Use of deoxycholic acid in the preparation of a medicament or additive for protection against viral infection in aquatic animals

Abstract

The application discloses application of deoxycholic acid in preparation of a medicine or additive for resisting aquatic virus infection, wherein the aquatic virus is a spring viremia of carp virus and / or infectious hematopoietic necrosis virus. Experimental data show that the deoxycholic acid can significantly inhibit the proliferation of the spring viremia of carp virus and the infectious hematopoietic necrosis virus in vivo and in vitro, and effectively improve the survival rate of fish after being infected with the two viruses, so that the deoxycholic acid can be developed as a medicine and a feed additive for preventing and controlling viruses in the field of aquaculture, and has important significance for preventing and controlling aquatic viruses.

Description

Technical Field

[0001] This invention belongs to the field of aquaculture technology, specifically relating to the application of deoxycholic acid in the preparation of drugs or feed additives for the treatment or prevention of aquatic virus infections (especially carp spring viremia virus or infectious hematopoietic necrosis virus). Background Technology

[0002] Spring viremia of carp (SVC) is an acute, highly lethal infectious disease caused by spring viremia virus (SVCV). It is listed as a mandatory disease by the World Organisation for Animal Health (OIE) and is also classified as a Class II animal disease by the Ministry of Agriculture and Rural Affairs of my country. The main pathological symptoms in infected fish include hemorrhage in the liver, spleen, and kidneys, severe peritonitis, and hemorrhagic enteritis. Approximately 10 hatcheries nationwide test positive for SVCV each year. Among the positive samples monitored, carp accounted for 70.7%, koi 12.0%, goldfish 8.0%, crucian carp 5.2%, grass carp 1.8%, silver carp 1.4%, bighead carp 0.2%, and other species 0.7%.

[0003] Infectious hematopoietic necrosis disease (IHN) is a viral disease caused by the infectious hematopoietic necrosis virus (IHNV), resulting in a high mortality rate, sometimes reaching 100%, in juvenile salmon. Infected fish exhibit symptoms such as spiral swimming, trailing feces, blackened skin, bulging eyes, abdominal distension, and external hemorrhage. In surviving fish, spinal deformities may become more pronounced. The World Health Organization classifies this disease as a reportable animal disease, and my country classifies it as a Class II disease. The disease first broke out in the United States in the 1950s, entered China in the 1980s, and is now widespread in many countries worldwide, causing significant economic losses and posing a serious threat to salmon and trout farming.

[0004] Bile acids are a major component of bile and play an important role in animal fat metabolism. As a feed additive, the effects of bile acids have been gradually discovered, and their application is becoming increasingly widespread. Currently, mixed bile acids are widely used in aquatic feeds. Due to their complex and diverse composition, the specific active components within mixed bile acids are difficult to determine. Bile acids can be classified into primary and secondary bile acids based on their source. Primary bile acids, including cholic acid (CA) and chenodeoxycholic acid (CDCA), can only be synthesized by the host liver. Secondary bile acids are generated by intestinal microorganisms through hydrolysis and dehydroxylation of primary bile acids excreted from the host liver, including deoxycholic acid (DCA), lithocholic acid (LCA), and ursodeoxycholic acid (UDCA). Deoxycholic acid is a free secondary bile acid produced by the action of bile acid hydrolases and 7α-dehydroxylases on primary bile acids (CA) under the action of anaerobic bacteria. Deoxycholic acid (DOA) differs in structure and function from primary bile acids (CA, CDCA, etc.) and other secondary bile acids (LCA, UDCA, etc.). It is a free bile acid derived by losing an oxygen atom at the C-7 position of a bile acid. DOA promotes bile secretion, aids in food digestion and absorption, and eliminates cholestasis, and has been successfully used in the treatment of biliary tract diseases and lipomas. However, research on the effects of DOA on viral infections in fish has not yet been reported. Summary of the Invention

[0005] The inventors have discovered for the first time that deoxycholic acid can significantly inhibit the replication of certain aquatic viruses in and outside fish, and significantly improve the survival rate of fish infected with aquatic viruses. The structural formula of deoxycholic acid is shown below:

[0006]

[0007] Therefore, the purpose of this invention is to provide the application of deoxycholic acid in the preparation of drugs or feed additives for the treatment of aquatic viral infections.

