A nitrile hydratase mutant and use thereof

By mutating the amino acid sequence of nitrile hydratase with M43L and K202D, the protein structure of nitrile hydratase was optimized, solving the problem of simultaneously improving enzyme activity and thermal stability. This resulted in a significant increase in enzyme activity and maintenance of thermal stability, making it suitable for industrial nitrile hydration reactions.

CN122128287APending Publication Date: 2026-06-02SHIJIAZHUANG CHUANGZU BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-27
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Existing nitrile hydratases face the challenge of simultaneously optimizing enzyme activity and thermal stability in industrial applications. Current optimization methods often compromise one aspect for the other, leading to decreased enzyme activity or insufficient structural stability.

Method used

By mutating the amino acid sequence of nitrile hydratase derived from *Cyclocarya manganosa*, particularly by mutating the M43 site of the α subunit to leucine and the K202 site to aspartic acid, combined with the construction of genetically engineered bacteria and recombinant expression vectors, the protein structure was optimized, enzyme activity was improved, and thermostability was maintained.

Benefits of technology

It achieved a maximum 6.74-fold increase in nitrile hydratase activity, and its stability did not decrease significantly within two hours at 50°C, making it suitable for industrial applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention belongs to the field of enzyme engineering technology, specifically providing a nitrile hydratase mutant and its application. The nitrile hydratase mutant is derived from *Aurantimonas manganoxydans*. Am NHase)SI859A was modified using rational design methods based on its three-dimensional protein structure. The resulting nitrile hydratase mutant ultimately achieved an enzyme activity that was up to 6.74 times higher than that of the wild enzyme, and its stability did not decrease significantly within two hours under heating conditions at 50°C.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of enzyme engineering technology, specifically relating to a nitrile hydratase mutant and its applications. Background Technology

[0002] Nicotinamide (also known as nicotinamide or nicotinic acid amide) is an amide compound of nicotinic acid, a naturally occurring water-soluble vitamin found in food. It can be used as a dietary supplement and in pharmaceuticals, and has been widely applied in food fortification and medical treatment. The synthesis of nicotinamide is mainly divided into two categories: chemical methods and biotransformation methods. Compared with chemical methods, biotransformation methods have significant advantages such as mild reaction conditions, environmental friendliness, and high regioselectivity and enantioselectivity, making it an important direction for future green chemistry development. The core of this method relies on the catalytic action of nitrile hydratase (EC 4.2.1.84) to specifically convert the substrate 3-cyanopyridine into nicotinamide. Essentially, it catalyzes the hydrolysis of the cyano group (-CN) of nitrile compounds to generate the corresponding amide group (-CONH2). This enzyme is therefore widely used in the green synthesis processes of various amide compounds.

[0003] Nitrile hydratase is a multi-subunit enzyme protein containing α, β, and γ subunits as activating elements. The α and β subunits are mainly involved in the catalytic process, while the γ subunit activating element is an activating protein that plays a role in the expression and assembly of nitrile hydratase, ensuring its correct expression and thus obtaining highly active nitrile hydratase.

[0004] Currently, this type of nitrile hydratase has been successfully heterologously expressed in *Escherichia coli* (E. coli), significantly reducing production costs in industrial applications and laying the foundation for its large-scale promotion. However, as a biomacromolecule catalyst, the industrial application of nitrile hydratase still faces many limitations. The most significant of these is the inability to simultaneously achieve enzyme activity and thermal stability. Enzyme activity depends on the conformational flexibility of the catalytic center, while thermal stability requires a rigid overall enzyme molecule structure. Existing optimization methods often compromise one aspect for the other: enhancing thermal stability through site-directed mutagenesis or chemical modification restricts dynamic conformational changes in the catalytic center, leading to a decrease in enzyme activity; conversely, improving enzyme activity through directed evolution weakens the structural stability of the enzyme molecule, making it susceptible to inactivation under temperature fluctuations.

