Phenoxy carboxylic acid herbicide-degrading p450 enzyme mutants and applications thereof

By site-directed mutagenesis of CYP152 peroxygenase P450BSβ, a mutant with high efficiency in degrading phenoxycarboxylic acid herbicides was obtained, solving the problem of low enzyme degradation efficiency in the existing technology and realizing the cultivation of highly efficient degradation and herbicide-resistant crops.

CN117363589BActive Publication Date: 2026-03-03SHANDONG UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202210763140.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-06-30
Publication Date
2026-03-03
Estimated Expiration
2042-06-30

AI Technical Summary

Technical Problem

In the current technology, plant-derived P450 enzymes with catalytic functions have not been identified, making it difficult to efficiently degrade phenoxycarboxylic acid herbicides, and there is a lack of effective genes for breeding transgenic crops resistant to phenoxycarboxylic acid herbicides.

Method used

The CYP152 peroxygenase P450BSβ was modified using site-directed mutagenesis to obtain mutants such as P450BSβ-F46A, P450BSβ-F79A, P450BSβ-F173A, P450BSβ-F289A, and P450BSβ-F292A, which improved its degradation ability against phenoxycarboxylic acid herbicides. These enzyme mutants were then expressed in Escherichia coli through genetic engineering.

Benefits of technology

It achieves highly efficient degradation of phenoxycarboxylic acid herbicides, with a catalytic efficiency up to 12.3 times that of the starting enzyme. The highest conversion number for degrading the herbicide 2,4-dichlorophenoxybutyric acid can reach 8779, making it suitable for breeding transgenic crops resistant to phenoxycarboxylic acid herbicides.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117363589B_ABST
    Figure CN117363589B_ABST
Patent Text Reader

Abstract

The application discloses a kind of P450 enzymes and mutants thereof degrading phenoxy carboxylic acid herbicides, the P450 enzyme is respectively named as P450 BSβ , OleT JE ;The P450 enzyme mutant is respectively named as P450 BSβ -F46A, P450 BSβ -F79A, P450 BSβ -F173A, P450 BSβ -F289A, P450 BSβ -F292A;Its amino acid sequence is respectively shown as SEQ ID NO.1-7.The application also discloses the application of the P450 enzyme and mutants thereof in degrading phenoxy carboxylic acid herbicides and related genes in cultivating transgenic crops resistant to phenoxy carboxylic acid herbicides.Experiments prove that the efficiency of the P450 enzyme mutant in degrading phenoxy carboxylic acid herbicides can be up to 12.3 times of P450 BSβ , and the total conversion number of catalyzing 2,4-dichlorophenoxybutyric acid can be up to 8779.The P450 enzyme mutant disclosed in the application has the advantages of high catalytic efficiency, high protein expression and low industrial cost, and the whole operation process of degrading herbicides is simple, the process is mature, the cost is low, and has wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of enzyme engineering, biocatalysis, biochemistry and molecular biology, and relates to a class of P450 enzymes that can degrade phenoxycarboxylic acid herbicides, their mutants and their application in degrading phenoxycarboxylic acid herbicides. Background Technology

[0002] Phenoxycarboxylic acid herbicides are organic selective carboxylic acid herbicides with substituents on the α-carbon. The substituents mainly include phenoxy and aryloxy groups, and the carboxylic acids mainly include acetic acid, propionic acid, and butyric acid. As an important class of herbicides, phenoxycarboxylic acid herbicides, since the discovery of their first variety, 2,4-dichlorophenoxyacetic acid (abbreviated as 2,4-D), have been widely used in agricultural and forestry weed control and broadleaf weed control in wheat, rice, and corn fields due to their advantages such as broad spectrum of weed control, rapid effect, and low price, thus promoting the development of chemical weed control.

[0003] However, while the large-scale use of herbicides has promoted agricultural production, it has also brought about significant environmental problems. The residues of these herbicides in the soil can adversely affect the normal growth of subsequent sensitive crops. Chemical hydrolysis and microbial degradation are currently the two main pathways for removing herbicide residues from the soil. Microbial degradation of herbicides is mainly accomplished through the metabolic action of enzymes produced by the microorganisms. Essentially an enzymatic reaction, it is a complex physiological and biochemical process requiring multiple reactions both intracellularly and extracellularly. Through synergistic action, the herbicide is completely degraded or degraded into smaller, less toxic molecules. The main types of microbial degradation of herbicides include: side-chain cleavage, ester bond hydrolysis, dehalogenation, aromatic oxidation, methylation, and ring cleavage. Among these, the decomposition of fatty acid side chains of phenoxycarboxylic acid herbicides to produce 2,4-dichlorophenol (2,4-DCP), which has significantly reduced toxicity, has been shown in some plants to be mediated by P450 enzymes. This degradation pathway is also considered a herbicide resistance mechanism in some plants. However, plant-derived P450 enzymes with this catalytic function have not yet been identified. Furthermore, the search for genes that can degrade or resist herbicides is also key to developing transgenic crops resistant to phenoxycarboxylic acid herbicides.

[0004] The applicant's research found that, if the multifunctional CYP152 peroxygenase P450, with its known crystal structure, high reactivity, and high catalytic efficiency, is selected... BSβ As a parental enzyme, site-directed mutagenesis was used to screen for highly efficient mutants capable of degrading phenoxycarboxylic acid herbicides. This holds promise for achieving the low-cost and efficient degradation of various phenoxycarboxylic acid herbicides, generating their fatty acid side-chain cleavage products, 2,4-dichlorophenol (2,4-DCP), and the corresponding aldehyde or keto acids. P450 from Bacillus subtilis... BSβH2O2 can be used as the sole electron and oxygen donor to catalyze various reactions on the substrate. A literature and patent search revealed that no domestic or international literature currently utilizes P450. BSβ Reports on the degradation of phenoxycarboxylic acid herbicides by mutants of herbicides or similar substances. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the present invention aims to provide a class of P450 enzymes capable of degrading phenoxycarboxylic acid herbicides, their mutants, and their applications in degrading phenoxycarboxylic acid herbicides.

