Saccharomyces cerevisiae strain msl, fermentation inoculant containing saccharomyces cerevisiae msl and application thereof
By screening and applying the wine yeast MSL, the problem of wine lacking regional characteristics has been solved, resulting in richer flavors and improved quality, especially in the production of Longan dry white wine.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- HEBEI AGRICULTURAL UNIV.
- Filing Date
- 2023-06-28
- Publication Date
- 2026-06-12
AI Technical Summary
my country's wine products lack regional characteristics, have relatively simple aromas, rely on imported brewing yeast, and are affected by other factors during fermentation.
A strain of Saccharomyces cerevisiae (MSL) was selected and provided. This yeast can still produce high levels of β-glucosidase under conditions of high sugar, high alcohol, high SO2 concentration and low pH, which promotes the production of terpenes and C13-norisoprene compounds, enhances the complexity of wine flavor, and can be applied to winemaking as a fermentation agent.
Brewing yeast MSL significantly increases the content of volatile compounds in wine, enhances floral and fruity aromas, and improves the flavor complexity and regional characteristics of the wine, conforming to the typical style of fine wines.
Smart Images

Figure CN116769621B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of industrial microbiology, and more particularly to a strain of Saccharomyces cerevisiae MSL, a fermentation agent containing Saccharomyces cerevisiae MSL, and their applications. Background Technology
[0002] Wine is the world's second most consumed alcoholic beverage after beer, holding a significant position in global regional economies and international trade. Saccharomyces cerevisiae is the primary yeast strain in the wine industry, playing a crucial role in the winemaking process. It converts most of glucose into ethanol and carbon dioxide, while simultaneously producing metabolic byproducts such as glycerol, amino acids, esters, and higher alcohols through a series of reactions, thus influencing the quality of the wine in terms of color, aroma, and taste. Winemaking primarily relies on Saccharomyces cerevisiae, employing natural fermentation or inoculation fermentation to fully express the various potential qualities and advantages of the grape raw materials. During the winemaking process, the performance of the Saccharomyces cerevisiae is critical to the formation of wine quality, as the fermentation characteristics of the yeast directly affect not only the alcohol accumulation and sensory quality of the wine but also determine the fermentation process, operating cycle, and costs. Wine is a highly individual beverage; wines from different regions exhibit distinct styles and characteristics, and this diversity is precisely what makes wine so captivating.
[0003] With the development of the wine industry, consumers have placed higher demands on the quality of wines. The production of high-quality wines urgently requires superior yeast strains that possess regional characteristics and can reflect the wine's unique features and style. Currently, my country's wine products suffer from severe homogenization, lacking high-quality products that can represent the characteristics of different production regions. The most prominent issue is the lack of diverse aromas and distinct regional characteristics, which has become one of the main factors restricting the development of my country's grape and wine industry. Furthermore, other factors during fermentation, such as sugar content, alcohol content, pH value, and sulfur dioxide, can also affect yeast reproduction, thus impacting wine quality. Therefore, selecting resistant, native winemaking yeasts is of great significance to wine production. Summary of the Invention
[0004] In response to the problems that existing brewing yeasts mainly rely on imports and that wine products do not have distinct regional style characteristics, this invention provides a brewing yeast strain MSL, a fermentation agent containing brewing yeast MSL, and its application.
[0005] To solve the above-mentioned technical problems, the technical solution provided by the present invention is as follows:
[0006] In a first aspect, the present invention provides a strain of Saccharomyces cerevisiae MSL, which has the accession number CGMCC No.25347.
[0007] The brewer's yeast (Saccharomyces cerevisiae) MSL, classified as Saccharomyces, was deposited on July 18, 2022, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 25347, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
[0008] The biological characteristics of the Saccharomyces cerevisiae MSL provided by this invention are as follows: on YPD medium, it is milky white, round, with neat borders, and the colonies are spherical protrusions and opaque.
[0009] Preferably, the brewing yeast (Saccharomyces cerevisiae) MSL is selected from the surface of Marselan grapes grown in Huailai County, Zhangjiakou City, Hebei Province.