[0005] Therefore, developing a nitrile hydratase with simultaneously optimized enzyme activity and thermal stability has significant industrial value. Summary of the Invention

[0006] To achieve the above objectives, the present invention adopts the following technical solution: The first objective of this invention is to provide a nitrile hydratase mutant, which is composed of an α subunit, a β subunit, and a regulatory protein; the amino acid sequence of the β subunit of the nitrile hydratase mutant is shown in SEQ ID NO.4; the amino acid sequence of the regulatory protein of the nitrile hydratase mutant is shown in SEQ ID NO.5; the amino acid sequence of the α subunit of the nitrile hydratase mutant is any one of the following (1) to (3): (1) The methionine at position 43 of the α subunit of the nitrile hydratase, whose amino acid sequence is shown in SEQ ID NO.6, is mutated to leucine (the mutated sequence is shown in SEQ ID NO.1); (2) The 202nd lysine of the α subunit of the nitrile hydratase, whose amino acid sequence is shown in SEQ ID NO.6, is mutated to aspartic acid (the mutated sequence is shown in SEQ ID NO.2); (3) The methionine at position 43 of the α subunit of the nitrile hydratase, whose amino acid sequence is as shown in SEQ ID NO.6, is mutated to leucine, and the lysine at position 202 of the α subunit of the nitrile hydratase, whose amino acid sequence is as shown in SEQ ID NO.6, is mutated to aspartic acid (the mutated sequence is shown in SEQ ID NO.3).

[0007] A second objective of this invention is to provide a gene encoding the aforementioned nitrile hydratase mutant.

[0008] A third objective of this invention is to provide a recombinant expression vector containing the said gene.

[0009] A fourth objective of the present invention is to provide a genetically engineered bacterium that contains the aforementioned gene or the aforementioned recombinant expression vector.

[0010] A fifth object of the present invention is to provide an enzyme preparation comprising the above-mentioned nitrile hydratase mutant.

[0011] A sixth object of the present invention is to provide the use of the above-mentioned nitrile hydratase mutant, or the genetically engineered bacteria, or the enzyme preparation thereof in catalyzing the production of nicotinamide from 3-cyanopyridine.

[0012] The beneficial effects of this invention are as follows: This invention is based on *Manganese Oxidase Orange* (a type of *Bacillus manganese*). Aurantimonas manganoxydans,Am The wild-type nitrile hydratase (NHase)SI859A was modified using rational design methods based on its three-dimensional protein structure. The resulting nitrile hydratase mutant ultimately achieved an enzyme activity that was up to 6.74 times higher than that of the wild-type enzyme, and its stability did not decrease significantly within two hours under heating conditions at 50°C. Attached Figure Description

[0013] Figure 1Example 2: Nitrile Hydrate Enzyme Am Schematic diagram of NHase position specificity matrix.

[0014] Figure 2 Example 2: Nitrile Hydrate Enzyme Am 3D molecular docking plot of NHase Alphafold3 prediction results.

[0015] Figure 3 This is a relative enzyme activity map of each mutation point in alanine scanning, as shown in Example 3.

[0016] Figure 4 Nitrile hydratase Am NHase and double mutant Am Root mean square fluctuation plot of the entire NHase-M43L / K202D sequence.

[0017] Figure 5 The results are the tolerance test results of the product in Example 7. Detailed Implementation

[0018] To make the objectives and technical solutions of this invention clearer, preferred embodiments of this invention are described in detail below. It should be noted that the following embodiments are only used to further illustrate this invention and should not be construed as limiting the scope of protection of this invention. Any non-essential improvements and adjustments made by those skilled in the art based on the above description of this invention are within the scope of protection of this invention.

[0019] This invention uses *Ostomium manganese oxidizing* SI859A ( Aurantimonas manganoxydans Nitrile hydratase (SI859A) Am NHase was obtained through Blast comparison and screening, and then handed over to a gene synthesis company for codon optimization and gene synthesis.

[0020] The activity of nitrile hydratase was determined using a standard reaction system of 500 μL, which included 100 mM 3-cyanopyridine, an appropriate amount of enzyme solution, and 50 mM Tris-HCl buffer (pH 8.0). The reaction was carried out at 25°C for 2 min, and then 500 μL of pure acetonitrile was added immediately to terminate the reaction. The mixture was centrifuged at 10,000 rpm for 1 min, and the supernatant was filtered and the amount of nicotinamide produced was determined by high performance liquid chromatography.

