Site-directed mutant sucrose phosphorylase and use thereof

By site-directed mutagenesis of sucrose phosphorylase, particularly by replacing amino acids at positions 141 and/or 197 with cysteine, catalytic efficiency was improved, solving the problem of low yield in existing technologies and achieving efficient production of L-ascorbic acid glucoside.

CN116731997BActive Publication Date: 2026-05-15JINAN UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310726638.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-06-19
Publication Date
2026-05-15
Estimated Expiration
2043-06-19

AI Technical Summary

Technical Problem

The low catalytic efficiency of existing sucrose phosphorylases results in low yields of L-ascorbic acid glucoside, limiting its application in cosmetics and food.

Method used

The catalytic efficiency of sucrose phosphorylase was improved by site-directed mutagenesis of the amino acid sequence, particularly by replacing amino acids at positions 141 and/or 197 with cysteine.

Benefits of technology

This improved the yield of L-ascorbic acid glucoside, reduced production costs, and broadened its prospects for industrial application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116731997B_ABST
    Figure CN116731997B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of genetic engineering and protein engineering, and relates to a site-directed mutant sucrose phosphorylase and application thereof. The site-directed mutant sucrose phosphorylase is obtained by making a point mutation in sucrose phosphorylase (BiSPase) with an amino acid sequence shown as SEQ ID NO. 1, and the mutation site of the point mutation is selected from the 141th and / or 197th. Preferably, the point mutation of the 141th is threonine mutated into cysteine; and the point mutation of the 197th is glycine mutated into cysteine. The catalytic efficiency of the sucrose phosphorylase variant enzyme provided by the present application is obviously improved, so that the yield of L-ascorbyl glucoside can be improved, the production cost is reduced, the problems of low receptor specificity and low enzyme activity of sucrose phosphorylase in the prior art are solved, and the sucrose phosphorylase has a wide industrial application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and protein engineering technology, and relates to a site-directed mutagenesis sucrose phosphorylase and its applications. Background Technology

[0002] L-ascorbic acid (LAA), also known as vitamin C, is an essential vitamin and natural antioxidant that plays a vital role in maintaining human health. However, LAA's high antioxidant activity limits its important applications, such as in cosmetics and food, where a sustained effect is required. 2-O-alpha-D-glucopyranosyl-L-ascorbic acid (AA-2G) offers a practical compromise between stability and human bioavailability because it can be slowly hydrolyzed by α-glucosidases, which are widely present in epithelial tissues, releasing LAA to exert its physiological effects. AA-2G is already an industrially produced fine chemical with established uses in skincare cosmetics; another important use is as an LAA supplement in pharmaceuticals and food.

[0003] Sucrose phosphorylase (EC 2.4.1.7, SPase) is a member of subfamily 18 of the GH13 (GH13_18) glycoside hydrolysis family. It catalyzes the reversible phosphorylation of sucrose to α-D-glucose-1-phosphate and fructose. SPase is also a recognized transglycosidase, widely used in the synthesis of various glycosides. One important application is its efficient one-step catalytic conversion of LAA to AA2G using sucrose as a glycosyl donor. Although SPase shows promising industrial applications, its yield is low. Therefore, genetic modification of natural SPase is necessary to improve its catalytic efficiency. Summary of the Invention

[0004] The purpose of this invention is to provide a site-directed mutagenesis sucrose phosphorylase. The provided variant enzyme has significantly improved catalytic efficiency, thereby increasing the yield of L-ascorbic acid glucoside, reducing production costs, and solving the problems of low receptor specificity and low enzyme activity in existing sucrose phosphorylases. It has broad prospects for industrial application.

[0005] The site-directed mutagenesis sucrose phosphorylase of the present invention is obtained by creating a point mutation in sucrose phosphorylase (BiSPase) with an amino acid sequence as shown in SEQ ID NO.1, wherein the mutation site of the point mutation is selected from position 141 and / or position 197.

[0006] Preferably, the point mutation at position 141 is a threonine mutation to a cysteine ​​mutation.

[0007] Preferably, the point mutation at position 197 is a mutation of glycine to cysteine.

[0008] A second object of the present invention is to provide a DNA molecule that encodes the site-directed mutagenesis sucrose phosphorylase described in this invention.

[0009] According to a further feature of the DNA molecule of the present invention, the amino acid sequence of the DNA-encoded sucrose phosphorylase is selected from the amino acid sequences shown in SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4.

[0010] Specifically, in SEQ ID NO.2, the threonine at position 141 is mutated to cysteine. In SEQ ID NO.3, the glycine at position 197 is mutated to cysteine. In SEQ ID NO.4, both the threonine at position 141 and the glycine at position 197 are mutated to cysteine.