[0006] The present invention describes a class of P450 enzymes for degrading phenoxycarboxylic acid herbicides, characterized in that: the P450 enzymes are respectively named P450... BSβ OleT JE The P450 mentioned above BSβ The amino acid sequence is shown in SEQ ID NO. 1; the OleT JE The amino acid sequence is shown in SEQ ID NO.2.

[0007] The present invention describes a class of P450 enzyme mutants for degrading phenoxycarboxylic acid herbicides, characterized in that: the P450 enzyme mutants are respectively named P450. BSβ -F46A, P450 BSβ -F79A, P450 BSβ -F173A, P450 BSβ -F289A, P450 BSβ -F292A; wherein the P450 BSβ -F46A is formed by mutating phenylalanine to alanine at position 46 of the P450 enzyme, as shown in SEQ ID NO. 1, and its amino acid sequence is shown in SEQ ID NO. 3; the P450 BSβ -F79A is formed by mutating phenylalanine to alanine at position 79 of the P450 enzyme, as shown in SEQ ID NO. 1, and its amino acid sequence is shown in SEQ ID NO. 4; the P450 BSβ -F173A is formed by mutating phenylalanine to alanine at position 173 of the P450 enzyme, as shown in SEQ ID NO. 1, and its amino acid sequence is shown in SEQ ID NO. 5; the P450 BSβ -F289A is formed by mutating phenylalanine to alanine at position 289 of the P450 enzyme, as shown in SEQ ID NO. 1, and its amino acid sequence is shown in SEQ ID NO. 6; the P450 BSβ-F292A is formed by the mutation of phenylalanine to alanine at position 292 of the P450 enzyme, as shown in SEQ ID NO. 1, and its amino acid sequence is shown in SEQ ID NO. 7.

[0008] The preparation method of the P450 enzyme mutant for degrading phenoxycarboxylic acid herbicides according to the present invention comprises the following steps:

[0009] (1) Using the nucleotide sequence as shown in SEQ ID NO.8, P450 BSβ Using the gene as a template, PCR amplification was performed using primers F46A-F / F46A-R, F79A-F / F79A-R, F173A-F / F173A-R, F289A-F / F289A-R, or F292A-F / F292A-R, respectively, yielding the gene named P450. BSβ -F46A or P450 BSβ -F79A or P450 BSβ -F173A or P450 BSβ -F289A or P450 BSβ The PCR product of -F292A was then used; subsequently, the P450 gene carrying the PCR product was constructed using the E. coli expression vector pET28b. BSβ -F46A or P450 BSβ -F79A or P450 BSβ -F173A or P450 BSβ -F289A or P450 BSβ -F292A expression vector; construct the expression vector pET28b-P450 BSβ -F46A or pET28b-P450 BSβ -F79A or pET28b-P450 BSβ -F173A or pET28b-P450 BSβ -F289A or pET28b-P450 BSβ -F292A was transformed into E. coli BL21(DE3) chemocompetent cells, and the five transformed individuals were named BL21(DE3)-pET28b-P450, respectively. BSβ -F46A or BL21(DE3)-pET28b-P450 BSβ -F79A or BL21(DE3)-pET28b-P450 BSβ -F173A or BL21(DE3)-pET28b-P450 BSβ -F289A or BL21(DE3)-pET28b-P450 BSβ -F292A;

[0010] The nucleotide sequences of the primers mentioned above are as follows:

[0011] F46A-F:AAAAACGCAATTTGCATGACTGGC

[0012] F46A-R: GCAAATTGCGTTTTTCCCAACAA

[0013] F79A-F:TCGCTGGCAGGTGTTAATGCGATT

[0014] F79A-R: AACACCTGCCAGCGATTTCTGCAC

[0015] F173A-F:GACGCGGCAGGTGCTGTGGGACCG

[0016] F173A-R: AGCACCTGCCGCGTCGACCATGTC

[0017] F289A-F: TATCCGGCAGGCCCGTTTTTAGGG

[0018] F289A-R: CGGGCCTGCCGGATAATATCTGCG

[0019] F292A-F: GGCCCGGCATTAGGGGCGCTTGTC

[0020] F292A-R:CCCTAATGCCGGGCCGAACGGATA

[0021] (2) The five transformants obtained above were inoculated into LB liquid medium containing 50 mg / L kanamycin and cultured overnight at 37°C and 220 rpm to prepare five fermentation seed cultures; the five fermentation seed cultures were inoculated into TB medium and cultured at 37°C and 220 rpm until OD. 600 After the concentration of 1.0 ± 0.1 was reached, 0.2 mM IPTG was added to the fermentation broth, and the culture was incubated at 18℃ and 180 rpm for 24 ± 2 h. The cultured bacterial broth was centrifuged, the supernatant was discarded, and the bacterial cells were collected to obtain five protein-producing bacterial cells, which were named BL21(DE3)-pET28b-P450. BSβ -F46A or BL21(DE3)-pET28b-P450 BSβ -F79A or BL21(DE3)-pET28b-P450 BSβ -F173A or BL21(DE3)-pET28b-P450 BSβ-F289A or BL21(DE3)-pET28b-P450 BSβ -F292A, store frozen at -80℃;

[0022] (3) The five protein-producing bacterial cells were ultrasonically disrupted and then purified by nickel column affinity chromatography to obtain five purified proteins of P450 enzyme mutants; the purified proteins were named P450 respectively. BSβ -F46A or P450 BSβ -F79A or P450 BSβ -F173A or P450 BSβ -F289A or P450 BSβ -F292A, frozen in liquid nitrogen, stored at -80℃.

[0023] This invention provides a set of recombinant expression vectors capable of expressing the above-mentioned P450 enzyme, characterized in that: the recombinant expression vectors are pET28b-OleT JE pET28b-P450 BSβ Or pET30a-OleT JE pET30a-P450 BSβ .

