mg lysozyme and 10 mg DNase were dissolved in 1 L deionized water) was added to each well and mixed well. The plates were then incubated at 37°C for 1.5 h. The cells were then centrifuged at 4°C, 3500 x g for 10 min and 50 μL of the supernatant was transferred into a 96-well plate containing 150 μL of reaction solution (the reaction solution was prepared as follows: 400 mM ammonium formate, pH 9.0, 10 mM benzoylformic acid, 0.1 mM NADPH). The plates were mixed well and the change in absorbance at 340 nm was measured at 60°C for 1 min. The higher the activity of the mutant, the faster the absorbance at 340 nm decreased. Mutants with a higher decrease in absorbance at 340 nm than the wild type were selected for re-screening. The mutants were induced in a flask, purified and the specific activity of the purified enzyme was determined. The corresponding genes were sequenced.
[0095] By screening, it is found that the activity of the preferred mutant to benzoyl formic acid is significantly improved by replacing the 98th serine of diaminopimelate dehydrogenase with isoleucine, replacing the 98th serine with asparagine, replacing the 98th serine with proline, replacing the 98th serine with cysteine, replacing the 98th serine with valine, replacing the 101st isoleucine with glutamine, replacing the 129th tryptophan with threonine, replacing the 129th tryptophan with glycine, replacing the 129th tryptophan with proline, replacing the 130th aspartic acid with serine, replacing the 134th proline with cysteine, replacing the 134th proline with isoleucine, replacing the 134th proline with methionine, replacing the 134th proline with leucine, replacing the 134th proline with serine, replacing the 134th proline with threonine, replacing the 134th proline with alanine, replacing the 154th phenylalanine with valine, replacing the 160th methionine with leucine, replacing the 163rd serine with threonine, replacing the 164th valine with arginine, replacing the 165th alanine with valine, replacing the 177th serine with glycine, replacing the 177th serine with alanine, replacing the 177th serine with proline, replacing the 179th threonine with valine, replacing the 189th arginine with phenylalanine, replacing the 233rd arginine with leucine, replacing the 235th histidine with isoleucine, replacing the 235th histidine with methionine, replacing the 235th histidine with valine, replacing the 235th histidine with serine, and replacing the 237th valine with leucine.
[0096] Purification of recombinant diaminopimelate dehydrogenase mutants of Example 2
[0097] The recombinant diaminopimelate dehydrogenase bacterial cells are resuspended at a ratio of 1 g of wet cells to 10 mL of A solution. After mixing thoroughly, the bacterial cells are placed in an ultrasonic disrupter for cell disruption. The total working time is set to 15 min, and ultrasonic disruption is performed every 6 s for 4 s. The disrupted solution is light yellow and slightly translucent. It is placed in a centrifuge at 4°C and 12000 rpm for 35 min. After centrifugation, the supernatant is collected and stored in an ice box, waiting for subsequent purification operations. The nickel column is treated as follows: first, rinse the nickel column with ultrapure water to wash away the residual ethanol; then, equilibrate the nickel column with A solution. To ensure that the column is fully equilibrated, at least 4 column volumes of A solution are used for equilibration. Then, add the disrupted supernatant to the equilibrated nickel column, and the supernatant slowly flows out, while the target protein binds to the Ni 2+Binding was left on the column. After eluting the impurities with A (20 mM Tris, 250 mM NaCl, 10 mM imidazole, 0.0375% (v / v) β-mercaptoethanol), the target protein was eluted with B (20 mM Tris, 250 mM NaCl, 250 mM imidazole, 0.0375% (v / v) β-mercaptoethanol). The collected target protein solution was concentrated to about 1 mL using an ultrafiltration tube with a 10 kDa molecular weight cut-off, and then replaced twice with C (50 mM Tris, 150 mM NaCl, 1 mM DTT) and finally concentrated to about 500 μL. The concentration of the obtained protein concentrate was determined using a Nanodrop, after which it could be used immediately or stored in a freezer at -80°C after quick freezing in liquid nitrogen.