[0011] A third object of the present invention is to provide a carrier containing the DNA molecule described herein.

[0012] A fourth object of the present invention is to provide a host cell containing the DNA molecule described in the present invention, or containing the vector described in the present invention.

[0013] The fifth objective of this invention is to provide a method for producing the site-directed mutagenesis sucrose phosphorylase described in this invention.

[0014] The production method of the present invention includes: culturing the host cells of the present invention under conditions suitable for sucrose phosphorylase expression, and isolating the sucrose phosphorylase from the culture medium.

[0015] The sixth object of this invention is to provide the application of the site-directed mutagenesis sucrose phosphorylase described herein in the preparation of L-ascorbic acid glucoside.

[0016] The sucrose phosphorylase mutant described in this application was obtained by site-directed mutagenesis based on sucrose phosphorylase derived from Bifidobacterium longum. This improved the enzyme activity of sucrose phosphorylase, which is conducive to expanding the application prospects of sucrose phosphorylase in glycoside conversion in industrial applications and realizing large-scale industrial applications. Attached Figure Description

[0017] Figure 1 This is an SDS-PAGE image of BiSPase sucrase and its mutants after induction, expression, isolation, and purification.

[0018] Figure 2 BiSPase T141C / G197C LC-MS chromatogram of the catalyst solution at 24h. Detailed Implementation

[0019] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto.

[0020] Unless otherwise stated, the terms used herein have the meanings commonly understood by those skilled in the art. Definitions of some specific terms used in this invention are provided below.

[0021] “wtBiSPase” represents wild-type sucrose phosphorylase, and its gene is represented by italicized wtBiSPase.

[0022] BiSPase T141C / G197C "Indicates mutant sucrose phosphorylase BiSPase" T141C / G197C Its genes are BiSPase T141C / G197C express.

[0023] BiSPase T141C "Indicates mutant sucrose phosphorylase BiSPase" T141C Its genes are BiSPase T141C express.

[0024] BiSPase G197C "Indicates mutant sucrose phosphorylase BiSPase" G197C Its genes are BiSPase G197C express.

[0025] A site-directed mutagenesis sucrose phosphorylase, wherein the mutant is a single-point mutation or a combination of two-point mutations at the following two sites based on the BiSPase amino acid sequence SEQ ID NO.1: threonine at position 141 (T141) and glycine at position 197 (G197); these mutations can enhance the enzyme's catalytic activity for L-ascorbic acid glycosylation, improve the reaction rate and substrate conversion, and effectively increase the content of the product AA-2G.

[0026] This invention includes the following mutants:

[0027] Mutant 1: The threonine at position 141 of the amino acid sequence shown in SEQ ID NO.1 in the sequence listing is replaced with cysteine, i.e., mutant BiSPase. G197C ;

[0028] Mutant 2: The glycine at position 197 of the amino acid sequence shown in SEQ ID NO.1 in the sequence listing is replaced with cysteine, i.e., mutant BiSPase.T141C ;

[0029] Mutant 3: The amino acid sequence shown in SEQ ID NO.1 is modified by replacing glycine at position 197 with cysteine ​​and threonine at position 141 with cysteine, resulting in mutant BiSPase. T141C / G197C .

[0030] Any mutant amino acid sequence in which one or more amino acids are deleted, inserted, or replaced, and which has L-ascorbic acid transglycosylation activity, is still within the scope of protection of this invention.

[0031] The present invention discloses a method for preparing a recombinant sucrose phosphorylase mutant, comprising the following steps: culturing the recombinant expression transformant of the present invention, and inducing the production of the recombinant sucrose phosphorylase mutant protein. The culture medium used for culturing the recombinant expression transformant can be any culture medium in the art capable of growing the transformant and producing the sucrose phosphorylase mutant protein of the present invention, such as LB medium: yeast extract 5 g·L⁻¹. -1 Bacterial peptone 10 g·L -1 10 g·L of sodium chloride -1 There are no special restrictions on the culture methods and conditions, as long as the transformants can grow and produce sucrose phosphorylase mutant protein.

[0032] The preferred method is as follows: The recombinant Escherichia coli of this invention is inoculated into LB medium containing 50-100 mg / L kanamycin, and the culture density is OD... 600nm When the concentration is 0.5 to 0.8, adding isopropyl βD-thiopyranoside (IPTG) to a final concentration of 0.25 to 0.5 mM can induce efficient expression of the recombinant sucrose phosphorylase mutant protein of the present invention.