[0024] This invention provides a set of recombinant expression vectors capable of expressing the above-mentioned P450 enzyme mutants, characterized in that: the recombinant expression vectors are pET28b-P450. BSβ -F46A, pET28b-P450 BSβ -F79A, pET28b-P450 BSβ -F173A, pET28b-P450 BSβ -F289A, pET28b-P450 BSβ -F292A; or pET30a-P450 BSβ -F46A、pET30a-P450 BSβ -F79A、pET30a-P450 BSβ -F173A, pET30a-P450 BSβ -F289A, pET30a-P450 BSβ -F292A.

[0025] This invention provides a group of genetically engineered bacteria capable of expressing the above-mentioned P450 enzyme, characterized in that: the genetically engineered bacteria are the recombinant expression vector pET28b-OleT of the above-mentioned P450 enzyme. JE pET28b-P450 BSβ Or pET30a-OleT JE pET30a-P450 BSβE. coli that were transformed separately.

[0026] Wherein: the genetically engineered bacterium is preferably BL21(DE3)-pET28b-OleT JE Or BL21(DE3)-pET28b-P450 BSβ .

[0027] This invention provides a group of genetically engineered bacteria capable of expressing the above-mentioned P450 enzyme mutant, characterized in that: the genetically engineered bacteria are the recombinant expression vector pET28b-P450 of the above-mentioned P450 enzyme mutant. BSβ -F46A, pET28b-P450 BSβ -F79A, pET28b-P450 BSβ -F173A, pET28b-P450 BSβ -F289A, pET28b-P450 BSβ -F292A; or pET30a-P450 BSβ -F46A、pET30a-P450 BSβ -F79A、pET30a-P450 BSβ -F173A, pET30a-P450 BSβ -F289A, pET30a-P450 BSβ -F292A transformed E. coli.

[0028] The genetically engineered bacterium is preferably BL21(DE3)-pET28b-P450. BSβ -F46A、BL21(DE3)-pET28b-P450 BSβ -F79A、BL21(DE3)-pET28b-P450 BSβ -F173A, BL21(DE3)-pET28b-P450 BSβ -F289A or BL21(DE3)-pET28b-P450 BSβ -F292A.

[0029] The present invention describes a class of P450 enzymes (OleT) that degrade herbicides. JE Or P450 BSβ Application of ) in the degradation of phenoxycarboxylic acid herbicides.

[0030] Wherein: the 200 μL enzyme reaction system for the reaction of P450 enzyme with phenoxycarboxylic acid herbicides in the aforementioned application is: 1 ± 0.2 μM OleT JE Or P450 BSβThe reaction mixture consisted of 500±20 μM herbicide substrate (2,4-D (2,4-dichlorophenoxyacetic acid) or 2,4-DP (2,4-dichlorophenoxypropionic acid) or 2,4-DB (2,4-dichlorophenoxybutyric acid) or MCPA (dimethyltetrachloro) or MCPP (2,4-methylchloropropionic acid) or MCPB (2,4-methylchlorobutyric acid)), 5 μM AldO (sugar alcohol oxidase), and 10% glycerol, reacted at 30±2℃ for 6±1 hours. A preferred embodiment is that the enzyme reaction system of P450 enzyme and herbicide substrate in the application is: 1 μM OleT... JE Or P450 BSβ The reaction mixture consisted of 500 μM herbicide substrate (2,4-D (2,4-dichlorophenoxyacetic acid) or 2,4-DP (2,4-dichlorophenoxypropionic acid) or 2,4-DB (2,4-dichlorophenoxybutyric acid) or MCPA (dimethyltetrachloro) or MCPP (2,4-methylchloropropionic acid) or MCPB (2,4-methylchlorobutyric acid)), 5 μM AldO (sugar alcohol oxidase), and 10% glycerol, and was reacted at 30 °C for 6 hours.

[0031] The present invention describes a class of herbicide-degrading P450 enzyme mutants (P450...). BSβ -F46A or P450 BSβ -F79A or P450 BSβ -F173A or P450 BSβ -F289A or P450 BSβ Application of -F292A in the degradation of phenoxycarboxylic acid herbicides.

[0032] Wherein: the 200 μL enzyme reaction system for the P450 enzyme mutant reacting with phenoxycarboxylic acid herbicides in the application is: 1 ± 0.2 μM P450 BSβ -F46A or P450 BSβ -F79A or P450 BSβ -F173A or P450 BSβ -F289A or P450 BSβ -F292A, 500±20 μM herbicide substrate (2,4-D (2,4-dichlorophenoxyacetic acid) or 2,4-DP (2,4-dichlorophenoxypropionic acid) or 2,4-DB (2,4-dichlorophenoxybutyric acid) or MCPA (dimethyltetrachloro) or MCPP (2,4-methylchloropropionic acid) or MCPB (2,4-methylchlorobutyric acid)), 5 μM 1dO (sugar alcohol oxidase), 10% glycerol, reacted at 30±2℃ for 6±1 hours. A preferred embodiment is: the enzyme reaction system of the P450 enzyme mutant with the herbicide substrate in the application is: 1 μM P450... BSβ -F46A or P450 BSβ -F79A or P450 BSβ -F173A or P450 BSβ-F289A or P450 BSβ -F292A, 500 μM herbicide substrate (2,4-D (2,4-dichlorophenoxyacetic acid) or 2,4-DP (2,4-dichlorophenoxypropionic acid) or 2,4-DB (2,4-dichlorophenoxybutyric acid) or MCPA (dimethyltetrachloro) or MCPP (2,4-methylchloropropionic acid) or MCPB (2,4-methylchlorobutyric acid)), 5 μM AldO (sugar alcohol oxidase), 10% glycerol, reacted at 30°C for 6 hours.

[0033] The P450 enzyme (OleT) for degrading phenoxycarboxylic acid herbicides described in this invention JE Or P450 BSβ ) or the P450 enzyme mutant that degrades phenoxycarboxylic acid herbicides (P450 BSβ -F46A or P450 BSβ -F79A or P450 BSβ -F173A or P450 BSβ -F289A or P450 BSβ The application of the gene (-F292A) in the breeding of transgenic crops resistant to phenoxycarboxylic acid herbicides; wherein the crop is preferably cotton, soybean, peanut, rice, wheat, corn, millet or sugarcane.