[0008] Specifically, in the above applications, the aquatic viruses are carp spring viremia virus (SVCV) and / or infectious hematopoietic necrosis virus (IHNV).

[0009] Experimental data show that deoxycholic acid can significantly inhibit the proliferation of SVCV and IHNV viruses in fish both in vivo and in vitro, and significantly improve the survival rate of fish infected with the virus.

[0010] Further experimental data showed that deoxycholic acid significantly improved survival rates by reducing viral load in the organs of fish infected with the virus and alleviating pathological damage to the organs, including the liver, intestines, and kidneys.

[0011] In the above applications, the drug or feed additive is a preparation made by adding excipients to deoxycholic acid as the active ingredient. The preparation can be a liquid or a solid formulation, specifically a powder, granules, or tablets.

[0012] In the above applications, the drug can be administered orally or mixed with feed to deliver an effective dose to the individual.

[0013] The beneficial effects of the present invention: The experimental data of the present invention show that deoxycholic acid can significantly inhibit the proliferation of carp spring viremia virus and infectious hematopoietic necrosis virus at in vivo and in vitro levels, and effectively improve the survival rate of fish infected with the two viruses. Therefore, deoxycholic acid can be developed as a drug and feed additive for virus prevention and control in the aquatic field, which is of great significance for the prevention and control of aquatic viruses (especially SVCV and IHNV). Attached Figure Description

[0014] Figure 1 The results of testing different concentrations of deoxycholic acid on the cytotoxicity of EPC cells;

[0015] Figure 2 To investigate the inhibitory effect of different concentrations of deoxycholic acid on SVCV-G gene expression levels in EPC cells;

[0016] Figure 3 To investigate the inhibitory effect of different concentrations of deoxycholic acid on SVCV-G protein expression in EPC cells;

[0017] Figure 4 To investigate the inhibitory effect of different concentrations of deoxycholic acid on SVCV virus particle formation;

[0018] Figure 5 To investigate the protective effect of deoxycholic acid against SVCV infection in zebrafish;

[0019] Figure 6 The inhibitory effect of deoxycholic acid on IHNV in EPC cells;

[0020] Figure 7 To investigate the protective effect of deoxycholic acid against IHNV infection in rainbow trout. Detailed Implementation

[0021] To make the technical problems, technical solutions, and beneficial effects of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. Obviously, the described embodiments are only some embodiments of this invention, and not all embodiments.

[0022] Unless otherwise specified, the methods described in the following examples are conventional; the reagents and materials described are commercially available unless otherwise specified.

[0023] Example 1: Inhibitory effect of deoxycholic acid on SVCV

[0024] Deoxycholic acid can effectively inhibit the proliferation of SVCV, as illustrated in the following experiments.

[0025] (1) Experiment on the toxicity of deoxycholic acid to cells.

[0026] This example uses the MTT assay to detect the toxicity of deoxycholic acid. The specific method is as follows:

[0027] Collect carp epithelioma cells (Epithelioma Papulosum Cyprini, EPC) in the logarithmic growth phase, adjust the cell suspension concentration, and add them to 96-well plates. Add 200 μL of culture medium to each well, maintaining a cell density of 1000-5000 cells / well. Fill the edge wells with sterile PBS. Incubate at 28°C with 5% CO2 until the cells adhere (approximately 6-8 hours). Then, add deoxycholic acid in gradients, with 6 replicates per gradient. Continue incubation for 48 hours, observing cell status under an inverted microscope. Add 20 μL of LTT solution (5 mg / ml, i.e., 0.5% MTT) to each well and continue incubation for 4 hours. Then, terminate the culture and carefully aspirate the culture medium from the wells. Add 150 μL of dimethyl sulfoxide to each well and place on a decolorizing shaker with low speed for 10 minutes to fully dissolve the crystals. Measure the absorbance of each well at OD490 nm using an ELISA reader and calculate the cell viability.