[0033] The preparation method of the catalyst for the catalytic production of L-ascorbic acid glucoside is as follows:

[0034] Seed activation: Recombinant Escherichia coli containing the BiSPase mutant gene encoding sucrose phosphorylase were spread on LB solid medium containing 50-100 mg / L kanamycin and incubated at 37°C for 12-20 h to obtain single colonies; the LB solid medium was LB medium with 1.5-2.0% agar added.

[0035] Seed culture: Single colonies from LB solid medium are inoculated into LB medium containing 50-100 mg / L kanamycin and cultured at 37°C for 8-16 hours to obtain seed culture.

[0036] Induction of expression: Seed culture was inoculated at a volume concentration of 1-2% into a 250 mL shake flask containing 50 mL of LB medium with a final concentration of 50-100 mg / L kanamycin. The culture was incubated at 37°C and shaken at 200 rpm until OD600nm = 0.5-0.8. IPTG was then added to a final concentration of 0.25-0.5 mM, and the culture was induced at 24-26°C and shaken at 200 rpm for 6-24 h.

[0037] Application of the present invention: Sucrose phosphorylase mutants or their genetically engineered bacteria can catalyze the synthesis of AA-2G in the form of free enzymes, immobilized enzymes, and recombinant vigorous cells.

[0038] Example 1: Construction of E. coli expressing wtBiSPase recombinant protein

[0039] The sucrose phosphorylase gene wtBiSPase, derived from *Bifidobacterium longum*, has the amino acid sequence shown in SEQ ID NO. 1. In this invention, BamHI and EcoRI restriction endonuclease sites were added to the 5′ and 3′ ends of the gene, respectively. The target gene sequence was codon-optimized, and pET28a(+) was selected as the expression vector to obtain the recombinant vector pET28a(+)-BiSP. This recombinant vector was synthesized by Shanghai Jierui Biotechnology Co., Ltd. The recombinant vector pET28a(+)-BiSP was transformed into *Escherichia coli* BL21(DE3) to obtain the corresponding recombinant *E. coli*. These recombinant *E. coli* strains were plated on LB agar plates containing kanamycin and incubated overnight at 37°C. Random single colonies were selected for sequencing verification. The results showed that the recombinant expression vector containing the sucrose phosphorylase BiSPase gene was successfully transformed into the host *E. coli* BL21(DE3), ultimately yielding a strain expressing the wtBiSPase recombinant protein.

[0040] Example 2: Construction of E. coli expressing mutant protein

[0041] (1) Overlap PCR was performed using the plasmid pET28a(+)-BiSP containing the target gene from Example 1 as a template. The primers BiSP-F-BamHI / G197C-R and BiSP-R-EcoRI / G197C-F, as shown in Table 1, were used respectively. The PCR procedure is shown in Table 2. The PCR product was recovered to obtain the mutant BiSPase. G197C The upstream and downstream homologous arms of the gene are G197C-up and G197C-dn.

[0042] Using the recovered G197C-up and G197C-dn as templates and BiSP-F-BamHI / BiSP-R-EcoRI as primers, BiSPase was amplified by overlap PCR. G197CTarget gene. BiSPase was treated with double digestion of EcoRI and BamHI. G197C After purification and recovery, the pET-28a(+) vector obtained by the same double digestion was ligated with T4 ligase. The resulting ligation product was transformed into E. coli DH5α competent cells. Single clones were picked, plasmids were extracted, and identified by double digestion with EcoRI and BamHI. The recombinant expression plasmid was sequenced to obtain the plasmid pET28a(+)-BiSPase. G197C .

[0043] (2) Overlap PCR was performed using the plasmid pET28a(+)-BiSP containing the target gene from Example 1 as a template. The primers BiSP-F-BamHI / T141C-R and BiSP-R-EcoRI / T141C-F, as shown in Table 1, were used respectively. The PCR procedure is shown in Table 2. The PCR product was recovered to obtain the mutant BiSPase. T141C The upstream and downstream homologous arms of the gene are T141C-up and T141C-dn.

[0044] Using the recovered T141C-up and T141C-dn as templates and BiSP-F-BamHI / BiSP-R-EcoRI as primers, BiSPase was amplified by overlap PCR. T141C Target gene. BiSPase was treated with double digestion of EcoRI and BamHI. T141C After purification and recovery, the pET-28a(+) vector obtained by the same double digestion was ligated with T4 ligase. The resulting ligation product was transformed into E. coli DH5α competent cells. Single clones were picked, plasmids were extracted, and identified by double digestion with EcoRI and BamHI. The recombinant expression plasmid was sequenced to obtain the plasmid pET28a(+)-BiSPase. T141C .

