A novel coronavirus vaccine for promoting specific igA antibody secretion and construction method and application thereof

By introducing the IL-5 adjuvant protein into the SARS-CoV-2 S protein, a novel vaccine was constructed to enhance mucosal IgA antibody levels, addressing the problem of insufficient mucosal immune response in the face of viral mutations in existing vaccines and achieving a stronger defensive effect.

CN116903754BActive Publication Date: 2026-07-07NORTHWESTERN POLYTECHNICAL UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NORTHWESTERN POLYTECHNICAL UNIV
Filing Date
2023-06-26
Publication Date
2026-07-07

AI Technical Summary

Technical Problem

Current COVID-19 vaccines are unable to effectively stimulate mucosal immune responses when faced with viral mutations, leading to reinfection after vaccination and a lack of potent protection.

Method used

By introducing IL-5 as an adjuvant protein into the SARS-CoV-2 S protein, a novel adjuvant protein-modified vaccine is formed, which stimulates the immune system to produce specific IgA antibodies and enhances the defense capabilities of the respiratory mucosa.

Benefits of technology

It significantly increased the level of mucosal IgA antibodies in the body after vaccination, enhanced the body's defense against the novel coronavirus, and improved the problem of insufficient mucosal immune response.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116903754B_ABST
    Figure CN116903754B_ABST
Patent Text Reader

Abstract

The application discloses a novel coronavirus vaccine for promoting specific IgA antibody secretion and a construction method and application thereof, belongs to the field of immunology and the field of genetic engineering, and is an immunogen developed by taking S protein as the vaccine (the same is true for other structural proteins of the novel coronavirus, such as N protein or E protein or M protein), aims to improve the mucosal IgA expression level after immunization of the vaccine, and constructs a novel coronavirus vaccine which can significantly promote human B lymphocytes to secrete specific anti-S protein IgA antibodies in the process of stimulating the immune response of the body by the S protein, and further enhance the mucosal protection and defense function, and provides a construction technology, method and application thereof. By introducing a specific protein domain, IL-5 (referred to as 'adjuvant protein'), into the S protein of the novel coronavirus, a novel coronavirus vaccine modified by the 'adjuvant protein' is formed.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of immunology and genetic engineering, and specifically relates to a COVID-19 vaccine that promotes the secretion of specific IgA antibodies, its construction method, and its application. Background Technology

[0002] COVID-19, caused by the novel coronavirus (SARS-CoV-2), poses a significant threat to human health and public health security, presenting humanity with an extremely severe challenge. The novel coronavirus is an enveloped, single-stranded, positive-sense RNA virus with a genome of 29,903 bases, encoding approximately 9,860 amino acids. Its structural proteins include the spike protein (S), envelope protein (E), membrane protein (M), and nucleocapsid protein (N), with structural protein genes accounting for one-third of the entire genome's open reading frames. Among these, the S protein mediates viral recognition of host cell receptors, promotes membrane fusion, and induces an immune response to produce neutralizing antibodies. The S protein contains two subunits, S1 and S2. When the virus infects a cell, the receptor-binding domain (RBD) on the S1 subunit binds to the angiotensin-converting enzyme (ACE2) receptor on the cell membrane. This is the region where the neutralizing antigen epitope of the novel coronavirus is located, mediating the virus's recognition of the host cell. Therefore, it is also the main target for the development of vaccines against the novel coronavirus. The S2 subunit mediates the membrane fusion between the virus and the host cell.

[0003] The global outbreak of COVID-19 has posed enormous challenges to human health and the socio-economic landscape, and vaccination is the primary means of effectively controlling the pandemic. Currently, the main COVID-19 vaccines administered globally include inactivated vaccines, mRNA vaccines, recombinant subunit vaccines, and adenovirus vector vaccines. These vaccines have, to some extent, suppressed the spread and pathogenicity of the virus. However, with the fluctuating nature of the pandemic in different regions, it has become apparent that many vaccinated individuals can still be reinfected with the virus, leading to a sharp decline in public expectations for vaccines. Analysis of the reasons for the lack of potent protection after vaccination generally suggests that it is mainly due to viral mutations, particularly changes in key antigenic sites caused by mutations in the RBD region, making it impossible for existing antibodies to recognize the mutated RBD region. While mutation factors have some theoretical and practical basis, most studies have also confirmed that antibodies targeting the pre-mutated RBD can still recognize and neutralize most of the mutated RBD. Therefore, the occurrence of reinfection after vaccination cannot be entirely attributed to viral mutations.

