Application of long non-coding RNA in serum exosomes as a diagnostic marker for non-small cell lung cancer

Abstract

The present invention discloses an application of a long non-coding RNA in serum exosomes as a diagnostic marker for non-small cell lung cancer, characterized in that the long non-coding RNA is the AL139294.1 gene, and its nucleotide sequence is shown in SEQ ID NO.1; the application of the non-small cell lung cancer diagnostic marker in the preparation of a molecular targeted drug for non-small cell lung cancer or a non-small cell lung cancer diagnostic kit, wherein the diagnostic kit comprises a pair of specific amplification primers for detecting the expression amount of the lncRNA AL139294.1 gene in serum exosomes, and the specific nucleotide sequences are as follows: upstream amplification primer: 5'-TGTCACAGCAGATGCCACA T-3'; downstream amplification primer: 5'-CCCACTCGCTGCCTATAACA-3'; the advantages are high sensitivity and specificity and positive correlation with the prevalence of non-small cell lung cancer.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology, and in particular relates to the application of long-chain non-coding RNA in serum exosomes as a diagnostic marker for non-small cell lung cancer. Background Art

[0002] Global cancer data from 2023 shows that lung cancer is the most deadly type of cancer. Non-small cell lung cancer (NSCLC) is the predominant pathological type of lung cancer, accounting for approximately 85% of lung cancer cases. Statistics show that the five-year survival rate for NSCLC patients is only 20%-30%. Because NSCLC is often asymptomatic or mild in its early stages, patients are already in the advanced stages of the disease when first diagnosed, missing out on surgical options. Furthermore, NSCLC treatment options are limited, resulting in a poor prognosis. Therefore, early screening for lung cancer is crucial to improving patient survival and reducing lung cancer mortality.

[0003] Currently, non-invasive screening for early lung cancer can be based on low-dose computed tomography (CT) and liquid biopsy biomarkers. Liquid biopsy, due to its minimally invasive, real-time monitoring, and readily available advantages, offers advantages in early screening, measuring treatment response, and predicting lung cancer prognosis. Common tumor markers used in clinical liquid biopsies include neuron-specific enolase (NSE), cytokeratin 19 fragments, carcinoembryonic antigen, and carbohydrate antigen 72-4 (CA72-4). However, their sensitivity and specificity are limited. For example, although NSE is the preferred marker for small cell lung cancer, only approximately 60% of patients with small cell lung cancer have elevated NSE levels. CA72-4 also has varying degrees of detection rates not only for lung cancer, but also for other gastrointestinal cancers, breast cancer, and ovarian cancer. Therefore, the search for more sensitive and specific lung cancer diagnostic markers is crucial to improving early lung cancer screening rates.

[0004] Exosomes are extracellular vesicles with a diameter of 40-200 nm and a lipid bilayer membrane. Exosomes mediate cell-to-cell communication by transporting and releasing their contents, including microRNA (miRNA), long non-coding RNA (lncRNA), circular RNA (circRNA), messenger RNA (mRNA), DNA, and proteins, into recipient cells, thereby influencing the physiological and pathological functions of the recipient cells. In cancer patients, both normal and tumor cells can secrete exosomes into the bloodstream. Tumor cells are the primary source of exosomes in the circulation and are one of the main drivers of tumor development. At various stages of tumor development, exosomes secreted by tumor cells mediate intercellular communication by transporting their contents (miRNA, lncRNA, circRNA, etc.), thereby participating in tumor growth, angiogenesis, hypoxia-driven epithelial-mesenchymal transition, tumor metastasis, immune escape, and drug resistance. Therefore, exosomes and their contents have the potential to become new molecular targets for the diagnosis and treatment of lung cancer. LncRNAs are non-coding RNAs (ncRNAs) greater than 200 nucleotides in length. They regulate gene expression primarily at the epigenetic, transcriptional, and post-transcriptional levels, thus extensively participating in physiological and pathological processes, particularly tumor development and progression. Numerous studies have demonstrated that long non-coding RNAs play a crucial role in cancer development and progression, serving as non-invasive biomarkers for liquid biopsies. For example, the exosomal lncRNA Sox2ot is highly expressed in patients with pancreatic ductal adenocarcinoma and is closely associated with poor prognosis. Currently, no studies have been published domestically or internationally on the use of serum exosomal lncRNA AL139294.1 as a diagnostic biomarker for non-small cell lung cancer. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide an application of long-chain non-coding RNA in serum exosomes with high sensitivity and specificity and positive correlation with the prevalence of non-small cell lung cancer as a diagnostic marker for non-small cell lung cancer.