[0021] The preparation of 50 mM Tris-HCl buffer (pH 8.0) is as follows: Weigh 6.06 g of tris(hydroxymethyl)aminomethane (Tris) and dissolve it in 800 mL of deionized water. Adjust the pH to 8.0 using 1 M hydrochloric acid and bring the volume to 1000 mL.

[0022] Preparation of 1 M 3-cyanopyridine: Weigh 10.411 g of 3-cyanopyridine and dissolve it in 50 mM 100 mL Tris-HCl buffer at pH 8.0 to prepare a 10-fold stock solution.

[0023] The enzyme activity unit (U) of nitrile hydratase is defined as the amount of enzyme required to catalyze the production of 1 μmol of nicotinamide per minute at 25°C.

[0024] Nitrile hydratase specific enzyme activity (U / mg): The enzyme activity per milligram of nitrile hydratase.

[0025] Example 1 Am Preparation of crude NHase enzyme products To construct a basic system for subsequent enzyme molecule modification and activity verification, enzymes derived from *Cyclocarya manganeseosa* SI859A were studied. Aurantimonas manganoxydans Nitrile hydratase (SI859A) Am Heterologous expression and crude enzyme preparation of NHase: First of all Am NHase gene sequence was directionally cloned into the pET-28a expression vector. Nde I and Hind III A recombinant expression vector was constructed between the restriction enzyme sites. This recombinant vector was transformed into *E. coli* BL21 (DE3) competent cells. The transformed bacterial culture was evenly spread on LB agar plates containing a final concentration of 50 mg / L kanamycin and incubated at 37°C for 12 h for resistance screening. Single-positive clones were picked from the plates and transferred to fresh LB liquid shake flasks, which were then incubated at 220 rpm and 37°C with shaking until the OD600 value reached 0.6-1.0. Isopropyl-β-D-thiogalactopyranoside (IPTG) was added to the bacterial culture to a final concentration of 0.2 mM, and the shaker temperature was adjusted to 25°C. Expression was induced for 16 h with shaking at 220 rpm. After induction, the bacterial culture was rotated at 8000 r·min⁻¹. -1 Centrifuge at a certain speed to collect the wet bacterial cells, which will be used for subsequent reactions. Am NHase crude enzyme product.

[0026] Example 2 is based on Am Semi-rational design of NHase (screening candidate mutation sites) To achieve Am NHase activity optimization involves a semi-rational design based on its sequence characteristics and spatial structure to screen for potential mutation targets: First, ... AmThe amino acid sequence of NHase was submitted to the local server, and BLAST alignment was performed using the Uniref90 protein database as a reference. Sequences with large gaps in the alignment results were trimmed and screened to obtain high-quality multiple sequence alignment files. A position-specific matrix was constructed based on these files. Figure 1 The evolutionarily conserved sites containing catalytic triplets are eliminated by pre-defined criteria, and the remaining sites are used as initial candidate mutation sites.

[0027] Using the Alphafold3 tool, input wild-type nitrile hydratase. Am NHase amino acid sequence and the chemical SMILES number of the substrate 3-cyanopyridine were used to perform three-dimensional structural modeling and molecular docking of the protein-substrate complex. Figure 2 The analysis and visualization of the output results were performed to screen out amino acid sites within an 8-angstrom space around the substrate molecule.

[0028] The amino acid sites within an 8-angstrom spatial range surrounding the substrate molecule were screened based on sequence conservation, and highly conserved amino acid sites were removed. The remaining amino acid sites were then scanned for alanine. Subsequently, site-directed saturation mutagenesis was performed on amino acid sites that enhanced enzyme activity based on alanine scanning. Simultaneously, the sequences were submitted to EVcouplings (https: / / v2.evcouplings.org / ) to identify co-evolutionary sites. The site K202, with the highest independent epistasis score, was selected as one of the candidate sites for subsequent saturation mutagenesis, providing a basis for predicting mutations using epistasis models.