[0034] Experiments have shown that the phenoxycarboxylic acid-resistant transgenic positive seedlings, due to their resistance to phenoxycarboxylic acid herbicides, can be widely used in the cultivation of resistant transgenic crops of dicotyledonous and monocotyledonous plants sensitive to phenoxycarboxylic acid herbicides. This can overcome the selectivity problem of herbicides, allow for the wider application of phenoxycarboxylic acid herbicides, and will not affect the normal growth of subsequent phenoxycarboxylic acid-resistant transgenic crops, thus having a large market demand.

[0035] This invention discloses a class of P450 enzymes capable of degrading phenoxycarboxylic acid herbicides, their mutants, and their application in degrading phenoxycarboxylic acid herbicides and in the breeding of phenoxycarboxylic acid herbicide-resistant transgenic crops. The inventors screened multifunctional CYP152 peroxyenases and discovered OleT... JE and P450 BSβ It can degrade phenoxycarboxylic acid herbicides and modify P450 through site-directed mutagenesis. BSβ A mutant with high efficiency in degrading phenoxycarboxylic acid herbicides, P450, was obtained. BSβ -F46A or P450 BSβ -F79A or P450 BSβ -F173A or P450 BSβ -F289A or P450 BSβ -F292A. Experiments have shown that its catalytic efficiency in degrading phenoxycarboxylic acid herbicides can reach up to the initiating enzyme P450.BSβ The efficiency is 12.3 times higher, and the highest transformation number for degrading the herbicide 2,4-dichlorophenoxybutyric acid can reach 8779. The P450 enzyme mutant described in this invention has advantages such as high catalytic efficiency, high protein expression level, and low industrial cost. The entire herbicide degradation process is simple, mature, and inexpensive. This invention indicates that the P450 enzyme and its mutant for degrading phenoxycarboxylic acid herbicides provided by this invention have broad application prospects in herbicide degradation and the cultivation of transgenic crops resistant to phenoxycarboxylic acid herbicides, and its application in the pesticide field is promising. Attached Figure Description

[0036] Figure 1 P450 provided for this invention BSβ P450 BSβ -F46A, P450 BSβ -F79A, P450 BSβ -F173A, P450 BSβ -F289A and P450 BSβ HPLC chromatogram of 2,4-DP (2,4-dichlorophenoxypropionic acid) degradation by -F292A.

[0037] Figure 2 P450 provided for this invention BSβ P450 BSβ -F46A, P450 BSβ -F79A, P450 BSβ -F173A, P450 BSβ -F289A and P450 BSβ HPLC chromatogram of 2,4-DB (2,4-dichlorophenoxybutyric acid) degradation by -F292A.

[0038] Figure 3 The OleT provided by this invention JE P450 BSβ P450 BSβ -F46A, P450 BSβ -F79A, P450 BSβ -F173A, P450 BSβ -F289A and P450 BSβ - Catalytic activity analysis diagram of F292A for degrading phenoxycarboxylic acid herbicides 2,4-D (2,4-dichlorophenoxyacetic acid), 2,4-DP (2,4-dichlorophenoxypropionic acid), and 2,4-DB (2,4-dichlorophenoxybutyric acid).

[0039] Figure 4 The OleT provided by this invention JE P450 BSβ P450 BSβ-F46A, P450 BSβ -F79A, P450 BSβ -F173A, P450 BSβ -F289A and P450 BSβ -F292A Catalytic activity analysis diagram for degradation of phenoxycarboxylic acid herbicides MCPA (2,4-methyl tetrachloro), MCPP (2,4-methyl chloropropionic acid), and MCPB (2,4-methyl chlorobutyric acid).

[0040] Figure 5 The OleT provided by this invention JE P450 BSβ P450 BSβ -F46A, P450 BSβ -F79A, P450 BSβ -F173A, P450 BSβ -F289A and P450 BSβ -F292A's highest total conversion analysis of the degradation of phenoxycarboxylic acid herbicide 2,4-DB (2,4-dichlorophenoxybutyric acid). Detailed Implementation

[0041] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. The examples described below are merely preferred embodiments of the present invention. It should be noted that the following description is only for explaining the present invention and is not intended to limit the present invention in any way. Any simple modifications, equivalent changes, and alterations made to the embodiments based on the technical essence of the present invention shall fall within the scope of the present invention.

[0042] Unless otherwise specified, all materials, reagents, plasmids, strains, kits, etc. used in the following examples were obtained commercially.

[0043] In this invention, the Escherichia coli BL21(DE3) competent cells used were purchased from Beijing Qingke, and the E. coli expression vector pET28b was purchased from Invitrogen. The P450 gene... BSβ The nucleotide sequence is shown in SEQ ID NO. 8.

[0044] Culture medium used in the examples:

[0045] LB medium: tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L;

[0046] TB medium: tryptone 12 g / L, yeast extract 24 g / L, glycerol 40 g / L, K2HPO4 9.4 g / L, KH2PO4 2.2 g / L.

[0047] Protein purification buffer used in the examples:

[0048] Lysis buffer (pH=8.0): NaH2PO4 6g / L, NaCl 17.532g / L, glycerol 100g / L, imidazole 0.6808g / L.

[0049] Washing buffer (pH=8.0): NaH2PO4 6g / L, NaCl 17.532g / L, glycerol 100g / L, imidazole 1.3616g / L.

[0050] Elution buffer (pH=8.0): NaH2PO4 6g / L, NaCl 17.532g / L, glycerol 100g / L, imidazole 17.02g / L.

[0051] Desalting buffer (pH=7.4): NaH2PO4 6g / L, glycerol 100g / L.