[0010] β-glucosidase, a cellulosic hydrolase, hydrolyzes glycosidic bonds in glycoside-bound substances, releasing aroma compounds and promoting the production of terpenes and C13-norisoprene compounds. This enhances the floral, fruity, and nutty aromas of wine, playing a crucial role in improving or enhancing its flavor complexity. However, certain conditions during winemaking (such as high sugar, high alcohol content, high SO2 concentration, and low pH) may inhibit β-glucosidase activity in the fermentation system, preventing it from fully hydrolyzing glycosidic bonds. The *Saccharomyces cerevisiae* MSL provided in this invention can still produce high levels of β-glucosidase under traditional winemaking conditions. This β-glucosidase exhibits high enzyme activity under these conditions, promoting the release of terpenes, increasing the content of volatile compounds in wine, and contributing to increased flavor complexity.
[0011] Furthermore, the β-glucosidase activity of the Saccharomyces cerevisiae MSL provided by the present invention is 36.80±0.39U / mL.
[0012] Secondly, the present invention also provides a fermentation agent comprising the aforementioned brewing yeast MSL.
[0013] Furthermore, the fermentation agent is a liquid agent, a semi-liquid agent, or a solid agent.
[0014] For example, *Saccharomyces cerevisiae* MSL was inoculated into YPD liquid medium and fermented until the viable cell count reached 10⁻⁶. 8 A liquid bacterial agent was obtained with a concentration of cfu / mL or higher.
[0015] The above liquid bacterial agent was concentrated to obtain a semi-liquid bacterial agent.
[0016] The above concentration can be achieved using conventional concentration methods in the field, such as centrifugation and filtration, and the present invention does not impose any special requirements.
[0017] Add buffer solution and lyophilization protectant to the above semi-liquid bacterial agent, and adjust the viable count to 10⁻⁶. 10 cfu / mL ~10 12 cfu / mL, freeze-dried to obtain solid bacterial agent.
[0018] The buffer solution described above can be a conventional buffer solution in the art, such as PBS buffer or physiological saline. The lyophilization protectant can also be a commonly used lyophilization protectant in the art, such as at least one of skim milk powder, maltodextrin, dextran, or glycerol.
[0019] Furthermore, the viable cell concentration of *Saccharomyces cerevisiae* MSL in the fermentation agent is 10. 8 cfu / mL ~10 12 cfu / mL.
[0020] Thirdly, the present invention also provides the application of the above-mentioned brewing yeast MSL or fermentation agent in winemaking, especially in the brewing of longan dry white wine.
[0021] The brewing yeast provided by this invention can be widely used in the production of wines from various grape varieties in Chinese wine-producing regions, especially in the wine-making of Huailai County, Zhangjiakou City, Hebei Province. In terms of the typicality of dry white wines, it is significantly superior to commercial strains, indicating that the selected strain can reflect the typical characteristics of wines from its origin and has practical application value.
[0022] The present invention also provides a method for producing wine, which involves fermenting grape raw materials with the above-mentioned wine yeast MSL or any of the above-mentioned fermentation agents to obtain wine.
[0023] Specifically, the steps of the above-mentioned method for producing wine are as follows: using crushed, destemmed, and pressed grape juice as raw material, inoculating the above-mentioned wine yeast MSL or the fermentation agent into the grape juice, mixing evenly, and fermenting under pH 3-4 and 12℃-16℃ conditions to obtain wine.
[0024] Furthermore, the inoculum size of the brewer's yeast MSL is 1×10⁻⁶. 6 cfu / mL~1×10 7 cfu / mL.
[0025] Fermentation by brewer's yeast produces a series of metabolites that impart a pleasant and unique flavor to wine. The higher alcohols and esters in these metabolites are directly influenced by the cell density of the brewer's yeast. An optimal inoculum size ensures appropriate levels of higher alcohols and esters in the wine, and also provides suitable alcohol content and fermentation degree, resulting in a better taste.
[0026] Furthermore, the grape juice raw material is obtained by crushing, destemming, and pressing longan grapes from Huailai County, Zhangjiakou City, Hebei Province.