[0029] Example 3 Am NHase A mutation scan Based on the mutation sites screened in Example 2, the effect of the mutation sites on enzyme activity was further verified by alanine scanning, and effective mutation targets were screened: With wild-type nitrile hydratase AmUsing the pET-28a recombinant plasmid of the NHase gene as a template, forward and reverse primers containing alanine codons to replace the original codons were designed for candidate sites (D25, E35, M43, T58, N64, S92, W135, L148, R167, P181, R201, G206, H214, E218). (Taking the D25A mutation as an example, forward primer: D25A-F: CACGACAACCATCTCGCACCGATGACCGCG, reverse primer: D25A-R: GAGATGGTTGTCGTGATCACGGTCGTGGTG). PCR amplification of the introduced mutation was performed using the high-fidelity DNA polymerase PrimeSTAR Max (TaKaRa Bio). The PCR reaction mixture consisted of: a total volume of 20 μL, 1 μL of forward / reverse primers, 1 μL of template plasmid, 7 μL of ddH2O, and 10 μL of 2×PrimeSTAR Max. PCR reaction program: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 60℃ annealing for 5 s, 72℃ extension for 30 s, 30 cycles; final extension at 72℃ for 2 min. The PCR products were then... DpnⅠ The enzyme was treated at 37°C for 1 h to remove the template plasmid, then transformed into *E. coli* BL21 (DE3) competent cells, plated on LB agar plates containing 50 mg / L kanamycin, and incubated at 37°C for 12 h. Transformants were picked and sequenced for verification. Single colonies of mutants with correct sequences were selected and induced for expression according to the method in Example 1. Activity was tested according to the corresponding activity detection method, with three parallel experiments for each mutant, and the average value was taken. Site-directed saturation mutagenesis was performed on the sites that enhanced enzyme activity, and after screening in deep-well plates, the enzyme was verified again in shake flasks to measure the wild-type and mutant activities. The wild-type nitrile hydratase was also tested. Am NHase (WT) activity was used as 1 to calculate the relative activity of each mutant. Results are as follows: Figure 3 As shown, only D25, M43, R201, G206, and H214 retained more than 80% of their activity after being mutated to alanine. Therefore, these sites were selected as candidate sites for subsequent saturation mutations.

[0030] Example 4 Construction and screening of mutants Based on the candidate sites identified in Examples 2 and 3, a mutant library was constructed through saturation mutation and highly active mutants were screened: For D25, M43, R201, G206, H214, and K202, the original codons were replaced with the degenerate codon NNK, and forward and reverse primers were designed respectively (taking the K202 saturation mutation as an example, forward primer: 202-F: GGCTCGTCACCCGCNNKTCCATGATCGGT, reverse primer: 202-R: GGCGGTGACGAGCGCCGCCAGCGCCGCCTC); recombinant expression vectors were constructed according to the PCR method in Example 3, and the PCR products were subjected to... DpnⅠ After enzyme treatment at 37°C for 1 h, the cells were transformed into *E. coli* BL21 (DE3) competent cells, plated on LB agar plates containing 50 mg / L kanamycin, and incubated at 37°C for 12 h to obtain six independent saturated mutant libraries. Single colonies (90 colonies per library) were picked from each mutant library and cultured at 6 different temperatures. Am Single colonies of NHase were used as controls and cultured overnight at 37°C and 220 rpm. A 10% inoculum was then transferred from the overnight culture to 1 mL of liquid LB medium containing 50 mg / L kanamycin in 96-well plates with shaking at 37°C and 220 rpm until the OD reached approximately 0.6-0.8. IPTG was then added to a final concentration of 0.2 mM, and expression was carried out at 25°C for 16 h. The bacterial cells from the 96-well plates were collected by centrifugation at 4500 rpm for 20 min as crude enzyme. Enzyme activity in each well was measured according to the corresponding activity assay method. Cells with higher activity than [previous enzyme] were screened. Am The mutants of NHase were sequenced for verification. Subsequently, the candidate mutants were repeatedly induced for expression and enzyme activity was measured in shake flasks, using wild-type nitrile hydratase. Am The relative activity was calculated by setting the enzyme activity of NHase to 1, and finally a high-activity mutant was obtained.

[0031] The activity obtained through final screening was significantly higher than Am The mutants of NHase were K202D and M43L, which were expressed by shake-flask fermentation. The activities were then tested, with three replicates for each mutant. The activity test results are shown in Table 1. The single-point mutants M43L and K202D showed activities compared to the original nitrile hydratase. Am NHase (WT) increased by 1.34 and 1.99 times, respectively.