[0052] Reagents used in the examples:

[0053] The one-step cloning kit used in the embodiments of this invention was purchased from Nanjing Novizan Pharmaceutical Co., Ltd.; the agarose gel DNA recovery kit and plasmid extraction kit were both purchased from Omega Pharmaceutical Co., Ltd.; the high-fidelity DNA polymerase was purchased from Takara; the restriction endonuclease was purchased from Thermo Fisher Scientific; PCR primer synthesis and DNA sequencing were performed by Shanghai Sangon Biotech Co., Ltd.; 2,4-dichlorophenoxyacetic acid (2,4-D), 2,4-dichlorophenoxypropionic acid (2,4-DP), 2,4-dichlorophenoxybutyric acid (2,4-DB), dimethyltetrachloroacetic acid (MCPA), 2,4-methylchloropropionic acid (MCPP), 2,4-methylchlorobutyric acid (MCPB), 2,4-dichlorophenol (2,4-DCP), 2-methyl-4-chlorophenol (2M4CP), and 3,5-dichlorocatechol were purchased from Macklin, Aladdin, and Dr. Ehrenstorfer.

[0054] Instruments used in the examples:

[0055] PCR amplification instrument (Eppendorf), high-speed refrigerated centrifuge (Eppendorf), agarose gel electrophoresis system (BIO-RAD), agarose gel imaging system (Shanghai Tianneng Technology Co., Ltd.), constant temperature shaker (Jingqi), SpectraMAX M2 multi-functional microplate reader (Molecular Devices), Agilent high performance liquid chromatograph (Agilent Technologies).

[0056] Example 1: Screening of P450 enzymes for degrading phenoxycarboxylic acid herbicides

[0057] Since phenoxycarboxylic acid herbicides all possess a carboxylic acid group, and the CYP152 peroxygenase family has always been referred to as fatty acid hydroxylases or fatty acid decarboxylases, the applicant selected three typical P450 enzymes from this family, OleT. JE P450 SPα and P450 BSβ Degradation experiments were conducted on phenoxycarboxylic acid herbicides.

[0058] The degradation test procedure for phenoxycarboxylic acid herbicides is as follows: A 200 μL reaction system includes 1 μM P450 enzyme (OleT). JE Or P450 SPα Or P450 BSβ The reaction mixture was prepared with 500 μM substrate (2,4-dichlorophenoxyacetic acid (2,4-D) or 2,4-dichlorophenoxypropionic acid (2,4-DP) or 2,4-dichlorophenoxybutyric acid (2,4-DB)), 5 μM AldO (sugar alcohol oxidase), and reacted at 30 ± 2 °C for 6 ± 1 h. An equal volume of acetonitrile was added to terminate the reaction, and the supernatant was collected after high-speed centrifugation for HPLC analysis.

[0059] Based on the amount of substrate consumed and the identification of the products, OleT was preliminarily determined. JE and P450 BSβ It can degrade the phenoxycarboxylic acid herbicides 2,4-dichlorophenoxypropionic acid (2,4-DP) and 2,4-dichlorophenoxybutyric acid (2,4-DB) to generate the side-chain CO bond cleavage product 2,4-dichlorophenol (2,4-DCP).

[0060] Example 2 P450 BSβ Construction of mutants

[0061] P450 was found during screening in Example 1. BSβ Compared to OleT JE It exhibits higher degradation activity against phenoxycarboxylic acid herbicides. (Based on P450) BSβ The crystal structure of the complex with the fatty acid palmitic acid substrate (PDB: 1IZO) shows that the binding of phenoxycarboxylic acid herbicides to substrates has high spatial requirements. The applicant aims to promote substrate entry and binding at the active site by shaping the substrate channel space. Phe46, Phe79, Phe173, Phe289, and Phe292 of the substrate active pocket were mutated to smaller alanine molecules. Using P450... BSβ Using the P450 mutant as a starting template, site-directed mutagenesis was employed to construct the mutant. BSβ -F46A, P450 BSβ -F79A, P450 BSβ -F173A, P450 BSβ -F289A and P450 BSβ-F292A.

[0062] The specific steps are as follows: Using the gene with the nucleotide sequence SEQ ID NO.8 as a template, PCR amplification was performed using primers F46A-F / F46A-R, F79A-F / F79A-R, F173A-F / F173A-R, F289A-F / F289A-R, or F292A-F / F292A-R, respectively. The PCR program was as follows: 10 μL of 5×PrimeSTAR GXL Buffer, 200 μM dNTPs, 0.3 μM each of forward and reverse primers, an appropriate amount of DNA template (10-100 ng), 2.5 U of high-fidelity polymerase (PrimeSTAR GXL DNA polymerase), and ddH2O to a final volume of 50 μL. The reaction conditions were: 98℃ pre-denaturation for 5 min, 98℃ denaturation for 10 s, 60℃ annealing for 15 s, 68℃ extension for 4 min, for 30 cycles, and a final extension at 68℃ for 10 min. After the PCR products were purified using a nucleic acid purification kit, expression plasmids were obtained using a one-step cloning kit and then directly transformed into E. coli BL21(DE3) competent cells to construct mutants.

[0063] Three to four single colonies were randomly selected and inoculated into 3 mL LB broth containing 50 μg / mL kanamycin and cultured overnight. The selected single colonies were then sequenced. The five P450 sequences with accurate sequencing results were then analyzed. BSβ -F46A or P450 BSβ -F79A or P450 BSβ -F173A or P450 BSβ -F289A or P450 BSβ -F292A mutant bacterial cultures were each added with an equal volume of sterile 40% glycerol and stored at -80°C to complete P450. BSβ Construction of mutants.

[0064] Table 1: Primer sequences used in the examples

[0065]

[0066] Example 3 P450 BSβ Fermentation expression, nickel column affinity chromatography purification, and protein concentration determination of mutant proteins

[0067] The five types of P450 from Example 2 were frozen at -80°C. BSβThe mutant strains were removed from glycerol tubes and activated by streaking in three zones on kanamycin-resistant LB agar plates, then incubated at 37°C for 12-16 h. Single colonies were picked and inoculated into 50 mL of LB liquid medium containing kanamycin, and incubated at 37°C and 220 rpm for 12-16 h. The seed culture was then transferred at a 1:100 volume ratio to 500 mL of TB liquid medium containing kanamycin, and incubated at 37°C and 220 rpm for 3-4 h. OD was then calculated. 600 When the concentration was 0.8-1.0, IPTG was added to a final concentration of 0.15 mM, and 5-ALA and VB1 were added to a final concentration of 0.5 mM. Protein expression was induced at 18℃ and 180 rpm for 20-24 h. After centrifugation at 6000 rpm and 4℃ for 10 min, the five P450 molecules were collected. BSβ The mutant bacterial cells were frozen at -80°C.