[0004] The mucosal system, especially the respiratory mucosa, is the gateway for the novel coronavirus to invade the body. With in-depth research into the pathogenic biology of the novel coronavirus, research on vaccine protective effects has once again focused on the correlation between vaccine immune effects and respiratory mucosal immune responses. The level of mucosal immune response stimulated by the body's immune system is a crucial factor determining its protective efficacy and whether it can prevent reinfection. In other words, the level of mucosal IgA secretion stimulated by the vaccine is a key factor in whether the vaccine can prevent reinfection. Therefore, vaccine development based on increasing IgA levels is a significant breakthrough in the research of novel COVID-19 vaccines. Summary of the Invention

[0005] To address the aforementioned problems, this invention uses the S protein as the immunogen for vaccine development (the same applies to other structural proteins of the novel coronavirus, such as the N, E, or M proteins). With the aim of increasing mucosal IgA expression levels after vaccine immunization, a novel novel COVID-19 vaccine has been constructed that significantly promotes the secretion of specific anti-S protein IgA antibodies by human B lymphocytes during the S protein-stimulated immune response, thereby enhancing mucosal protection and defense. The invention also provides its construction technology, methods, and applications. By introducing a specific cluster of protein domains—IL-5 (referred to as the 'adjuvant protein')—into the S protein of the novel coronavirus, a novel COVID-19 vaccine modified with the 'adjuvant protein' is formed. Its gene expression is shown in SEQ 5, with the full-length DNA sequence of signal peptide gene—adjuvant protein gene—connector gene—S protein gene.

[0006] Modification of the S protein by the 'adjuvant protein' includes: direct or chemical coupling of the adjuvant protein to the S protein in vitro or coupling through a third-party material; recombinant expression after fusion of the adjuvant protein gene and the S protein gene; direct mixing of adjuvant protein and S protein solution; and mRNA vaccines prepared after fusion of the adjuvant protein gene and the S protein gene.

[0007] The beneficial effects of this invention are:

[0008] The adjuvant protein-modified S protein described above is the novel COVID-19 vaccine of this invention. After vaccination, this vaccine can stimulate the immune system to produce specific anti-S protein antibodies, especially significantly stimulate the expression and secretion of specific IgA antibodies, thereby improving the body's respiratory mucosa's ability to resist the invasion of the COVID-19 virus and improving the shortcomings of some vaccines that have low mucosal immune response and can still be reinfected with the COVID-19 virus after vaccination. Attached Figure Description

[0009] Figure 1 The DNA is the full-length 'signal peptide gene-adjuvant protein (IL-5) gene-connector gene-RBD protein gene' DNA from Example 1.

[0010] Figure 2The results show the IgA levels in mice immunized with the fusion protein in Example 1.

[0011] Figure 3 The results show the IgA level measurement of mice immunized with the coupled protein in Example 2.

[0012] Figure 4 The results show the IgA level measurement of mice immunized with the mixed protein in Example 3.

[0013] Wherein, ** indicates P<0.01 (significant statistical difference), *** indicates P<0.001 (extremely significant statistical difference), **** indicates P<0.0001 (extremely significant statistical difference); ns indicates no significant statistical difference. Detailed Implementation

[0014] To enable those skilled in the art to better understand the technical solutions of the present invention, the technical solutions of the present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0015] Example 1

[0016] Based on the gene sequences of the S protein RBD (receptor-binding domain) and adjuvant protein (IL-5) in the COVID-19 vaccine, a whole-genome synthesis method was used to synthesize... Figure 1 The DNA shown.