[0027] It should be noted that the Saccharomyces cerevisiae MSL needs to be activated before fermentation. Conventional activation methods in this field can be used, such as inoculating the Saccharomyces cerevisiae MSL into YPD liquid medium and incubating overnight at 28°C in a shaker.
[0028] The *Saccharomyces cerevisiae* MSL provided by this invention can produce high levels of β-glucosidase (36.80±0.39 U / mL) and exhibits excellent tolerance. Compared with the commercial *Saccharomyces cerevisiae* VL2, the *Saccharomyces cerevisiae* MSL provided by this invention can produce wines with higher ester content (1145.78±14.28 mg / L) and higher alcohol content (355.37±5.38 mg / L), and also increases the content of terpenes. It has a rich floral and fruity aroma, an elegant and harmonious fragrance, a smooth taste, and distinct regional aroma and flavor characteristics, which is of great significance to promoting the development of the wine industry. Attached Figure Description
[0029] Figure 1 Colony morphology of Saccharomyces cerevisiae MSL on YPD solid medium;
[0030] Figure 2 Spider diagram for sensory evaluation of wines fermented with Saccharomyces cerevisiae MSL and commercial yeast VL2. Detailed Implementation
[0031] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.
[0032] Culture medium used in the examples:
[0033] YPD liquid culture medium (1L): 20g glucose, 20g peptone, 10g yeast extract, 1000mL water, natural pH, sterilized at 121℃ for 20min before use.
[0034] YPD solid medium (1L): 20g glucose, 20g peptone, 10g yeast extract, 15g agar, 100mg chloramphenicol (pre-dissolved in a small amount of ethanol), 1000mL water, natural pH, sterilized at 121℃ for 20min before use.
[0035] Screening medium (1L): 10g yeast extract, 20g peptone, 20g glucose, 20g agar, 3g ammonium sulfate, 4g potassium dihydrogen phosphate, 1g p-NPG, 1000mL water, natural pH, sterilized at 121℃ for 20min before use.
[0036] Aescin medium formula (1L): 3g aescin, 0.5g ferric citrate, 2g sodium chloride, 0.5g magnesium sulfate heptahydrate, 0.1g potassium dihydrogen phosphate, 20g agar, 1000mL water, natural pH, sterilize at 121℃ for 20min before use.
[0037] Enzyme-producing culture medium formula (1L): 10g yeast powder, 20g peptone, 20g glucose, 3g sulfuric acid, 4g phosphate, 1000mL water, natural pH value, sterilize at 121℃ for 20min and then use.
[0038] Example 1
[0039] 1. Selection of starting strains
[0040] 1.1 Isolation and screening of fruit surface yeasts
[0041] Aseptically weigh 5g of ripe Marselan grapes from Huailai County, Zhangjiakou City, and place them in 45mL of sterilized 0.9% sodium chloride solution. Shake well to prepare a bacterial suspension. Take 1mL of the bacterial suspension and place it in a thermostatically sterilized YPD liquid medium. Incubate at 28℃ (180r / min) for 2 days. Take 1mL of the bacterial suspension and add it to 9mL of sterilized 0.9% sodium chloride solution. Gently shake. Repeat the above operation, serially diluting 10... 2 ~10 7 Add 0.1 mL of bacterial suspension at different concentration gradients to YPD solid medium using a micropipette. Spread the solution evenly using a spreader. Incubate the YPD solid medium in a constant temperature incubator at 28°C, inverted. Set up three replicates for each concentration gradient. Pick single colonies with different appearances and colors from the YPD solid medium and purify them using the four-zone streak method. Record the obtained pure cultures. Mix the pure cultures with 40% glycerol solution in an equal proportion, shake well, and store at -20°C.
[0042] 1.2 Screening of β-glucosidase-producing yeast strains
[0043] Initial screening: The yeast strains obtained from the above screening were inoculated onto YPD liquid medium and cultured at 28°C with shaking for 24 hours (180 r / min). The activation solution was then diluted to 10. 4 CFU / mL was inoculated into selection medium and incubated at 28°C for 72 h. Then, a 1 mol / L sodium carbonate solution was sprayed onto the medium. The mold-producing strain decomposes p-NPG to produce p-nitrophenol (p-NP). p-NP reacts with sodium carbonate to produce a yellow substance, forming a clear zone around the colony. The larger the diameter and the deeper the color of the clear zone, the higher the enzyme activity. Single colonies of the target strain were picked and cultured for 48 h. The bacterial solution was then mixed with a 40% glycerol solution in an equal proportion, shaken thoroughly, and stored at -20°C.