[0098] Example 3 Activity assay of recombinant diaminopimelate dehydrogenase mutants
[0099] Activity assay reaction system 1 mL: 10 mM phenylglyoxalic acid, 0.2 mM NADPH, 10 μL of appropriately diluted pure enzyme solution, ammonium formate buffer (400 mM, pH 9.0). After thorough mixing, the change in absorbance of NADPH at 340 nm was measured at 60°C, and the detection time was 1 min. The enzyme activity was calculated, and each group had three replicates. The activity unit (U) of the enzyme was defined as the amount of enzyme that catalyzes the oxidation of 1 μmol of NADPH to NADP + The amount of enzyme required was 1 U.
[0100] Table 1 Diaminopimelate dehydrogenase mutants and their specific activities
[0101]
[0102]
[0103] Example 4 Fermentative preparation of recombinant diaminopimelate dehydrogenase mutants
[0104] The recombinant diaminopimelate dehydrogenase mutant BtDAPDH S98N / W129T / F154V / H235IThe recombinant expression transformant was inoculated into LB medium containing 50 μg / mL kanamycin and cultured at 37°C for 12 hours on a shaker as a seed liquid. The temperature and stirring speed of the fermenter were set to 37°C and 400 rpm, respectively, and the aeration rate was adjusted to 1 vvm (3 L / min). After the parameters of the fermenter were stabilized, 200 mL of the seed liquid was introduced into the fermenter containing 3 L of medium (glycerol 5 g / L, peptone 5 g / L, yeast extract 5 g / L, Na2HPO4 3 g / L, Na2SO4 0.7 g / L, KH2PO4 3.4 g / L, MgSO4 0.25 g / L, NH4Cl 2.7 g / L) under flame protection, and fermentation was started. As the cells grew, the dissolved oxygen (DO) decreased, and when the DO decreased to below 30%, the stirring speed was gradually increased to 500 rpm. Ammonia water was fed to control the pH at about 7.0 during fermentation. Samples were taken every 1 h after 2 h of fermentation, and the cell concentration (OD 600 ) in the fermentation broth was detected. After 4 h of culture, the carbon and nitrogen sources (250 g / L glycerol, 60 g / L peptone, 60 g / L yeast extract) were supplemented at a flow rate of 35 mL / h. At 5 h of culture, the temperature of the broth in the fermenter was adjusted to 25°C, and the feed rate was reduced to 27 mL / h. After 5.5 h of culture, IPTG aqueous solution (1 M stock solution, final concentration 0.2 mM) was added to induce the expression of the target protein. Samples were taken every 2 h after induction, and the OD 600 was detected. After 10 h of induction, the fermentation was ended. The fermentation broth was centrifuged to obtain 184 g of resting cells.
[0105] Example 5 Preparation of cell breakage liquid, freeze-dried cells and freeze-dried enzyme powder of the recombinant diaminopimelate dehydrogenase mutant
[0106] The 100 g of harvested recombinant cells in Example 4 were freeze-dried to obtain 22 g of freeze-dried cells containing the diaminopimelate dehydrogenase mutant. 50 g of harvested recombinant cells were suspended in 0.5 L of buffer, high-pressure homogenized, and the supernatant was collected by centrifugation to obtain the crude enzyme liquid of the recombinant diaminopimelate dehydrogenase mutant. The collected crude enzyme liquid was frozen at -80°C, and then dried at low temperature using a vacuum freeze dryer to obtain 9.6 g of freeze-dried enzyme powder of the recombinant diaminopimelate dehydrogenase mutant. The obtained freeze-dried enzyme powder was stored in a 4°C refrigerator and could be conveniently used.
[0107] Example 6 Synthesis of D-phenylglycine from benzoylformic acid catalyzed by BtDAPDH
[0108] Reference Figure 1 In a 1 mL reaction system, 10 mM of the substrate benzoylformic acid, 0.1 mM of NADP +0.5 mg of BtDAPDH pure enzyme, 10 mg of formate dehydrogenase, and ammonium formate buffer (400 mM, pH 9.0) were added. The reaction was carried out at 40 °C and 1000 rpm for 24 h. The reaction was then quenched by adding acetonitrile. The substrate conversion rate was 6% and the product ee value was 99% as determined by liquid chromatography.