[0045] (3) The obtained plasmid pET28a(+)-BiSPase G197C Overlap PCR was performed using the primers BiSP-F-BamHI / T141C-R and BiSP-R-EcoRI / T141C-F as shown in Table 1. The PCR procedure is shown in Table 2. The PCR product was recovered to obtain the mutant BiSPase. T141C / G197C The upstream and downstream homologous arms of the gene are T141C / G197C-up and T141C / G197C-dn.

[0046] Using the recovered T141C / G197C-up and T141C / G197C-dn as templates and BiSP-F-BamHI / BiSP-R-EcoRI as primers, BiSPase was amplified by overlap PCR. T141C / G197CTarget gene. BiSPase was treated with double digestion of EcoRI and BamHI. T141C / G197C After purification and recovery, the pET-28a(+) vector obtained by the same double digestion was ligated with T4 ligase. The resulting ligation product was transformed into E. coli DH5α competent cells. Single clones were picked, plasmids were extracted, and identified by double digestion with EcoRI and BamHI. The recombinant expression plasmid was sequenced to obtain the plasmid pET28a(+)-BiSPase. T141C / G197C .

[0047] (4) The obtained plasmid pET28a(+)-BiSPase T141C pET28a(+)-BiSPase G197C and pET28a(+)-BiSPase T141C / G197C The recombinant E. coli was directly transformed into E. coli BL21(DE3) to obtain the corresponding recombinant E. coli. The recombinant E. coli was plated on LB agar plates containing kanamycin and incubated overnight at 37°C. Single colonies were randomly selected for sequencing verification. The results showed that the recombinant expression vector containing the BiSPase mutant gene of sucrose phosphorylase was successfully transformed into the host E. coli BL21(DE3), and mutant strains T141C, G197C, and T141C / G197C were finally obtained.

[0048] Table 1: Primers for mutant construction

[0049] Primers Sequence (5'-3') BiSP-F-BamHI CGCGGATCCATGAAGAACAAGGTTCAATTGA BiSP-R-EcoRI CCGGAATTCTTAATGATGATGATGATGATGATCAATA G197C-R GGAAGTTCCAGCTTCCTTAGCGCAGTATCCAACAGCATCCAAT G197C-F TTAGATTGGATGCTGTTGGATACTGCGCTAAGGAAGCTGG T141C-R AGTCTTACCAGCAAACTTGTAATGGCAAAATGGCAATCCTGG T141C-F GACCTAGACCAGGATTGCCATTTTGCCATTACAAGTTTGC

[0050] Table 2: Overlap Extension PCR Procedure

[0051] Pre-variation PCR system Reaction cycle number 94℃, 5min 94℃ for 10 seconds, 55℃ for 5 seconds, 72℃ for 30 seconds 35 98℃, min 98℃10s, 55℃30s, 72℃10min 35

[0052] Example 3: Expression and purification of wtBiSPase and mutants

[0053] Plasmid pET28a(+)-BiSP was introduced into BL21(DE3) competent cells. Positive clones were picked and incubated in 50 mL of LB medium containing 50 μg / mL Kan antibiotic at 37°C and 225 rpm for 10 h on a shaker. 1 mL of the bacterial culture was then transferred to 50 mL of LB medium containing Kan antibiotic and cultured at 37°C and 225 rpm until the OD reached approximately 0.5. 50 μL of 0.5 M IPTG was added, and the culture was transferred to 20°C and fermented at 225 rpm for 6–24 h. The culture was then collected and centrifuged at 12000 g for 10 min at 4°C. The collected bacterial cells were washed twice with 50 mM Tris-HCl (pH = 7.5), and an appropriate amount of 20 mM phosphate buffer (pH = 7.4) was added. The cells were then sonicated on ice for 30 min. After disruption, the cells were centrifuged at 12000 g for 10 min at 4°C, and the supernatant was collected for protein gel identification. The supernatant was filtered through a 0.45 μm filter and purified using a nickel column (His Trap™ HP 1 mL). The loading buffer consisted of 500 mM NaCl, 50 mM NaH₂PO₄, and 50 mM Na₂HPO₄, pH 7.4. The elution buffer consisted of 250 mM imidazole, 500 mM NaCl, 50 mM NaH₂PO₄, and 50 mM Na₂HPO₄, pH 7.4. The purified target protein was analyzed by SDS-PAGE.