[0028] This experiment also included zeroing wells (culture medium, MTT, dimethyl sulfoxide) and control wells (cells, solvent of the corresponding concentration, culture medium, MTT, dimethyl sulfoxide).

[0029] The results are as follows Figure 1 As shown, the cell viability of EPC cells treated with various concentrations of deoxycholic acid for 48 hours did not change significantly compared with the control group, indicating that the concentrations of deoxycholic acid used had no toxic effect on EPC cells.

[0030] (2) Deoxycholic acid inhibits SVCV-G gene expression.

[0031] SVCV encodes five structural proteins: nucleoprotein (N), phosphoprotein (P), membrane protein (M), glycoprotein (G), and RNA-dependent RNA polymerase (L-protein). The glycoprotein encoded by the G gene is an SVCV membrane protein, associated with SVCV virulence, and often used as a target for viral load detection. This example investigated the effect of different concentrations on SVCV-G gene expression levels. The specific procedure is as follows:

[0032] EPC cells were seeded into 12-well plates. After reaching 70-80% confluence, the culture medium was discarded, and complete culture medium containing 50 μM, 20 μM, 10 μM, 5 μM, and 1 μM deoxycholic acid and PBS was added for pretreatment for 12 h. The culture medium was then discarded, and cells were adsorbed with 1 mL of 0.1 MOI SVCV. The cells were incubated at 28°C for 1 h, and free viruses were washed away. Complete culture medium containing the corresponding concentrations of deoxycholic acid and PBS was added again, and the cells were incubated at 28°C in a 5% CO2 incubator for another 24 h (three independent replicates were set up for each concentration treatment). After 24 h, total RNA was extracted from the cells, and the expression level of the SVCV-G gene was detected by reverse transcription and quantitative real-time fluorescence detection. The primer pair sequence for quantitative detection of the SVCV-G gene was CGACCTGGATTAGACTTG / AATGTTCCGTTTCTCACT (SEQ ID NO.1 / SEQ ID NO.2).

[0033] The results are as follows Figure 2 As shown, compared with the control group, the expression of the SVCV-G gene was significantly reduced when the concentration of deoxycholic acid was 1 μM (P < 0.01), a decrease of 30.19% compared with the control group; the gene expression was extremely significantly reduced when the concentrations of deoxycholic acid were 5 μM and 10 μM (P < 0.001), downregulated by 49.18% and 50.69% respectively compared with the control group; the gene expression was extremely significantly reduced when the concentrations of deoxycholic acid were 20 μM and 50 μM (P < 0.0001), downregulated by 68% and 91.99% respectively compared with the control group. This indicates that deoxycholic acid can inhibit the expression level of the SVCV-G gene in a concentration-dependent manner.

[0034] (3) Deoxycholic acid inhibits SVCV-G protein expression.

[0035] This example further examines the expression level of SVCV-G protein under the action of deoxycholic acid, using the following method:

[0036] EPC cells were seeded into 12-well plates. After reaching 70-80% confluence, the culture medium was aspirated, and complete culture medium containing 50 μM, 20 μM, 10 μM, 5 μM, and 1 μM deoxycholic acid and PBS was added for pretreatment for 12 h. The culture medium was then aspirated, and cells were adsorbed with 1 mL of 0.1 MOI SVCV. The cells were incubated at 28°C for 1 h, and free viruses were washed away. Complete culture medium containing the corresponding concentrations of deoxycholic acid and PBS was added again, and the cells were incubated at 28°C in a 5% CO2 incubator for another 24 h (three independent replicates were set up for each concentration treatment). After 24 h, the cell samples were blown off with pre-cooled PBS, centrifuged at 2500g for 10 min, the supernatant was discarded, and the cells were resuspended in 32 μL of PBS. 8 μL of SDS was added, and the cells were boiled in water for 10 min. After adding the samples, electrophoresis was performed at 80V, 300mA, and 300W for 2 h. After transfer, antibody incubation was performed, followed by the addition of anti-SVCV-G or actin primary antibody, and secondary antibody diluted 1:5000 with 5% BSA (prepared with 1×TBST). Finally, the Thermo ECL colorimetric kit was used for color development, with the exposure time adjusted appropriately.

[0037] The results are as follows Figure 3 As shown, compared with the control group, the expression level of SVCV G protein decreased sequentially with the increase of deoxycholic acid concentration, indicating that deoxycholic acid inhibits SVCV protein expression in a dose-dependent manner.

[0038] (4) Deoxycholic acid inhibits the formation of SVCV virus.

[0039] EPC cells were seeded into 12-well plates. After reaching 70-80% confluence, the culture medium was aspirated, and complete culture medium containing 50 μM, 20 μM, 10 μM, 5 μM, and 1 μM deoxycholic acid and PBS was added for pretreatment for 12 h. The culture medium was then aspirated, and cells were adsorbed with 1 mL of 0.1 MOI SVCV. The cells were incubated at 28°C for 1 h, and free viruses were washed away. Complete culture medium containing the corresponding concentrations of deoxycholic acid and PBS was added, and the cells were incubated at 28°C in a 5% CO2 incubator for another 24 h (three independent replicates were set up for each concentration treatment).

[0040] After 24 hours, cell supernatant was collected for plaque assay. The specific steps are as follows: EPC cells were seeded into 24-well plates and allowed to grow to 100% confluence for viral infection; cells were washed twice with serum-free medium, and the virus was serially diluted 10-fold, with 500 μL of virus solution added to each well, and each concentration was repeated three times; cells were incubated at 28°C for 1 hour; cells were washed once with serum-free medium and 1 mL of DMEM-CMC semi-solid medium was added; cells were incubated at 28°C for 48-60 hours until visible plaques were formed, at which point the medium was discarded; cells were fixed with 10% formaldehyde for 12 hours; the solid medium was discarded and the cells were rinsed with tap water; cells were stained with crystal violet for 3 hours; the staining solution was recovered, the cells were rinsed with tap water and air-dried; the number of plaques was counted and the virus titer was calculated.

[0041] The results are as follows Figure 4 As shown, the viral titer of SVCV in the control group was 10. 6.11 The viral titers of SVCV after treatment with PFU / mL, 1μM, 5μM, 10μM, and 20μM deoxycholic acid were 10, respectively. 5.81 PFU / mL, 10 5.18 PFU / mL, 10 4.96 PFU / mL, 10 4.4 When the concentration of deoxycholic acid reached 50 μM, SVCV could not be detected in the cell supernatant, indicating that deoxycholic acid can significantly inhibit the formation of SVCV virus particles.

[0042] Example 2: Protective effect of deoxycholic acid against SVCV infection in zebrafish

[0043] This example uses zebrafish to investigate the effect of deoxycholic acid administration on SVCV infection in fish. The method is as follows:

[0044] Adult zebrafish aged three months were purchased from the National Zebrafish Resource Center and acclimatized for two weeks at 28℃, fed with brine shrimp twice daily (morning and evening). After the acclimatization period, healthy, disease-free zebrafish of similar size and uniformity were selected. The selected zebrafish were then gradually cooled by 1℃ daily from 28℃ to 16℃ and maintained at 16℃ for subsequent experiments. Dissolved oxygen levels in the culture water were maintained at 6-14 mg / L using an air pump, and the pH was controlled at 6.8-7.8. The zebrafish were divided into a control group and a deoxycholic acid (DCA) supplementation group. In the DCA group, DCA was added to the brine shrimp at a dosage of 0.2 mg / fish, while the control group received the same volume of DMSO as a control. After 7 days of DCA feeding, 10 zebrafish were... 4 Inject PFU SVCV virus suspension along the base of the pelvic fin into infected zebrafish, and observe and record survival over 14 days.