[0017] The signal peptide used was the human IL-5 signal peptide (SEQ1). This signal peptide is not limited to the sequence listed in SEQ1, but also includes all commonly used signal peptides. The adjuvant protein (IL-5) gene was the DNA corresponding to 115 amino acids (SEQ2). The linker gene was the base sequence corresponding to six consecutive glycine residues (SEQ3). The RBD protein was a domain containing a neutralizing epitope in the SARS-CoV-2 S protein (SEQ4). The synthesized full-length DNA of the 'signal peptide gene-IL-5 gene-linker gene-RBD gene' (SEQ5) was cloned into the PCDNA3.1 eukaryotic expression vector and subsequently transfected into 293T cells. The RBD control was a 'signal peptide gene-RBD gene' cloned into the PCDNA3.1 eukaryotic expression vector, which was transfected into 293T cells using the same method.

[0018] After transfecting 293T cells with the above expression vector, the cell supernatant was harvested, and the expressed protein was purified by nickel column chromatography. After identification by ELISA and Western blotting, it was used for mouse immunization. Group A mice were immunized with IL-5-RBD protein expressed by the 'signal peptide gene-adjuvant protein gene-connector gene-RBD protein gene', with each mouse receiving an intraperitoneal injection of 30 μg. Group B mice were immunized with RBD protein expressed by the 'signal peptide gene-RBD protein gene', with each mouse receiving an intraperitoneal injection of 21.8 μg of supernatant (calculated based on the same molar protein amount as the experimental group). Immunization was performed 10 days apart, for a total of 4 immunizations. Two weeks after the fourth immunization, blood was collected from the tail vein of the mice, and the total IgA concentration and anti-RBD specific IgA concentration were detected by ELISA. Lung lavage fluid from the mice was collected, and the anti-RBD sIgA concentration was detected by ELISA.

[0019] Experimental results are as follows Figure 2 As shown, the levels of total IgA and specific IgA in the serum and sIgA of the lung lavage fluid of mice immunized with the fusion protein were significantly higher than those in the control group, with statistically significant differences.

[0020] Example 2

[0021] The RBD protein and adjuvant protein were biotinylated separately, and two groups were set up with a molar ratio of adjuvant protein to RBD protein of 1:1 and 1:3. Based on the principle that one molecule of avidin can bind to four molecules of biotin, the corresponding streptavidin was calculated and added. The mixture was incubated at 37°C for 1 hour to construct the conjugated protein. After identification by ELISA, it was used for mouse immunization.

[0022] Group A mice were immunized with the constructed IL-5-RBD conjugate protein, with 30 μg injected intraperitoneally into each of the four mice. Group B mice were immunized with the RBD protein alone, with 21.8 μg of the supernatant injected intraperitoneally into each of the four mice (calculated based on the same molar protein amount as the experimental group). Immunizations were performed 10 days apart, for a total of four immunizations. Two weeks after the fourth immunization, blood was collected from the tail vein of the mice, and the total IgA concentration and anti-RBD specific IgA concentration were detected by ELISA. Lung lavage fluid from the mice was collected, and the anti-RBD sIgA concentration was detected by ELISA.

[0023] The experimental results are shown in the figure below. Compared with the control group, the levels of total IgA and specific IgA in the serum IgA and sIgA in the bronchoalveolar lavage fluid of mice immunized with the conjugated protein were significantly increased, showing statistically significant differences. According to the molar ratio of IL-5 to S-RBD conjugation, the 1:1 group showed better activation of the immune response than the 1:3 group, providing a theoretical basis for the fusion of equicopy gene of fusion protein.

[0024] Example 3

[0025] RBD protein solution and adjuvant protein solution were mixed in equimolar amounts in vitro for mouse immunization. Group A mice were immunized with the mixed protein solution; each mouse received an intraperitoneal injection of 30 μg. Group B mice were immunized with RBD protein alone; each mouse received an intraperitoneal injection of 21.8 μg of the supernatant (calculated based on the equimolar protein amount of the experimental group). Immunization was performed 10 days apart, for a total of 4 immunizations. Two weeks after the fourth immunization, blood was collected from the tail vein of the mice, and the total IgA concentration and anti-RBD specific IgA concentration were detected by ELISA. Lung lavage fluid from the mice was collected, and the anti-RBD sIgA concentration was detected by ELISA.