[0006] The technical solution adopted by the present invention to solve the above technical problems is: an application of long-chain non-coding RNA in serum exosomes as a diagnostic marker for non-small cell lung cancer, wherein the long-chain non-coding RNA is the AL139294.1 gene.

[0007] Furthermore, the nucleotide sequence of the AL139294.1 gene is shown in SEQ ID NO.1.

[0008] Furthermore, the non-small cell lung cancer diagnostic marker is used in the preparation of a non-small cell lung cancer molecular targeted drug or a non-small cell lung cancer diagnostic kit.

[0009] Furthermore, the non-small cell lung cancer diagnostic kit includes a pair of specific amplification primers for detecting the expression level of the lncRNA AL139294.1 gene in serum exosomes, and the specific nucleotide sequences are as follows: upstream amplification primer: 5'-TGTCACAGCAGATGCCACAT-3'; downstream amplification primer: 5'-CCCACTCGCTGCCTATAACA-3'.

[0010] Furthermore, the diagnostic kit also includes a fluorescent quantitative PCR reaction system, which consists of: 5 μl of SYBR Green, 1 μl of cDNA template, 0.5 μl of upstream primer with a concentration of 10 μM, 0.5 μl of downstream primer with a concentration of 10 μM, ddH2O added to 10 μl, and the fluorescent quantitative PCR reaction conditions are as follows: 95°C for 10 min; 95°C for 15 s, 60°C for 30 s, 72°C for 30 s, 40 cycles; 95°C for 15 s, 60°C for 1 min, 95°C for 30 s.

[0011] Compared with the existing technology, the advantages of the present invention are: the present invention discloses for the first time the use of lncRNA AL139294.1 in serum exosomes in the preparation of a diagnostic marker for non-small cell lung cancer and a kit for detecting the long non-coding RNA lncRNA AL139294.1 associated with non-small cell lung cancer. The kit detects the expression of lncRNA AL139294.1 and GAPDH in serum exosomes of subjects by SYBR Green fluorescence quantitative PCR. The expression of lncRNA AL139294.1 in exosomes is calculated and compared in samples from non-small cell lung cancer patients, pneumonia patients, and normal samples. The relative expression parameters of lncRNA AL139294.1 in exosomes are calculated to assist in the diagnosis of non-small cell lung cancer. Compared with traditional non-small cell lung cancer detection technologies, the kit has the advantages of simple operation, high sensitivity, strong specificity, and short cycle time, which is conducive to the early diagnosis and treatment of non-small cell lung cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 Screening of highly expressed lncRNAs in serum exosomes from patients with non-small cell lung cancer;

[0013] Figure 2 To detect the top 45 most significantly upregulated lncRNAs in serum exosomes from 10 patients with non-small cell lung cancer;

[0014] Figure 3is the expression level of lncRNA AL139294.1 in the serum of healthy control group (n=40), pneumonia group (n=49) and non-small cell lung cancer group (n=111);

[0015] Figure 4 The receiver operating characteristic curve was used to analyze the sensitivity and specificity of lncRNA AL139294.1 in serum exosomes for distinguishing patients with non-small cell lung cancer from healthy controls, and the area under the curve was 0.915;

[0016] Figure 5 The expression level of lncRNA AL139294.1 in patients with non-small cell lung cancer with or without lymph node metastasis (N0 / N1-N3), with or without distant metastasis (M0 / M1), and high or low TNM stage (Ⅰ-Ⅱ / Ⅲ-Ⅳ). DETAILED DESCRIPTION

[0017] The present invention will be described in further detail below with reference to the accompanying drawings and embodiments. Specific embodiments

[0019] 1. Between 2019 and 2022, serum samples from patients with non-small cell lung cancer (n = 111) and pneumonia (n = 49) before surgery or any treatment were randomly collected from the First Affiliated Hospital of Ningbo University and the Li Huili Hospital Affiliated to Ningbo University. Serum samples from healthy people (n = 40) without any history of cancer were collected from Ningbo Kangning Hospital. Each subject provided informed consent and agreed to the use of their serum for research purposes in this study. The clinical characteristics of all subjects (including sample type, age, sex, tumor size, histological subtype, TNM stage, lymph node metastasis, distant metastasis, etc.) are listed in Table 1.