[0045] See results Figure 5 A. The survival rate of zebrafish infected with SVCV was 23.33%, while the addition of deoxycholic acid significantly increased the survival rate of zebrafish infected with SVCV to 66.67%, indicating that deoxycholic acid can improve the survival rate of zebrafish infected with SVCV.

[0046] The liver, intestine, and kidney of zebrafish infected with SVCV for 5 days in the above experiment were collected, and total RNA was extracted. After reverse transcription, absolute quantification of SVCV-G was performed using fluorescence quantitative PCR. The primer sequence for quantifying the SVCV-G gene was TGCTGTGTTGCTTGCACTTATYT / TCAAACKAARGACCGCATTTCG (SEQ ID NO.3 / SEQ ID NO.4), and the probe sequence was FAM-ATGAAGARGAGTAAACKGCCTGCAACAGA-TAMRA (SEQ ID NO.5).

[0047] Figure 5 B showed that deoxycholic acid significantly reduced viral load in the liver, intestine, and kidney of zebrafish infected with SVCV.

[0048] Liver, intestine, and kidney of zebrafish uninfected with SVCV and zebrafish infected with SVCV for 5 days were fixed in 4% paraformaldehyde, then dehydrated, cleared, embedded in paraffin, sectioned, and stained with H&E to observe changes in the tissue structure of the organs.

[0049] Figure 5 C shows that all organs of zebrafish fed with deoxycholic acid were normal compared with those of the control group, with no difference, indicating that deoxycholic acid treatment is not toxic to zebrafish. Compared with the SVCV infection group, the pathological damage caused by the virus infection in various organs of zebrafish fed with deoxycholic acid was significantly reduced after SVCV infection, indicating that deoxycholic acid significantly reduced the pathogenicity of SVCV infection in zebrafish.

[0050] Example 3: Inhibitory effect of deoxycholic acid on IHNV

[0051] Deoxycholic acid can effectively inhibit the proliferation of SVCV, as verified in this case through the following experimental procedure:

[0052] EPC cells were seeded in 12-well plates. After reaching 70-80% confluence, the culture medium was aspirated, and complete culture medium containing 50 μM deoxycholic acid and PBS was added for pretreatment for 12 h. The culture medium was then aspirated, and cells were adsorbed with 1 mL of 0.1 MOI IHNV. The cells were incubated at 16°C for 1 h, and free viruses were washed away. Complete culture medium containing the corresponding concentrations of deoxycholic acid and PBS was added again, and the cells were incubated at 16°C in a 5% CO2 incubator for another 24 h (three independent replicates were set up for each treatment). After 24 h, total RNA was extracted from the cells, and the expression level of the IHNV-G gene was detected by reverse transcription and quantitative real-time fluorescence detection. The primer sequences used for quantitative detection of the IHNV-G gene were CACGGAAACAACACCACCATTA / AACAGCAAGGAGGAGAACAAGG (SEQ ID NO.6 / SEQ ID NO.7).

[0053] The results are as follows Figure 6 As shown, compared with the control group, treatment with 50 μM deoxycholic acid significantly reduced the viral load of IHNV (P<0.0001), indicating that deoxycholic acid can significantly inhibit the proliferation of IHNV at the cellular level.