[0026] The experimental results are shown in the figure below. Compared with the control group, the levels of total IgA and specific IgA in the serum IgA and sIgA in the bronchoalveolar lavage fluid of mice immunized with the mixed protein were not significantly different. The results indicate that if only the two proteins are mixed and injected, their ability to increase the body's IgA antibody level is limited and the immune effect is weak.

[0027] The results clearly show that the fusion or conjugation of adjuvant protein (IL-5) with RBD protein can significantly increase the expression level of SARS-CoV-2 S-RBD protein-specific IgA antibody in the body's immune system, and can also increase the level of secretory IgA in the respiratory mucosa (lung lavage fluid). However, simply mixing and injecting the two proteins cannot achieve the above effects.

[0028] All of the above-mentioned types of novel vaccines have certain immune effects. Among them, the recombinant fusion protein has the strongest immune efficacy. The level of anti-SARS-CoV-2 S protein IgA antibody in the serum of mice after immunization is 3-5 times higher than the level of IgA antibody in the serum of mice immunized with S protein alone, and the level of sIgA on the surface of tracheal mucosa is 5-15 times higher.

[0029] SEQ1: Signal peptide

[0030] ATGAGGATGCTTCTGCATTTGAGTTTGCTAGCTCTTGGAGCTGCCTACG TGTATGCC

[0031] SEQ2:IL-5

[0032] GAAATTCCCACAAGTGCATTGGTGAAAGAGACCTTGGCACTGCTTTCTACTCATCGAACTCTGCTGATAGCCAATGAGACTCTGAGGATTCCTGTTCCTGTACATAAAAATCACCAACTGTGCACTGAAGAAATCTTTCAGGGAATAGGCACACTGGAGAGTCAAACTGTGCAAGGGGGTACTGTGGAAAGACTATTCAAAAACTTGTCCTTAATAAAGAAATACATTGACGGCCAAAAAAAAAAGTGTGGAGAAGAAAGACGGAGAGTAAACCAATTCCTAGACTACCTGCAAGAGTTTCTTGGTGTAATGAACACC

[0033] SEQ3:LEFT

[0034] GGTGGATCTGGAGGTTCC

[0035] SEQ4: RBD

[0036] AGAGTCCAACCAACAGAATCTATTGTTAGATTTCCTAATATTACAAACTTGGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATT TTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTA CAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAAACAAATGTGTCAATTTC

[0037] SEQ5

[0038]

[0039] SEQ6:

[0040] IPTEIPTSALVKETLALLSTHRTLLIANETLRIPVPVHKNHQLCTEEIFQGIGTLESQTVQGGTVERLFKNLSLIKKYIDGQKKKCGEERRRVNQFLDYLQEFLGVMNTEWIIES

[0041] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of the present invention is defined by the appended claims and their equivalents.

Claims

1. A COVID-19 vaccine that promotes the secretion of specific IgA antibodies, characterized in that, The vaccine in question refers to the introduction of a cluster of specific protein domains, namely adjuvant proteins, into the S protein of the novel coronavirus. The gene of the vaccine is a signal peptide gene-adjuvant protein gene-linker gene-S protein gene, and its full-length DNA is shown in SEQ ID NO:

5.

2. The COVID-19 vaccine that promotes the secretion of specific IgA antibodies according to claim 1, characterized in that, The amino acid sequence of the adjuvant protein is shown in SEQ ID NO:

6.

3. The COVID-19 vaccine that promotes the secretion of specific IgA antibodies according to claim 1, characterized in that, The signal peptide gene, adjuvant protein gene, linker gene, and S protein gene are constructed into an mRNA vaccine or a eukaryotic expression vector to express the fusion protein vaccine.

4. The COVID-19 vaccine that promotes the secretion of specific IgA antibodies according to claim 1, characterized in that, The SARS-CoV-2 S protein that makes up the vaccine is the S1-RBD of the S protein.

Citation Information

Patent Citations

  • Novel COVID-19 subunit vaccine and construction method thereof

    CN113336857A