[0032] Table 1 Activity of single-point mutants

[0033] Example 5 Construction of combined mutants

[0034] The single-point mutant M43L plasmid was extracted using the Tiangen plasmid miniprep kit and used as a template. K202D-F: GGCTCGTCACCCGCGATTCCATGATCGGT and K202D-R: GCGGGTGACGAGCGCCGCCAGCGCCGCCTCGG were used as primers, and the mutant was obtained by mutation according to the method in Example 4. Am NHase-M43L / K202D. Enzyme activity was measured after successful sequencing, with each experiment repeated three times.

[0035] Combined mutants Am The activity assay results of NHase-M43L / K202D are shown in Table 2, indicating that its specific activity is 6.74 times that of the WT. This is because nitrile hydratase... Am The M43 site of NHase is far from the active pocket, and the surrounding secondary structure is an alpha helix. Other alpha helices are close to the N-terminus. Mutating methionine to leucine helps stabilize the surrounding secondary structure. The 202 site is located at the C-terminus, and the surrounding area consists mostly of loop-variable beta turns and short alpha helices. Mutating the uncharged serine to the negatively charged aspartic acid can help stabilize the protein in the catalytic state and also assist the operation of the charge transport network near the catalytic pocket.

[0036] Table 2 Activity of Combined Mutants

[0037] Example 6: Assessment of the thermal stability of the mutant

[0038] Considering that the nitrile hydration reaction releases a large amount of heat in industrial applications, the enzyme needs to have a certain degree of heat resistance. This embodiment further addresses this issue. Am NHase (WT) and its mutants Am NHase-M43L, Am NHase-K202D, Am Thermoresistance experiments and molecular dynamics simulations were conducted on NHase-M43L / K202D to systematically evaluate its thermal stability and structural differences. 1. Heat resistance test determination Take the sample prepared in Example 1 Am NHase crude enzyme product and those obtained by the same expression and purification method Am NHase-M43L, Am NHase-K202D, AThe crude enzyme product mNHase-M43L / K202D was incubated at a constant temperature of 50℃. Samples were taken at 0h, 1h, and 2h of incubation, and the residual enzyme activity was determined according to the aforementioned enzyme activity detection method. The residual activity and half-life at different incubation time points were calculated with the enzyme activity at 0h of each sample as 100%, and the difference in thermostability between wild type and mutant was compared.

[0039] The stability test results are shown in Table 3. As can be seen from Table 3, Am NHase-M43L, Am NHase-K202D, A mNHase-M43L / K202D showed enzyme activity at both 1 h and 2 h that was significantly higher than that of other enzymes. Am High NHase levels indicate Am NHase mutant Am NHase-M43L, Am NHase-K202D, A mNHase-M43L / K202D maintains high enzyme activity without decreasing thermal stability, making it suitable for industrial applications.

[0040] Table 3. Determination of residual enzyme activity and half-life

[0041] 2. Molecular dynamics simulation analysis With mutants A Taking mNHase-M43L / K202D as an example, Gromacs 2024.5 software was used to perform molecular dynamics simulations to evaluate the structural changes of wild-type nitrile hydratase and nitrile hydratase mutants. The specific parameters and procedures are as follows: Force field and parameter settings: The enzyme molecule uses the amber14sb_parmbsc1 force field, and the substrate 3-cyanopyridine uses the general Amber gaff force field; the relevant parameters of 3-cyanopyridine are generated using Ambertools22 and acpype tools.

[0042] System construction: Sodium and chloride ions were added to neutralize the system charge. The system was dissolved using TIP3P water molecules. A rectangular simulation box was used to ensure that the minimum distance between the protein and the edge of the simulation box was 0.1 nm, and periodic boundary conditions were applied.

[0043] Energy minimization and equilibrium process: The steepest gradient method is used to perform an energy minimization cycle on the molecular system; in the NVT ensemble, the system is heated to 303.15 K within 100 ps; then, equilibrium is carried out in the NPT ensemble (303.15 K, 1.0 bar) for 100 ps, ​​during which constant pressure and temperature are maintained (coupled for 2 ps) by the Berendsen algorithm, and the protein backbone atoms are initially confined to their initial positions.