[0044] Secondary screening: The target strains selected in the previous step were inoculated onto YPD liquid medium and cultured at 28℃ with shaking for 24 hours (180 r / min). The activated bacterial solution was then inoculated into a medium containing aescin and observed using a 96-well plate. Each strain was inoculated three times, covered with a sealing film, and incubated statically at 28℃ for 1 day. The color of the medium was observed for any changes and the degree of color change. Aescin can be converted to aescinogen under the action of β-glucosidase, and aescinogen reacts with ferric ions to produce a brownish-black color. Therefore, the intensity of enzyme production by the strain can be judged based on the color of the medium.
[0045] 1.3 Assay of β-glucosidase activity
[0046] The high-β-glucosidase-producing strains obtained from the previous screening were inoculated onto YPD liquid medium and activated by shaking culture at 28°C for 24 h (180 r / min). The activation solution was then diluted to 10. 6 CFU / mL was inoculated into the enzyme-producing medium and cultured at 28°C with shaking for 3 days. The cultured bacterial solution was then placed in a centrifuge tube and centrifuged at 8000 rpm for 10 minutes at 4°C. The supernatant, i.e., the crude enzyme solution, was collected for further analysis and detection.
[0047] Accurately pipette 0.5 mL of crude enzyme solution into a 15 mL centrifuge tube. Then add 1 mL of 35 mM p-NPG solution (pH 5.0) prepared in advance using citrate-phosphate buffer as the solvent. Gently vortex to mix, and react in a water bath at 50 °C for 10 min. Add 8 mL of 1 mol / L sodium carbonate solution to terminate the reaction. After waiting 5 min for color development and stabilization, measure the absorbance under UV light at a wavelength of 400 nm. The blank is YPD liquid culture medium without inoculation under the same treatment.
[0048] Enzyme activity unit (U) is defined as the amount of enzyme required to hydrolyze p-NPG to produce 1 nmol of p-NP in 1 min under reaction conditions of pH 5.0 and 50℃.
[0049] The enzyme activity was measured to be 36.80 ± 0.39 U / mL.
[0050] Example 2
[0051] Identification of enzyme-producing strains
[0052] 1.1 Ecological Observation
[0053] The MSL strain was inoculated onto YPD solid medium and incubated in a 28°C incubator for about 48 hours. The colony morphology, colony edge, color, and transparency on the medium were then observed.
[0054] On YPD solid medium, strain MSL appears milky white, round, with neat borders; the colonies are spherical and opaque. Figure 1 As shown.
[0055] 1.2 Molecular biological identification
[0056] DNA extraction: Follow the instructions for the PlantZol genomic extraction kit.
[0057] PCR amplification: PCR amplification was performed using the universal ITS rDNA primers ITS1 (5'-TCCGTAGGTGAACCTGCG G-3') and ITS4R (5'-TCCTCCGCTTATTGATATGC-3').
[0058] PCR amplification was performed using a 50 μL reaction system, which included: 5.0 μL of 10×Ex Taq buffer, 4.0 μL of 2.5 mM dNTP Mix, 2.0 μL of 10p primer 1, 2.0 μL of 10p primer 2, 0.5 μL of 5U Ex Taq (5 U / μL), 2.0 μL of DNA template (20 μg / μL), and 34.5 μL of ddH2O.