[0020] Patient inclusion criteria included signed informed consent, a confirmed pathological diagnosis, and no prior radiotherapy, chemotherapy, or biological therapy. Pregnant or lactating women, patients who had undergone radiotherapy, chemotherapy, or biological therapy, and patients with other malignancies besides lung cancer or other serious illnesses were excluded.

[0021] The inclusion criteria for healthy individuals included signing an informed consent form, being roughly similar in age to the patient group, having no tumors as confirmed by a physical examination in the past year, no diseases in major organs, and being in good mental state.

[0022] Table 1 Sample types and clinical data in this project

[0023]

[0024] 2. Serum exosome extraction

[0025] (1) Add 380 μl of serum to a 1.5 ml EP tube and centrifuge at 2000 g for 30 min at 4°C.

[0026] (2) After taking 300 μl of supernatant and adding it to a new 1.5 ml EP tube, add 60 μl of exosome extraction reagent (Thermo Fisher, 4478360), shake and mix, and then let it stand at 4°C for 30 min;

[0027] (3) Centrifugation at room temperature, 10,000 g, for 10 min;

[0028] (4) Discard the supernatant and add 300 μl of PBS buffer (PBS buffer was pre-filtered through a 0.22 μm filter) to resuspend the exosomes.

[0029] 3. RNA extraction from serum exosomes

[0030] (1) After centrifugation at low speed in a microcentrifuge, 300 μl of the exosome suspension was transferred into a 2 ml enzyme-free EP tube. 1.2 ml of Trizol solution (total RNA extraction reagent) was added. The mixture was thoroughly shaken and lysed on ice for 5 min.

[0031] (2) Add 240 μl of chloroform and incubate on ice for 5 min (if the EP tube is layered, shake it again to mix thoroughly), then centrifuge at 12,000 g for 15 min at 4°C.

[0032] (3) Use a 100 μl pipette tip to aspirate the supernatant into a new 2 ml EP tube, taking care not to aspirate the middle DNA layer. Operate on ice.

[0033] (4) Add 600 μl of isopropanol, mix by inversion, keep on ice for 10 min, and centrifuge at 12,000 g for 10 min at 4°C;

[0034] (5) Discard the liquid in the EP tube, add 1 ml of 75% ethanol, shake up and down, centrifuge at 8000 g for 5 min at 4°C, and discard the ethanol; (6) Repeat the above steps once;

[0035] (7) After the RNA is semi-dried, add 50 μl of DEPC water to dissolve the RNA.

[0036] 4. Screening of long noncoding RNA lncRNA AL139294.1

[0037] (1) Serum samples from three healthy individuals and three patients with non-small cell lung cancer were randomly selected, and serum exosome RNA was extracted according to the above method;

[0038] (2) The six isolated RNA samples were sequenced using the Arraystar Human LncRNA Array (Arraystar, Rockville, MD, United States);

[0039] (3) Based on the criteria of P value less than 0.05 and difference fold greater than 2, a volcano plot was drawn to screen out 146 up-regulated and 350 down-regulated long non-coding RNAs ( Figure 1 );

[0040] (4) The top 45 most significantly upregulated long noncoding RNAs were selected and further validated in serum exosomes from 10 patients with non-small cell lung cancer;

[0041] (5) Figure 2 As shown in the figure, lncRNA AL139294.1 has the smallest Ct value compared to the other 44 long noncoding RNAs. Therefore, lncRNA AL139294.1 was selected as the target RNA to detect the level of lncRNA AL139294.1 in serum exosomes from healthy individuals, pneumonia patients, and non-small cell lung cancer patients.