[0068] Protein purification

[0069] Five types of P450 were taken out of the freezer at -80℃. BSβ After thawing the mutant cells at room temperature, add 35 mL of lysis buffer to each 1 L of fermentation broth collected and resuspend on ice. Sonicate the cells on ice at 25% power for 5 seconds, then pause for 5 seconds, for approximately 30-35 minutes until the solution is clear. Centrifuge the suspension at 10,000 rpm for 60 minutes at 4°C. Collect the supernatant and add 1-2 mL of Ni-NTA resin. Incubate at 4°C for 1-2 hours. Place the mixed solution in a protein separation column and wash with approximately 5 column volumes of washing buffer until no protein is detected by G250 staining. The target protein was eluted from the nickel column using 5-10 mL of elution buffer and collected. The eluent was concentrated using a Millipore ultrafiltration tube (30 kDa) at 4°C and 5500 rpm until the eluent volume was 1-2 mL. The GE Healthcare PD-10 desalting column was first equilibrated with 5-fold desalting buffer, then the concentrated protein eluent was added to the column. After the sample solution had completely entered the column, desalting buffer was added for elution. The eluted protein was collected, centrifuged, and ultrafiltered to concentrate it to 1-2 mL. The concentrated protein was mixed and aliquoted into 100 μL tubes. The five purified proteins obtained were named P450. BSβ -F46A or P450 BSβ -F79A or P450 BSβ -F173A or P450 BSβ -F289A or P450 BSβ -F292A, quick-frozen in liquid nitrogen, stored at -80℃.

[0070] Protein concentration determination

[0071] The corresponding P450 protein concentration was determined using the previously reported CO difference spectroscopy method.

[0072] To prepare the ferrous complexes of each enzyme reduced with sodium dithionite, 50-80 μL of P450 enzyme (the purified P450 above) was taken. BSβ The mutant protein was diluted to 900 μL with desalting buffer (pH 7.4, 50 mM NaH2PO4, 10% glycerol), and CO gas was slowly passed through the sample in a fume hood. The CO-saturated P450 sample was transferred to a cuvette and scanned across the entire wavelength range of 350-500 nm using a spectrophotometer. The cuvette was then removed, and an appropriate amount of sodium hydrosulfite (Na2S2O4) was added. The entire wavelength range was scanned again. The P450 activity concentration was calculated based on the difference in absorbance between 450 nm and 490 nm, using the formula: dilution factor × (ΔA450 - ΔA490) / 0.091, in μM.

[0073] Example 4 P450 BSβ Quantitative Analysis and Application of Mutant Proteins

[0074] The P450 obtained in Example 3 BSβ The mutant proteins were reacted in the following 200 μL reaction system: 1 μM P450 enzyme (P450 BSβ -F46A or P450 BSβ -F79A or P450 BSβ -F173A or P450 BSβ -F289A or P450 BSβ The reaction mixture consisted of 500 μM substrate (2,4-dichlorophenoxyacetic acid (2,4-D) or 2,4-dichlorophenoxypropionic acid (2,4-DP) or 2,4-dichlorophenoxybutyric acid (2,4-DB)), 5 μM AldO (sugar alcohol oxidase), and reacted at 30 ± 2 °C for 6 ± 1 h. An equal volume of acetonitrile was added to terminate the reaction. After high-speed centrifugation, the supernatant was collected for HPLC analysis, and relative quantification was performed based on the amount of substrate consumed.

[0075] By interacting with the initiation template enzyme (P450) BSβThis study compared the catalytic activities of phenoxycarboxylic acid herbicides based on 2,4-dichlorophenol (2,4-DCP) substrates (2,4-dichlorophenoxyacetic acid (2,4-D), 2,4-dichlorophenoxypropionic acid (2,4-DP), or 2,4-dichlorophenoxybutyric acid (2,4-DB)) to produce 2,4-dichlorophenol (2,4-DCP) and its further hydroxylation product 3,5-dichlorocatechol. The results showed that the catalytic activity for 2,4-D (2,4-dichlorophenoxyacetic acid) increased from 0% to 10.1%, 3.4%, 6.8%, 8.5%, and 7.0%, respectively, and the catalytic activity for 2,4-DP (2,4-dichlorophenoxypropionic acid) increased to 5.8, 6.8, 3.5, 4.3, and 5.1 times, respectively. Figure 1 The P450 enzyme mutants exhibited increased catalytic activity against 2,4-DB (2,4-dichlorophenoxybutyric acid) to 100%, 92.0%, 99.1%, 94.9%, and 99.1%, respectively. Figure 2 They were respectively named P450 BSβ -F46A, P450 BSβ -F79A, P450 BSβ -F173A, P450 BSβ -F289A, P450 BSβ -F292A. (Compared to P450) BSβ OleT, which belongs to the same multifunctional CYP152 peroxygenase family and has a sequence similarity of up to 41%, JE The catalytic activities for 2,4-D (2,4-dichlorophenoxyacetic acid), 2,4-DP (2,4-dichlorophenoxypropionic acid), and 2,4-DB (2,4-dichlorophenoxybutyric acid) were 4.6%, 3.3%, and 51.2%, respectively. Figure 3 ).