[0054] Example 4: Protective effect of deoxycholic acid against IHNV infection in rainbow trout

[0055] This example uses rainbow trout to investigate the effect of deoxycholic acid administration on IHNV infection in fish. The method is as follows:

[0056] Rainbow trout measuring 6-7 cm were purchased from a fish farm in Meishan, Sichuan Province. They were acclimatized for two weeks at 16℃, fed twice daily (morning and evening). After the acclimatization period, healthy, disease-free rainbow trout of similar size and uniformity were selected and maintained at 16℃ for subsequent experiments. Dissolved oxygen levels in the aquaculture water were maintained at 6-14 mg / L using an air pump, and the pH was controlled at 6.8-7.8. The rainbow trout were divided into a control group and a deoxycholic acid (DCA) supplementation group. DCA was mixed evenly with the feed, and the feeding amount was determined to be 0.2 mg / fish for the DCA group. The control group received the same volume of DMSO as a control. After 7 days of DCA feeding, 10... 4 Rainbow trout were infected by injecting a suspension of IHNV virus from PFU along the base of the pelvic fin, and their survival was observed and recorded over 14 days.

[0057] See results Figure 7 A. The survival rate of rainbow trout infected with IHNV was 30%, while the addition of deoxycholic acid significantly increased the survival rate of rainbow trout infected with IHNV to 60%, indicating that deoxycholic acid can improve the survival rate of rainbow trout infected with IHNV.

[0058] Liver, intestine, and kidney of rainbow trout infected with IHNV for 5 days in the above experiment were collected, and total RNA was extracted. IHNV-G was then quantitatively detected using reverse transcription followed by quantitative real-time fluorescence assay (primer sequences were the same as in Example 3). Results are shown below. Figure 7 B showed that deoxycholic acid significantly reduced viral load in the intestines and kidneys of rainbow trout infected with IHNV.

[0059] Liver, intestine, and kidney of uninfected rainbow trout and rainbow trout infected with IHNV for 5 days were fixed in 4% paraformaldehyde, then dehydrated, cleared, paraffin-embedded, embedded, sectioned, and stained with H&E to observe changes in the tissue structure of the organs.

[0060] See results Figure 7 C shows that all organs of rainbow trout fed with deoxycholic acid were normal compared with those of the control group, with no difference, indicating that deoxycholic acid treatment is not toxic to rainbow trout. Compared with the IHNV infection group, deoxycholic acid-fed rainbow trout infected with IHNV showed that the pathological damage caused by viral infection in various organs was significantly reduced, indicating that deoxycholic acid significantly reduced the pathogenicity of IHNV infection in rainbow trout.

[0061] In conclusion, deoxycholic acid can effectively inhibit the proliferation of carp spring viremia virus and infectious hematopoietic necrosis virus. Furthermore, when deoxycholic acid is used as a feed additive in zebrafish and rainbow trout, it can effectively improve the survival rate of fish infected with SVCV and IHNV. Therefore, deoxycholic acid can be developed into a drug and feed additive for virus control in aquaculture, which is of great significance for the prevention and control of aquatic viruses.

[0062] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the present invention.

Claims

1. Use of deoxycholic acid in the preparation of a medicine or feed additive for resisting aquatic viral infection, wherein the aquatic virus is infectious hematopoietic necrosis virus.

2. Use according to claim 1, characterized in that, The deoxycholic acid inhibits virus proliferation and improves the survival rate of fish after infection with the virus.

3. Use according to claim 2, characterized in that, The deoxycholic acid reduces the viral load in the organs of fish after infection with the virus and alleviates the pathological damage of the organs.

4. Use according to claim 3, characterized in that, The organs include the liver, the intestinal tract and the kidney.

5. The use according to claim 1, characterized in that, The medicine or feed additive is a preparation prepared by adding excipients to deoxycholic acid as an effective component.

6. Use according to claim 5, characterized in that, The preparation includes liquid preparations, powders and granules.

7. Use according to claim 5, characterized in that, The medicine is administered orally or by feeding with feed.

8. Use according to claim 5, characterized in that, An effective amount of the medicine is administered to an individual.

Images