[0109] Example 7 BtDAPDH W129T Catalytic synthesis of D-phenylglycine from benzoylcarboxylic acid
[0110] The 1 mL reaction system contained 20 mM benzoylformic acid and 0.1 mM NADP. + BtDAPDH W129T 0.5 mg of pure enzyme, 10 mg of formate dehydrogenase, ammonium formate buffer (400 mM, pH 9.0), were reacted in a constant temperature shaker at 40 °C and 1000 rpm for 24 h. The reaction was then quenched by adding acetonitrile. The substrate conversion rate was 82% and the product ee value was 99% as determined by liquid chromatography.
[0111] Example 8 BtDAPDH W129T / F154V Catalytic synthesis of D-phenylglycine from benzoylcarboxylic acid
[0112] The 1 mL reaction system contained 60 mM benzoylformic acid and 0.1 mM NADP. + BtDAPDH W129T / F154V 0.5 mg of pure enzyme, 1 mg of glucose dehydrogenase, 60 mM glucose, ammonium formate buffer (400 mM, pH 9.0) were added and reacted in a constant temperature shaker at 40℃ and 1000 rpm for 24 h. The reaction was then quenched by adding acetonitrile. The substrate conversion rate was 88% and the product ee value was 99% as determined by liquid chromatography.
[0113] Example 9 BtDAPDH W129T / F154V / T179V Catalytic synthesis of D-phenylglycine from benzoylcarboxylic acid
[0114] The 1 mL reaction system contained 100 mM benzoylformic acid and 0.1 mM NADP. + BtDAPDH W129T / F154V / T179V 0.5 mg of pure enzyme, 10 mg of formate dehydrogenase, ammonium formate buffer (400 mM, pH 9.0), were reacted in a constant temperature shaker at 40 °C and 1000 rpm for 24 h. The reaction was then quenched by adding acetonitrile. The substrate conversion rate was 80% and the product ee value was 99% as determined by liquid chromatography.
[0115] Example 10 BtDAPDH W129T / P134C / F154V / H235I Catalytic synthesis of D-phenylglycine from benzoylcarboxylic acid
[0116] Benzoyl formate 100 mM, 0.1 mM NADP + BtDAPDH W129T / P134C / F154V / H235I Pure enzyme 0.5 mg, formate dehydrogenase 10 mg, ammonium formate buffer (400 mM, pH 9.0), 40 °C, 1000 rpm constant temperature shaker for 24 h, then acetonitrile was added to quench the reaction, the substrate conversion rate was 90% and the product ee value was 99% by liquid chromatography.
[0117] Example 11 BtDAPDH W129T / P134C / F154V / S177G / H235I Catalyzing the synthesis of D-phenylglycine from benzoyl formate
[0118] Benzoyl formate 300 mM, 0.2 mM NADP + BtDAPDH W129T / P134C / F154V / S177G / H235I Crude enzyme 1 mg, formate dehydrogenase 48 mg, ammonium formate buffer (400 mM, pH 9.0), 50 °C, 1000 rpm constant temperature shaker for 24 h, then acetonitrile was added to quench the reaction, the substrate conversion rate was 82% and the product ee value was 99% by liquid chromatography.
[0119] Example 12 BtDAPDH W129T / P134C / F154V / S177P / H235I Catalyzing the synthesis of D-phenylglycine from benzoyl formate
[0120] Benzoyl formate 300 mM, 0.2 mM NADP + BtDAPDH W129T / P134C / F154V / S177P / H235I Crude enzyme 1 mg, formate dehydrogenase 48 mg, ammonium formate buffer (400 mM, pH 9.0), 50 °C, 1000 rpm constant temperature shaker for 24 h, then acetonitrile was added to quench the reaction, the substrate conversion rate was 82% and the product ee value was 99% by liquid chromatography.
[0121] Example 13 BtDAPDH W129T / P134C / F154V / S177A / H235I Catalyzing the synthesis of D-phenylglycine from benzoyl formate
[0122] Benzoyl formate 300 mM, 0.2 mM NADP + BtDAPDH W129T / P134C / F154V / S177A / H235I Crude enzyme 1 mg, formate dehydrogenase 48 mg, ammonium formate buffer (400 mM, pH 9.0), 50 °C, 1000 rpm constant temperature shaker for 24 h, then acetonitrile was added to quench the reaction, the substrate conversion rate was 82% and the product ee value was 99% by liquid chromatography.