[0076] By interacting with the initiation template enzyme (P450) BSβ A comparative study was conducted on the catalytic activities of phenoxycarboxylic acid herbicides based on 2-methyl-4-chlorophenol (2M4CP) substrates (MCPA (dimethyltetrachloro), MCPP (2-methyl-4-chloropropionic acid), or MCPB (2-methyl-4-chlorobutyric acid)) to produce 2-methyl-4-chlorophenol (2M4CP) and other products. The results showed that the catalytic activity for MCPA (dimethyltetrachloro) increased from 1.8% to 24.6%, 12.8%, 24.1%, 21.7%, and 9.9%, respectively; and the catalytic activity for MCPP (2-methyl-4-chloropropionic acid) increased from 28.7% to 95.5%, 84.4%, 62.8%, 44.7%, and 82.7%, respectively. Figure 4 The P450 enzyme mutants, whose catalytic activity against MCPB (2,4-methylchlorobutyric acid) increased from 88.1% to 99.0%, 89.3%, 97.3%, 86.2%, and 97.9%, respectively, were used. Figure 4They were respectively named P450 BSβ -F46A, P450 BSβ -F79A, P450 BSβ -F173A, P450 BSβ -F289A, P450 BSβ -F292A. (Compared to P450) BSβ OleT, which belongs to the same multifunctional CYP152 peroxygenase family and has a sequence similarity of up to 41%, JE The catalytic activities for MCPA (dimethyltetrachloro), MCPP (2,4-methylchloropropionic acid), and MCPB (2,4-methylchlorobutyric acid) were 2.0%, 16.6%, and 58.1%, respectively. Figure 4 ).

[0077] Experiments confirmed that the above method yielded P450. BSβ The mutant can indeed improve the activity of catalyzing phenoxycarboxylic acid herbicide substrates, which means that the P450 enzyme and its mutants provided by this invention for degrading phenoxycarboxylic acid herbicides have great application prospects in pesticide degradation.

[0078] Example 5 P450 BSβ Calculation of the total conversion number of mutant protein in the degradation of phenoxycarboxylic acid herbicides

[0079] Total transformation number calculation experiment: To further evaluate the application potential of P450 enzyme and its mutants in the degradation of phenoxycarboxylic acid herbicides, P450 and its mutant proteins were tested in the following 200 μL reaction systems: 0.5 μM or 1 μM P450 enzyme (OleT) JE Or P450 BSβ Or P450 BSβ -F46A or P450 BSβ -F79A or P450 BSβ -F173A or P450 BSβ -F289A or P450 BSβ -F292A), 10 mM 2,4-dichlorophenoxybutyric acid (2,4-DB), 5 μM AldO (sugar alcohol oxidase), reaction at 30±2℃ for 12±1 h. An equal volume of acetonitrile was added to terminate the reaction. After high-speed centrifugation, the supernatant was collected for HPLC analysis, and the total conversion number was analyzed based on the amount of substrate consumed.

[0080] The results showed P450 BSβ -F173A degrades the herbicide 2,4-dichlorophenoxybutyric acid (2,4-DB) to a maximum conversion number of 8779. Figure 5 ).

[0081] Example 6: Application of P450 enzyme and its mutant gene in the breeding of transgenic crops resistant to phenoxycarboxylic acid herbicides

[0082] target gene (OleT) JE Or P450 BSβ Or P450 BSβ -F46A or P450 BSβ -F79A or P450 BSβ -F173A or P450 BSβ -F289A or P450 BSβ A vector for gene editing in any plant can be constructed using the F292A method. After identification, a plant expression vector carrying the target gene is obtained. This vector is then introduced into a stable expression system (dicot or monocot plant cells) using Agrobacterium-mediated transformation or direct transformation of exogenous DNA (such as gene gun transformation). After genetic transformation, transgenic positive seedlings are screened using marker genes such as antibiotics and phenoxycarboxylic acid herbicides during the plant cell culture stage. PCR is then used for detection and verification to finally identify transgenic dicot or monocot plant positive seedlings containing the aforementioned target gene and resistant to phenoxycarboxylic acid herbicides. Preferred dicot plants include cotton, soybean, peanut, sunflower, sweet potato, potato, radish, tobacco, mint, and various melons; preferred monocot plants include rice, wheat, corn, millet, sugarcane, asparagus, bamboo shoots, yam, onion, garlic, and leek.

[0083] Experiments have confirmed that the transgenic positive seedlings resistant to phenoxycarboxylic acids possess the characteristic of resistance to phenoxycarboxylic acid herbicides. The P450 enzyme and its mutant gene (OleT) described in this invention... JE Or P450 BSβ Or P450 BSβ -F46A or P450 BSβ -F79A or P450 BSβ -F173A or P450 BSβ -F289A or P450 BSβ -F292A) can be widely used in the breeding of resistant transgenic crops of dicotyledonous and monocotyledonous plants sensitive to phenoxycarboxylic acid herbicides. It can overcome the selectivity problem of herbicides, enable the wider application of phenoxycarboxylic acid herbicides, and will not affect the normal growth of subsequent phenoxycarboxylic acid herbicide-resistant transgenic crops, thus having a large market demand.

[0084] Example 7 P450 enzyme mutant P450 BSβ -F46A, P450 BSβ -F79A, P450 BSβ -F173A, P450 BSβ -F289A, P450 BSβ The preparation steps for -F292A are as follows:

[0085] (1) Using the nucleotide sequence as shown in SEQ ID NO.8, P450 BSβ Using the gene as a template, PCR amplification was performed using primers F46A-F / F46A-R, F79A-F / F79A-R, F173A-F / F173A-R, F289A-F / F289A-R, or F292A-F / F292A-R, respectively, yielding the gene named P450. BSβ -F46A or P450 BSβ -F79A or P450 BSβ -F173A or P450 BSβ -F289A or P450 BSβ The PCR product of -F292A was then used; subsequently, the P450 gene carrying the PCR product was constructed using the E. coli expression vector pET28b. BSβ -F46A or P450 BSβ -F79A or P450 BSβ -F173A or P450 BSβ -F289A or P450 BSβ -F292A expression vector; construct the expression vector pET28b-P450 BSβ -F46A or pET28b-P450 BSβ -F79A or pET28b-P450 BSβ -F173A or pET28b-P450 BSβ -F289A or pET28b-P450 BSβ -F292A was transformed into E. coli BL21(DE3) chemocompetent cells, and the five transformed individuals were named BL21(DE3)-pET28b-P450, respectively. BSβ -F46A or BL21(DE3)-pET28b-P450 BSβ -F79A or BL21(DE3)-pET28b-P450 BSβ -F173A or BL21(DE3)-pET28b-P450 BSβ -F289A or BL21(DE3)-pET28b-P450 BSβ -F292A;