[0059] PCR reaction conditions: First, pre-denaturation at 94℃ for 3 min; then denaturation at 94℃ for 30 s, annealing at 54℃ for 30 s, extension at 72℃ for 1.5 min, for a total of 24 cycles, and a final extension at 72℃ for 10 min. PCR product detection and gel recovery: Products were electrophoresed in a 0.8% gel at 150V for 20 min. The PCR products were then recovered by gel cutting. PCR amplification and sequencing were performed by Ruiboxingke Biotechnology Co., Ltd., using the Sanger sequencing method. The sequencing results for ITS rDNA are as follows:
[0060] TTATAATTTTGAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAAGACCGGCCGTTTAAGGTTTACCCACTGGCGGTTATCCTTTTTTTATTCTGGACGGTATGGGACGTTAATCCAAAAGAAGAGAACCTCCTAGGCGAACCATGGTTCTTAAAGTTTGGACTCCAAATCAAGGTAAGAAGTACCCGCCTGAACTTAAGCATATCTTAAGAGACGCGCGGGAAAGAA。
[0061] The ITS rDNA sequence of the Saccharomyces cerevisiae MSL strain was compared with the sequences in the GenBank database, and the MSL strain was identified as Saccharomyces cerevisiae.
[0062] The Saccharomyces cerevisiae MSL was deposited on July 18, 2022, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 25347, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
[0063] Example 3
[0064] Evaluation of the stress resistance of yeast strains producing β-glucosidase, including resistance to high sugar, ethanol, acid, and SO2, after secondary screening.
[0065] 1.1 Evaluation of glucose tolerance
[0066] YPD liquid culture media with different glucose concentrations (5%, 10%, 15%, 20%) were prepared. Saccharomyces cerevisiae MSL were inoculated into each of the YPD liquid culture media with a different glucose concentration, with an inoculation volume of 10 μL. 6 The culture medium was incubated at 28°C with shaking for 72 hours using cfu / mL. A standard YPD medium with added bacterial culture was used as a control group. Enzyme activity was determined according to the method described in Example 1 (1.3).
[0067] 1.2 Ethanol tolerance evaluation
[0068] YPD liquid culture media with different ethanol concentrations (3%, 6%, 9%, 12%) were prepared, and *Saccharomyces cerevisiae* MSL was inoculated into the YPD liquid culture media with different ethanol concentrations at an inoculation volume of 10 μL. 6 The culture medium was incubated at 28°C with shaking for 72 hours using cfu / mL. A standard YPD medium with added bacterial culture was used as a control group. Enzyme activity was determined according to the method described in Example 1 (1.3).
[0069] 1.3 Metal ions
[0070] Different metal ions (Zn) were added at 5 mmol / L to YPD liquid culture medium. 2+ Mg 2+ Cu 2+ Ca 2+ Fe 2+ Mn 2+ Saccharomyces cerevisiae MSL was inoculated into YPD liquid medium containing different metal ions at a density of 10 μL. 6 The culture medium was incubated at 28°C with shaking for 72 hours using cfu / mL. A standard YPD medium with added bacterial culture was used as a control group. Enzyme activity was determined according to the method described in Example 1 (1.3).
[0071] 1.4 pH
[0072] The pH values of YPD liquid medium were adjusted to 2.0, 2.5, 3.0, and 3.5, respectively. Saccharomyces cerevisiae MSL was then inoculated into YPD liquid medium at different pH values at an inoculation volume of 10 μL. 6 The culture medium was incubated at 28°C with shaking for 72 hours using cfu / mL. A standard YPD medium with added bacterial culture was used as a control group. Enzyme activity was determined according to the method described in Example 1 (1.3).
[0073] 3.5 Sulfur dioxide
[0074] Potassium metabisulfite was added to YPD liquid medium to adjust the SO2 concentration to 40 mg / L, 60 mg / L, 80 mg / L, and 100 mg / L. Saccharomyces cerevisiae MSL was then inoculated into YPD liquid medium at different SO2 concentrations at an inoculation volume of 10 μL. 6 The culture medium was incubated at 28°C with shaking for 72 hours using cfu / mL. A standard YPD medium with added bacterial culture was used as a control group. Enzyme activity was determined according to the method in Example 1 (1.3). The results are shown in Table 1.
[0075] Table 1
[0076]
[0077] As shown in the table, the relative enzyme activity of the MSL strain gradually decreases with increasing glucose concentration. The relative enzyme activity reaches its maximum (100.17%) at a glucose concentration of 5%, indicating that the β-glucosidase secreted by yeast MSL is most effective at a glucose concentration of 50 g / L. At a glucose concentration of 20%, the relative enzyme activity of β-glucosidase is 45.24%, demonstrating the strain's good tolerance to high glucose levels.