[0123] Example 14 BtDAPDH W129T / P134C / F154V / H235I / V237LCatalytic benzoyl formic acid synthesis of D-phenylglycine
[0124] The reaction system of 100mL contains 100mM substrate benzoyl formic acid, 0.2mM NADP + BtDAPDH W129T / P134C / F154V / H235I / V237L The reaction was quenched by adding acetonitrile after 12h reaction in 100mg crude enzyme, 5g formate dehydrogenase, ammonium formate buffer (400mM, pH 9.0) at 30℃ in 1000rpm constant temperature shaker. The substrate conversion rate was 100% and the product ee value was 99% measured by liquid chromatography.
[0125] The above description of the embodiments is to facilitate the ordinary skilled in the art to understand and use the invention. Those skilled in the art can easily make various modifications to these embodiments, and apply the general principles described herein to other embodiments without creative labor. Therefore, the invention is not limited to the above embodiments, and the improvements and modifications made by those skilled in the art according to the disclosure of the invention without departing from the scope of the invention should be within the scope of protection of the invention.
[0126] The sequence information involved in the invention is as follows:
[0127] SEQ ID No. 1
[0128] ATGAGCGAAATCAGGACAGAACGACCCATCCGGGTAGCCATCATTGGTTACGGGAATATTGGCCAATATGCGTTGCAAGCTGTGGAAGAAGCTCCGGATATGGAGCTTGCGGGGGTGGTGCGGCGGCAAAGTTCACTGGAGAAGCCTTTGCCGCGTGAACTCCACGGCGTATCGGTGGTCTCAGACGTTTCTGCGCTGGGGCAAGTGGATGTGGCCGTCCTTTGCACGCCGACCCGCGAAACGCCGGCCATAGCCAAGGAACTGTTGGCTCGCGGCATCCACACGATCGACAGTTTTGACATCCATCAGGAAATTGTCCAGGTCCGGCATGAGCTGGATGAAGTGGCCAGGGCGCATCAGGCGGTGGCCATTTTGGCGGCAGGCCTGGATCCGGGGACCGACTCGATGATTCGGTCCATTCTGGAATTTATGGCACCGTATGGGATTACTTACACCAATTTTGGACCCGGGATGAGCATGGGGCATTCCGTGGCCGTGAAGGCGATTGAAGGGGTGAAAGATGCGCTGTCGCTGACCATCCCGATCGGCACGGGACTGCATCGCCGGATGGTTTATGTGGAACTGGAGGAAGGCGCCGATTTTGCGACGGTCAAGGAGCGCATTTTGCAGGATCCCTATTTTGTTCATGACGAAACCCATGTCCTGCAGGTAGACGATGTCAAACAGTTGATTGACCGGGGGATTGGCGTGCGCATGGAGAGAAAGGGCGTTTCCGGCCAAACCCAGAATCAGCTGTTCACCTATGAGATGCGGATTAACAATCCGGCGCTGACATCGCAGGTGATGATCGCGTCTGCGCGGGCGGCCATGCGGCAAAAACCGGGCGCCTACACGATGATCGAAATTCCGATCATTGATTTTCTGTACGGAGATCGGGACGAGCTGATTCGCCGTTTGGTATAA
[0129] SEQ ID No. 2
[0130] MSEIRTERPIRVAIIGYGNIGQYALQAVEEAPDMELAGVVRRQSSLEKPLPRELHGVSVVSDVSALGQVDVAVLCTPTRETPAIAKELLARGIHTIDSFDIHQEIVQVRHELDEVARAHQAVAILAAGWDPGTDSMIRSILEFMAPYGITYTNFGPGMSMGHSVAVKAIEGVKDALSLTIPIGTGLHRRMVYVELEEGADFATVKERILQDPYFVHDETHVLQVDDVKQLIDRGHGVRMERKGVSGQTQNQLFTYEMRINNPALTSQVMIASARAAMRQKPGAYTMIEIPIIDFLYGDRDELIRRLV
[0131] SEQ ID No. 3
[0132] AAGCTTGCATGAGCGAAATCAGGACAGAACGA
[0133] SEQ ID No. 4
[0134] CTCGAGTTATACCAAACGGCGAATCAGCTC
Claims
1. A diaminopimelic acid dehydrogenase mutant, characterized in that, It is a protein composed of any of the following amino acid sequences: (1) Replace tryptophan at position 129 of the amino acid sequence shown in SEQ ID No. 2 with threonine; (2) Replace tryptophan at position 129 of the amino acid sequence shown in SEQ ID No. 2 with threonine and phenylalanine at position 154 with valine; (3) Replace tryptophan at position 129 of the amino acid sequence shown in SEQ ID No. 2 with threonine, phenylalanine at position 154 with valine, and histidine at position 235 with isoleucine; (4) Replace tryptophan at position 129 of the amino acid sequence shown in SEQ ID No. 2 with threonine, phenylalanine at position 154 with valine, and threonine