[0044] Long-range interactions and constraints: The particle-mesh Ewald (PME) method was used to handle long-range electrostatic interactions, with a cutoff radius of 1.2 nm; the bond lengths of hydrogen atoms involved were constrained to their equilibrium values ​​using the Lincs algorithm.

[0045] Production simulation: 100 ns production simulation was performed in the NPT ensemble. The integration time step for each simulation was 2 fs. The Leap-Frog integrator was used, and the atomic coordinates were saved every 10 ps.

[0046] Data analysis: Using Gromacs' built-in analysis tools, the simulation results were calculated and analyzed for parameters such as Root Mean Square Fluctuation (RMSF) to assess the structural stability differences between wild-type and mutant strains.

[0047] like Figure 4 As shown, based on RMSF inferences, apart from the N-terminus, C-terminus, and wild type being similar, Am The overall full-sequence protein variability of NHase-M43L / K202D is less than that of the wild type, which indirectly proves that its thermal stability is higher than that of the wild type.

[0048] Example 7 Product Tolerance Collected Am The crude enzyme solution of NHase-M43L / K202D was resuspended in 2M 3-cyanopyridine solution and soaked in a water bath at 25°C for 30 min. After the reaction, the residual enzyme activity was determined using an enzyme activity detection system. The enzyme treated with only buffer was used as a control, and the enzyme activity was defined as 100%.

[0049] The results are as follows Figure 5 As shown, Am After immersion in 2M 3-cyanopyridine solution for 30 min, the residual enzyme activity of NHase was 48.3%. Am The NHase-M43L / K202D mutant maintained an enzyme activity of 73.1% after immersion in 2M 3-cyanopyridine solution for 30 min. This demonstrates that the mutant not only improved enzyme activity and thermostability but also enhanced tolerance to high concentrations of 3-cyanopyridine.

[0050] Example 8: Application in Nicotinamide Production Take 100 ml of the genetically engineered E. coli BL21(DE3) from Example 1. Am The crude enzyme solution after NHase double mutant induction culture was used. 3-Cyanopyridine to a final concentration of 1.5 M was added to the crude enzyme solution, and the reaction was carried out at 25 °C for 30 min. The contents of 3-cyanopyridine and nicotinamide in the reaction system were detected by HPLC. The results showed that there was no residual 3-cyanopyridine in the reaction system, its conversion rate was 100%, and the yield of nicotinamide was >99%.

Claims

1. A nitrile hydratase mutant, composed of an α subunit, a β subunit, and a regulatory protein, characterized in that, The amino acid sequence of the β subunit of the nitrile hydratase mutant is shown in SEQ ID NO.4; the amino acid sequence of the nitrile hydratase mutant regulatory protein is shown in SEQ ID NO.5; the α subunit of the nitrile hydratase mutant is any one of the following (1) to (3): (1) Mutate the methionine at position 43 of the α subunit of the nitrile hydratase, whose amino acid sequence is shown in SEQ ID NO.6, to leucine; (2) The lysine at position 202 of the α subunit of the nitrile hydratase, whose amino acid sequence is shown in SEQ ID NO.6, is mutated to aspartic acid; (3) The methionine at position 43 of the α subunit of the nitrile hydratase, whose amino acid sequence is as shown in SEQ ID NO.6, is mutated to leucine, and the lysine at position 202 of the α subunit of the nitrile hydratase, whose amino acid sequence is as shown in SEQ ID NO.6, is mutated to aspartic acid.

2. The gene encoding the nitrile hydratase mutant as described in claim 1.

3. A recombinant expression vector containing the gene of claim 2.

4. A genetically engineered bacterium, characterized in that, The genetically engineered bacteria contain the gene as described in claim 2, or contain the recombinant expression vector as described in claim 3.

5. An enzyme preparation, characterized in that, Including the nitrile hydratase mutant as described in claim 1.

6. The use of the nitrile hydratase mutant as described in claim 1, or the genetically engineered bacteria as described in claim 4, or the enzyme preparation as described in claim 5 in catalyzing the production of nicotinamide from 3-cyanopyridine.