[0078] Commercially available wines typically have an alcohol concentration of around 12%. At an ethanol concentration of 6%, the MSL strain exhibits some activation of enzyme activity, indicating that within a certain low-concentration ethanol range, ethanol can effectively increase cell membrane permeability, causing yeast cells to release more extracellular enzymes. At high ethanol concentrations, the relative enzyme activity of yeast is inhibited to varying degrees. The MSL strain maintains a high β-glucosidase activity (85.50%) at a 12% ethanol concentration, demonstrating that the β-glucosidase produced by the MSL strain has good ethanol tolerance.
[0079] Cu 2+ The Mg2+ enzyme activity of the MSL strain was inhibited. 2+ and Fe 2+ It had almost no effect on the enzyme activity of the MSL strain, Zn 2+ and Ca 2+ Mn has a certain activating effect on its enzyme activity.2+ There is a slight inhibitory effect. In summary, the enzyme production activity of Saccharomyces cerevisiae MSL is less affected by metal ions.
[0080] At pH 2, the relative enzyme activity of yeast strain MSL dropped below 15%. Excessively low pH alters the spatial structure of enzyme proteins, thus affecting enzyme activity. As the pH of the culture medium increased, enzyme activity increased to varying degrees. At pH 3.5, the relative enzyme activity reached over 50% of the control group. Most grape juices and commercially available wines have a pH between 3 and 4; within this range, strain MSL exhibited good enzyme activity, indicating its suitability for the low-pH fermentation environment of wine.
[0081] When the SO2 addition was 60 mg / L, the enzyme activity of the MSL strain was higher than that of the control group. When the SO2 addition was 80 mg / L, the enzyme activity of the MSL strain was less affected. When the SO2 addition was 100 mg / L, the relative enzyme activity remained above 85%, indicating that the β-glucosidase secreted by the yeast strain MSL has good tolerance to sulfur dioxide.
[0082] Example 4
[0083] Brewing yeast MSL is used in the production of dry white wine.
[0084] 1. Fermentation experiment
[0085] Sampling was conducted at a perennial, high-quality vineyard in Huailai County, Zhangjiakou City. Healthy, fresh longan grapes with undamaged skins were harvested. The juice from the crushed, destemmed, and pressed longan grapes was used as raw material. Wine yeast MSL was used as the starter culture. 250 mL of longan grape juice was placed in a 500 mL Erlenmeyer flask that had undergone high-temperature sterilization. The flask was sterilized at 70°C for 20 minutes, cooled to room temperature, and then inoculated with 5 mL of activated wine yeast MSL suspension. Commercially available active dry yeast VL2 (200 g / 100 mL) was used as a control. When the yeast mixture was added to the fermentation vessel, it was ensured that the yeast solution was thoroughly mixed within the fermenter. Static fermentation was carried out at 14°C until a constant weight was achieved after three consecutive days, at which point fermentation was considered complete.
[0086] 2. Detection of volatile compounds
[0087] Extraction of volatile aroma components: 7.5 mL of wine was transferred to a 20 mL glass headspace vial, and 10 μL of 3-octanol aqueous solution (300 mg / L) was added as an internal standard, along with 2 g of NaCl to facilitate aroma volatilization. The aroma was determined using a semi-quantitative internal standard method. The vial was then equilibrated in a 40 °C water bath for 15 min, followed by SPME fiber headspace extraction at constant temperature for 40 min. Finally, the vial was manually injected into the GC inlet for 6 min for analysis.
[0088] Qualitative analysis was performed using full scan mode (SCAN), and quantitative analysis was performed using ion scan mode (SIM). Mass spectra were compared with the NIST 14 library, and components with a matching degree of 80% or higher were analyzed. Semi-quantitative analysis of volatile compounds was performed using the internal standard method. The results are shown in Table 2.