[0042] 5. Reverse transcription reaction

[0043] (1) Using the TOYOBO reverse transcription kit (ReverTra Ace qPCR RT Master Mix with gDNA Remover, FSQ-301), add 8.8 μL of gDNA nucleic acid remover to 4×DN Master Mix (440 μL) and mix thoroughly by inversion.

[0044] (2) Take 5 μl of RNA template and place it in a 0.2 ml enzyme-free EP tube, heat denature at 65°C for 5 min, and immediately cool to 4°C;

[0045] (3) Prepare the following reaction solution on ice: 4 μl RNA template, 2 μl 4×DN Master Mix, and 2 μl DEPC water. Mix the reaction solution thoroughly, incubate at 37°C for 5 min, and cool to 4°C.

[0046] (4) Prepare the following reaction solution on ice: 8 μl of the total reaction solution in step 3, 2 μl of 5×RT Master Mix II, and 10 μl of DEPC water. Mix the reaction solution thoroughly and place it in a PCR instrument for reverse transcription. The specific reaction system is as follows: 37°C for 15 min, 50°C for 5 min, 98°C for 5 min, and then cool at 4°C. The PCR product is stored in a -20°C refrigerator.

[0047] 6. Fluorescence quantitative PCR reaction

[0048] (1) Based on the lncRNA AL139294.1 gene in serum exosomes, its upstream and downstream amplification primers were designed. The specific nucleotide sequence of the exosomal lncRNA AL139294.1 gene is shown in SEQ ID NO.1: ACCCCATCCCCTTCATACACACCTCATTCCAAATGCTATCCTGTCACAGCAGATGCCACATCACTTTTGGGGTGGGCTAAGAGATCAAGGACATATGCCGTGCCCAAATTTCATCTAATAATTAAAAATACGGGAAGTGACACAAAAGGGAAAACACAGGATGCTCTGGAAACTTGTTATAGGCAGCGAGTGGGAAGGAGACCTAGAGTCAGAGGAAGCTACTACTGGAAAGAGGAGCAGAACTGAGCCAGGC AAATAGGAGAGAAAATGTATTTCAGGCAGAAGAAACAGCACTCTGGAAACCCCAACATCTAGCCTTTGAGAATGTAAAATGAAGCCAGGATGACACTACCAATTCCAAGCTGTGTGTGTGTGCATGCATGT GCATGTATGTGTATATATATTAGATGTATATTTTAACATTCTGACTTAACATTAATATTAACATATTAATATTTATTTATTGAAATATTTAACGTGTATTTTAATATTAAATTCTGGATTTCCAAACCA;

[0049] The nucleotide sequences of the upstream amplification primers were as follows: 5′-TGTCACAGCAGATGCCACAT-3′;

[0050] The nucleotide sequences of the downstream amplification primers were as follows: 5′-CCCACTCGCTGCCTATAACA-3′;

[0051] (2) Fluorescence quantitative PCR (RT-qPCR) was used to detect the relative expression of lncRNA AL139294.1 in exosomes. The reaction system was as follows: 5 μl of SYBR Green, 1 μl of cDNA template, 0.5 μl of 10 μM upstream primer, 0.5 μl of 10 μM downstream primer, and ddH2O was added to 10 μl. A 96-well plate was added with the above reagents, and the plate was sealed with a 96-well film and placed in a centrifuge for instant centrifugation. The plate was then placed in a fluorescence quantitative PCR instrument for reaction. The specific reaction system was as follows: 95°C for 10 min; 95°C for 15 s, 60°C for 30 s, 72°C for 30 s, 40 cycles; 95°C for 15 s, 60°C for 1 min, and 95°C for 30 s.

[0052] 7. Calculation of the relative expression of lncRNA AL139294.1 in different sample types. This paper uses internal reference genes as the standard for relative quantification, using GAPDH as the internal reference gene. The target lncRNA AL139294.1 is normalized and the relative expression of the target lncRNA AL139294.1 in different samples is detected by fluorescence quantitative PCR. The formula for the expression fold change is:

[0053] △Ct=Ct(lncRNA AL139294.1)-Ct(GAPDH);

[0054] 2 -△Ct =2 -(Ct(lncRNA AL139294.1)-Ct(GAPDH)) ,

[0055] 2 of them -△Ct Represents relative expression level, 2 -△Ct Higher values ​​indicate higher expression of lncRNA AL139294.1 in exosomes. Ct(lncRNA AL139294.1) and Ct(GAPDH) represent the Ct values ​​of the target lncRNA AL139294.1 and the internal reference gene GAPDH, respectively, detected by fluorescence quantitative analysis. A negative control group was set up in the quantitative experiment, and each sample was analyzed in triplicate. DEPC water was used in the negative control instead of the sample cDNA template. Contamination was determined based on the amplification results of the negative control wells.