at position 179 with valine; (5) Replace the 98th serine in the amino acid sequence shown in SEQ ID No. 2 with isoleucine, the 129th tryptophan with threonine, the 154th phenylalanine with valine, and the 235th histidine with isoleucine. (6) Replace the 98th serine in the amino acid sequence shown in SEQ ID No. 2 with asparagine, the 129th tryptophan with threonine, the 154th phenylalanine with valine, and the 235th histidine with isoleucine. (7) Replace the 98th serine in the amino acid sequence shown in SEQ ID No. 2 with proline, the 129th tryptophan with threonine, the 154th phenylalanine with valine, and the 235th histidine with isoleucine. (8) Replace the 98th serine in the amino acid sequence shown in SEQ ID No. 2 with cysteine, the 129th tryptophan with threonine, the 154th phenylalanine with valine, and the 235th histidine with isoleucine. (9) Replace the 98th serine in the amino acid sequence shown in SEQ ID No. 2 with valine, the 129th tryptophan with threonine, the 154th phenylalanine with valine, and the 235th histidine with isoleucine. (10) Replace tryptophan at position 129 with threonine, aspartic acid at position 130 with serine, phenylalanine at position 154 with valine, and histidine at position 235 with isoleucine in the amino acid sequence shown in SEQ ID No.
2. (11) Replace tryptophan at position 129 with threonine, proline at position 134 with cysteine, phenylalanine at position 154 with valine, and histidine at position 235 with isoleucine in the amino acid sequence shown in SEQ ID No.
2. (12) Replace tryptophan at position 129 with threonine, proline at position 134 with isoleucine, phenylalanine at position 154 with valine, and histidine at position 235 with isoleucine in the amino acid sequence shown in SEQ ID No.
2. (13) Replace tryptophan at position 129 with threonine, proline at position 134 with methionine, phenylalanine at position 154 with valine, and histidine at position 235 with isoleucine in the amino acid sequence shown in SEQ ID No.
2. (14) Replace tryptophan at position 129 with threonine, proline at position 134 with leucine, phenylalanine at position 154 with valine, and histidine at position 235 with isoleucine in the amino acid sequence shown in SEQ ID No.
2. (15) Replace tryptophan at position 129 with threonine, proline at position 134 with serine, phenylalanine at position 154 with valine, and histidine at position 235 with isoleucine in the amino acid sequence shown in SEQ ID No.
2. (16) Replace tryptophan at position 129 with threonine, proline at position 134 with threonine, phenylalanine at position 154 with valine, and histidine at position 235 with isoleucine in the amino acid sequence shown in SEQ ID No.
2. (17) Replace tryptophan at position 129 with threonine, proline at position 134 with alanine, phenylalanine at position 154 with valine, and histidine at position 235 with isoleucine in the amino acid sequence shown in SEQ ID No.
2. (18) Replace tryptophan at position 129 of the amino acid sequence shown in SEQ ID No. 2 with threonine, phenylalanine at position 154 with valine, methionine at position 160 with leucine, and histidine at position 235 with isoleucine. (19) Replace tryptophan at position 129 with threonine, phenylalanine at position 154 with valine, serine at position 163 with threonine, and histidine at position 235 with isoleucine in the amino acid sequence shown in SEQ ID No.