[0054] Figure 1 This is an SDS-PAGE image showing the induced expression and purification of sucrose phosphorylase wtBiSPase and its mutants. Lane M: Marker; Lane 1: BiSPase cell lysate supernatant; Lane 2: BiSPase cell lysate precipitate; Lane 3: Purified wtBiSPase protein; Lane 4: G197C; Lane 5: T141C; Lane 6: T141C / G197C. The results indicate that electrophoretically pure recombinant sucrose phosphorylase and its mutants were obtained by NiNTA affinity chromatography.

[0055] Example 4: Analysis of the catalytic efficiency of sucrose phosphorylase mutant and its synthesis of AA-2G

[0056] The recombinant sucrose phosphorylase wtBiSPase and BiSPase purified in Example 3 were used. T141C BiSPase G197C and BiSPase T141C / G197C AA-2G was synthesized by transglycosylation reaction.

[0057] 1 mL of reaction system:

[0058] 1.2 mL ascorbic acid final concentration, 0.8 M sucrose final concentration, adjust substrate pH to 5.2, add purified enzyme to a final concentration of 0.4 mg / mL, and react at 40℃ in a metal shaker at 1000 rpm for 12-36 h.

[0059] Enzyme activity definition: Under the above conditions, the amount of enzyme required to generate 1 μmol AA-2G per minute is defined as one enzyme activity unit, expressed as 1 U. The relative activity of wtBiSPase is 100. The catalytic efficiency of wtBiSPase and its mutants on the corresponding substrates and the yield of AA-2G are shown in Table 3.

[0060] Table 3. Relative enzyme activities of wtBiSPase and its mutants and their AA-2G yields

[0061] mutant Compared with wild type, the relative enzyme activity is increased. AA-2G yield (g / L) wtBiSPase - 123 <![CDATA[BiSPase T141C ]]> 119% 151 <![CDATA[BiSPase G197C ]]> 151% 193 <![CDATA[BiSPase T141C / G197C ]]> 166% 215

[0062] High-performance liquid chromatography (HPLC) detection of AA-2G: The chromatographic column was an Acclaim 120 C18 (5 μm, 4.6 × 250 mm). The UV detection wavelength was 238 / 243 nm. The mobile phase was 100 mM KH₂PO₄, adjusted to pH 2.0 with phosphoric acid. The flow rate was 0.8 mL / min, the time was 20 min, the injection volume was 0.5 μL, and the column temperature was 25 °C. The peak area of ​​AA-2G in the HPLC chromatogram was directly proportional to its concentration; a standard curve for AA-2G was plotted accordingly. The concentration of AA-2G in the sample was determined using the standard curve and the peak area of ​​AA-2G in the sample.

[0063] Figure 2 BiSPase T141C / G197C LC-MS chromatogram of the catalyst solution at 24h.

[0064] Analysis of experimental results: Compared with the wild type, the sucrose phosphorylase BiSPase mutant provided by this invention has better catalytic activity. The concentration of AA-2G synthesized by the sucrose phosphorylase mutant is 154-215 g / L. The sucrose phosphorylase mutant can be better applied in the field of biocatalysis, which is of great significance for the industrial production and application of AA-2G.

[0065] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any way, and all technical solutions obtained by equivalent substitution or equivalent transformation fall within the protection scope of the present invention.

Claims

1. A site-directed mutagenesis sucrose phosphorylase, characterized in that, Sucrose phosphorylase (SAP) with an amino acid sequence as shown in SEQ ID NO.1 Bi The point mutation is obtained by creating a point mutation in SPase, wherein the mutation site is selected from: position 141 and / or position 197; the point mutation at position 141 is a threonine mutation to cysteine; and the point mutation at position 197 is a glycine mutation to cysteine.

2. A DNA molecule, characterized in that: It encodes the site-directed mutated sucrose phosphorylase as described in claim 1.

3. The DNA molecule according to claim 2, characterized in that: The amino acid sequence of the sucrose phosphorylase it encodes is selected from the amino acid sequences shown in SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.

4.

4. A carrier, characterized in that: It contains the DNA molecule as described in claim 2 or 3.

5. A host cell, characterized in that: It contains the DNA molecule as described in claim 2 or 3, or the vector as described in claim 4.

6. A method for producing sucrose phosphorylase by site-directed mutagenesis as described in claim 1, characterized in that, The method includes: culturing the host cell of claim 5 under conditions suitable for sucrose phosphorylase expression, and isolating the sucrose phosphorylase from the culture medium.

7. The application of the site-directed mutagenesis sucrose phosphorylase as described in claim 1 in the preparation of L-ascorbic acid glucoside.