[0089] Table 2
[0090]
[0091] Esters and alcohols are the main volatile aroma compounds in wine. Esters mainly include acetates and ethyl acetates, which are closely related to the floral and fruity aromas of wine. The total ester content of wine made from the MSL strain was significantly higher than that of the control wine. Wine made from the MSL strain also contained esters not found in the commercial control strain VL2, including ethyl 9-decenoate (36.19±0.11 mg / L) and phenethyl acetate (19.42±0.91 mg / L), which contribute positively to the floral and fruity aromas of wine. In wine made from the MSL strain, some esters related to floral and fruity aromas, such as isoamyl formate, were also higher than in the control wine.
[0092] Terpenes contribute floral and fruity aromas to wine, and their low threshold means that even low levels can affect the wine's aroma. Previous studies have shown that adding β-glucosidase to wine significantly increases the content of higher alcohols. Saccharomyces cerevisiae MSL produces high levels of β-glucosidase, resulting in a significantly higher alcohol content (355.37±5.38 mg / L) compared to the control group (98.83±3.66 mg / L). Simultaneously, four terpenes were detected in both samples: lauryl alcohol, 4-terpene alcohol, citronellol, and nerolidol. Lauryl alcohol, citronellol, and nerolidol are unique to wines made from the MSL strain. These volatile aromatic compounds contribute rich floral and fruity aromas to the wine. Furthermore, damascene (11.34±0.05 mg / L) was also detected in the MSL wine. Damascene, derived from glucosidase-hydrolyzed glucosinolate precursors, contributes positively to the wine's floral and sweet aromas.
[0093] 3. Sensory evaluation
[0094] After fermentation according to the above method, referring to the sensory indicators of wine in GB15037-2006 "Wine" and the flavor characteristics of longan wine, a panel of 10 experts with many years of experience in wine research was assembled to conduct a sensory evaluation of the fermented wine. The scoring results given by the expert panel are shown below. Figure 2As shown, experts unanimously agree that the dry white wine brewed by the MSL strain of brewing yeast of this invention has a clear and transparent body, a soft and delicate taste, and a richer aroma of fruit and flowers, especially green fruits and flowers. The aroma intensity is richer, the sweetness and acidity are balanced, the overall flavor is harmonious, and the style is unique. Compared with the commercial strain VL2, it can better highlight the characteristics of local longan grapes, better showcasing their winemaking characteristics, improving the sensory quality of the wine, and conforming to the typical style of high-quality dry white wine.
[0095] The results above show that the strain with accession number CGMCC No.25347 selected in this invention has good resistance to acid, sulfur dioxide, high sugar and alcohol, and has the excellent characteristic of high production of β-glucosidase. The wine made from it has local biochemical characteristics and can produce more prominent and richer regional aroma components, which is of great significance for brewing distinctive and high-quality dry white wine.
[0096] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions or improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A strain of brewer's yeast ( Saccharomyces cerevisiae MSL, characterized in that, Its accession number is CGMCCNo.25347.
2. A fermentation agent, characterized in that, It contains the brewing yeast MSL as described in claim 1.
3. The fermentation agent as described in claim 2, characterized in that, The fermentation agent is a liquid agent.
4. The fermentation agent as described in claim 2 or 3, characterized in that, The viable cell concentration of Saccharomyces cerevisiae MSL in the fermentation agent is 10. 8 cfu / mL ~10 12 cfu / mL.
5. The use of the brewing yeast MSL according to claim 1 or the fermentation agent according to any one of claims 2 to 4 in the brewing of dry white wine.
6. A method for producing dry white wine, characterized in that, The wine yeast MSL of claim 1 or the fermentation agent of any one of claims 2 to 4 is inoculated into grape juice, mixed evenly, and fermented at pH 3 to 4 and 12 to 16°C to obtain dry white wine.
7. The method for producing dry white wine as described in claim 6, characterized in that, The inoculation amount of the brewer's yeast MSL was 1×10⁻⁶. 6 cfu / mL ~1×10 7 cfu / mL.
Citation Information
Patent Citations
Saccharomyces cerevisiae and application thereof to wine making
CN108410745A
Saccharomyces cerevisiae and application thereof in preparation of fruity dry red wine
CN112226377A
Saccharomyces cerevisiae, leavening agent and application thereof in wine brewing
CN113717870A