[0056] 8. Results Analysis

[0057] SPSS 22.0 software was used to perform statistics and analysis of the data. ANOVA and Tukey's HSD test were used to compare the levels of exosomal lncRNA AL139294.1 between different groups (healthy group, pneumonia group, and non-small cell lung cancer group). RT-qPCR was used to detect the expression of lncRNA AL139294.1 in serum exosomes of patients with non-small cell lung cancer. It was found that the expression of lncRNA AL139294.1 in serum exosomes of patients with non-small cell lung cancer was significantly higher than that in the healthy control group and pneumonia group (P values ​​were all less than 0.01, see Figure 3 At the same time, the expression of lncRNA AL139294.1 in serum exosomes of pneumonia patients was higher than that in healthy controls (P value less than 0.05, see Figure 3 In order to evaluate the diagnostic efficacy of lncRNA AL139294.1 as a biomarker for non-small cell lung cancer, the inventors further used the receiver operating characteristic curve to analyze the sensitivity and specificity of lncRNA AL139294.1 in distinguishing healthy people from patients with non-small cell lung cancer. The area under the receiver operating characteristic curve was 0.915 ( Figure 4 ). This suggests that detecting the relative expression of exosomal lncRNA AL139294.1 has high value in the diagnosis of non-small cell lung cancer. Subsequently, we analyzed the relationship between lncRNA AL139294.1 in exosomes and clinical pathological parameters of patients with non-small cell lung cancer and found that high levels of lncRNA AL139294.1 were closely associated with lymph node metastasis (N1-3), distant metastasis (M1) and advanced stage of non-small cell lung cancer (Ⅲ-Ⅳ). Figure 5 ).

[0058] This invention detects the relative expression of lncRNA AL139294.1 in serum exosomes of non-small cell lung cancer, combines statistical principles and modern biological techniques, and provides a detection method with simple operation, high sensitivity, strong specificity, short cycle and stable results, providing a scientific basis for the screening and diagnosis of patients with non-small cell lung cancer.

[0059] The above description is not intended to limit the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by persons of ordinary skill in the art within the spirit and scope of the present invention shall also fall within the scope of protection of the present invention.

Claims

1. A reagent for detecting long non-coding RNA in serum exosomes for use as a reagent for preparing a diagnostic marker for non-small cell lung cancer, characterized in that: The long non-coding RNA is the AL139294.1 gene, and the nucleotide sequence of the AL139294.1 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The application of the non-small cell lung cancer diagnostic marker in the preparation of a non-small cell lung cancer diagnostic kit.

3. The use according to claim 2, characterized in that: The non-small cell lung cancer diagnostic kit includes a pair of specific amplification primers for detecting the expression level of lncRNA AL139294.1 gene in serum exosomes. The specific nucleotide sequences are as follows: upstream amplification primer: 5'-TGTCACAGCAGATGCCACAT-3'; downstream amplification primer: 5'-CCCACTCGCTGCCTATAACA-3'.

4. The use according to claim 3, characterized in that: The diagnostic kit also includes a fluorescent quantitative PCR reaction system, which consists of: 5 μl of SYBR Green, 1 μl of cDNA template, 0.5 μl of upstream primer at a concentration of 10 μM, 0.5 μl of downstream primer at a concentration of 10 μM, and ddH2O added to 10 μl. The fluorescent quantitative PCR reaction conditions are as follows: 95°C for 10 minutes; 95°C for 15 seconds, 60°C for 30 seconds, 72°C for 30 seconds, 40 cycles; 95°C for 15 seconds, 60°C for 1 minute, and 95°C for 30 seconds.

Images