2. (20) Replace isoleucine at position 101 with glutamine, tryptophan at position 129 with threonine, proline at position 134 with cysteine, phenylalanine at position 154 with valine, and histidine at position 235 with isoleucine. (21) Replace tryptophan at position 129 with threonine, proline at position 134 with cysteine, phenylalanine at position 154 with valine, valine at position 164 with arginine, and histidine at position 235 with isoleucine. (22) Replace tryptophan at position 129 with threonine, proline at position 134 with cysteine, phenylalanine at position 154 with valine, alanine at position 165 with valine, and histidine at position 235 with isoleucine. (23) Replace tryptophan at position 129 with threonine, proline at position 134 with cysteine, phenylalanine at position 154 with valine, serine at position 177 with glycine, and histidine at position 235 with isoleucine. (24) Replace tryptophan at position 129 with threonine, proline at position 134 with cysteine, phenylalanine at position 154 with valine, serine at position 177 with alanine, and histidine at position 235 with isoleucine. (25) Replace tryptophan at position 129 with threonine, proline at position 134 with cysteine, phenylalanine at position 154 with valine, serine at position 177 with proline, and histidine at position 235 with isoleucine. (26) Replace tryptophan at position 129 with threonine, proline at position 134 with cysteine, phenylalanine at position 154 with valine, arginine at position 233 with leucine, and histidine at position 235 with isoleucine. (27) Replace tryptophan at position 129 with threonine, proline at position 134 with cysteine, phenylalanine at position 154 with valine, histidine at position 235 with isoleucine, and valine at position 237 with leucine.
2. A nucleic acid, characterized in that, The code is for the diaminopimelic acid dehydrogenase mutant as described in claim 1.
3. A recombinant expression vector, characterized in that, It contains the nucleic acid as described in claim 2.
4. A recombinant expression transformant, characterized in that, It includes the recombinant expression vector as described in claim 3.
5. A recombinant diaminopimelic acid dehydrogenase mutant catalyst, characterized in that, It is any of the following forms: (1) Cultivate the recombinant expression transformant as described in claim 4, and isolate the transformant cells containing the diaminopimelic acid dehydrogenase mutant; (2) Cultivate the recombinant expression transformant as described in claim 4, isolate the transformant cells containing the diaminopimelic acid dehydrogenase mutant, and break the transformant cells containing the diaminopimelic acid dehydrogenase mutant to obtain the cell lysate; (3) Cultivate the recombinant expression transformant as described in claim 4, isolate the transformant cells containing the diaminopimelic acid dehydrogenase mutant, break the transformant cells containing the diaminopimelic acid dehydrogenase mutant, obtain the cell lysate, and freeze-dry the cell lysate of the diaminopimelic acid dehydrogenase mutant to obtain lyophilized enzyme powder.
6. The application of a catalyst based on the diaminopimelic acid dehydrogenase mutant as described in claim 1 or the recombinant diaminopimelic acid dehydrogenase mutant as described in claim 5 in the asymmetric reduction of benzoylformic acid to prepare D-phenylglycine.
7. The application as described in claim 6, characterized in that, The diaminopimelic acid dehydrogenase mutant of claim 1 or the recombinant diaminopimelic acid dehydrogenase mutant of claim 5 catalyzes the asymmetric reduction reaction of benzoylformic acid substrate, which requires the participation of coenzymes NADH or NADPH. During the reaction, coenzymes NADH or NADPH are oxidized to NAD. + or NADP + .
8. The application as described in claim 7, characterized in that, By coupling with the formic acid oxidation reaction catalyzed by formic acid dehydrogenase, and using ammonium formate as a co-substrate, in-situ regeneration of coenzymes NADH or NADPH can be achieved.
9. The application as described in claim 7, characterized in that, By coupling with glucose dehydrogenase-catalyzed glucose oxidation, in-situ regeneration of coenzymes NADH or NADPH is achieved using glucose as a cosubstrate.
10. The application as described in claim 7, characterized in that, In the aforementioned application, the concentration of benzoylformic acid substrate is 10–300 mM, and the NADP in the reaction solution is… + The dosage is 0.1~0.5 mM; the temperature for the asymmetric reduction reaction is 30~50°C.