[0086] The nucleotide sequences of the primers mentioned above are as follows:

[0087] F46A-F:AAAAACGCAATTTGCATGACTGGC

[0088] F46A-R: GCAAATTGCGTTTTTCCCAACAA

[0089] F79A-F:TCGCTGGCAGGTGTTAATGCGATT

[0090] F79A-R: AACACCTGCCAGCGATTTCTGCAC

[0091] F173A-F:GACGCGGCAGGTGCTGTGGGACCG

[0092] F173A-R: AGCACCTGCCGCGTCGACCATGTC

[0093] F289A-F: TATCCGGCAGGCCCGTTTTTAGGG

[0094] F289A-R: CGGGCCTGCCGGATAATATCTGCG

[0095] F292A-F: GGCCCGGCATTAGGGGCGCTTGTC

[0096] F292A-R:CCCTAATGCCGGGCCGAACGGATA

[0097] (2) The five transformants obtained above were inoculated into LB liquid medium containing 50 mg / L kanamycin and cultured overnight at 37°C and 220 rpm to prepare five fermentation seed cultures; the five fermentation seed cultures were inoculated into TB medium and cultured at 37°C and 220 rpm until OD. 600 After the concentration of 1.0 ± 0.1 was reached, 0.2 mM IPTG was added to the fermentation broth, and the culture was incubated at 18℃ and 180 rpm for 24 h. The cultured bacterial broth was centrifuged and the supernatant was discarded. The bacterial cells were collected to obtain five protein-producing bacterial cells, which were named BL21(DE3)-pET28b-P450. BSβ -F46A or BL21(DE3)-pET28b-P450 BSβ -F79A or BL21(DE3)-pET28b-P450 BSβ -F173A or BL21(DE3)-pET28b-P450 BSβ -F289A or BL21(DE3)-pET28b-P450 BSβ -F292A, store frozen at -80℃;

[0098] (3) The five protein-producing bacterial cells were ultrasonically disrupted and then purified by nickel column affinity chromatography to obtain five purified proteins of the P450 enzyme mutant. The purified proteins were named P450, respectively. BSβ-F46A or P450 BSβ -F79A or P450 BSβ -F173A or P450 BSβ -F289A or P450 BSβ -F292A, frozen in liquid nitrogen, stored at -80℃.

[0099] (4) Determination of P450 enzyme protein concentration: Take 50-80 μL of P450 enzyme. BSβ -F46A or P450 BSβ -F79A or P450 BSβ -F173A or P450 BSβ -F289A or P450 BSβ -F292A was diluted to 900 μL with desalting buffer, and CO gas was slowly passed through the sample in a fume hood. The CO-saturated P450 sample was transferred into a cuvette and placed in a spectrophotometer for a full wavelength scan of 350-500 nm. The cuvette was removed, and an appropriate amount of sodium hydrosulfite (Na2S2O4) was added. The full wavelength scan was performed again. Based on the absorbance values ​​measured twice, the P450 activity concentration was calculated according to the difference in absorbance at 450 nm and 490 nm, using the formula: dilution factor × (ΔA450 - ΔA490) / 0.091, in μM. sequence list <110> Shandong University <120> A class of P450 enzyme mutants that degrade phenoxycarboxylic acid herbicides and their applications <141> 2022-06-29 <160> 8 <210> 1 <211> 417 <212> PRT <213> Bacillus subtilis <221> Amino acid sequence of gene P450BSβ <222> (1)...(417) <400> 1 MNEQIPHDKS LDNSLTLLKE GYLFIKNRTE RYNSDLFQAR LLGKNFICMT GEAAAKVFYD 60 TDRFQRQNAL PKRVQKSLFG VNAIQGMDGS AHIHRKMLFL SLMTPPHQKR LAELMTEEWK 120 AAVTRWEKAD EVVLFEEAKE ILCRVACYWA GVPLKETEVK ERADDFIDMV DAFGAVGPRH 180 WKGRRARPRA EEWIEVMIED ARAGLLKTTS GTALHEMAFH TQEDGSQLDS RMAAIELINV 240 LRPIVAISYF LVFSALALHE HPKYKEWLRS GNSREREMFV QEVRRYYPFG PFLGALVKKD 300 FVWNNCEFKK GTSVLLDLYG TNHDPRLWDH PDEFRPERFA EREENLFDMI PQGGGHAEKG 360 HRCPGEGITI EVMKASLDFL VHQIEYDVPE QSLHYSLARM PSLPESGFVM SGIRRKS 417 <210> 2 <211> 422 <212> PRT <213> Jeotgalicoccus sp. ATCC 8456 <221> Amino acid sequence of gene OleTJE <222> (1)…(422) <400> 2 MATLKRDKGL DNTLKVLKQG YLYTTNQRNR LNTSVFQTKA LGGKPFVVVT GKEGAEMFYN 60 NDVVQREGML PKRIVNTLFG KGAIHTVDGK KHVDRKALFM SLMTEGNLNY VRELTRTLWH 120 ANTQRMESMD EVNIYRESIV LLTKVGTRWA GVQAPPEDIE RIATDMDIMI DSFRALGGAF 180 KGYKASKEAR RRVEDWLEEQ IIETRKGNIH PPEGTALYEF AHWEDYLGNP MDSRTCAIDL 240 MNTFRPLIAI NRFVSFGLHA MNENPITREK IKSEPDYAYK FAQEVRRYYP FVPFLPGKAK 300 VDIDFQGVTI PAGVGLALDV YGTTHDESLW DDPNEFRPER FETWDGSPFD LIPQGGGDYW 360 TNHRCAGEWI TVIIMEETMK YFAEKITYDV PEQDLEVDLN SIPGYVKSGF VIKNVREVVD 420 RT 422 <210> 3 <211> 417 <212> PRT <213> Bacillus subtilis <221> Amino acid sequence of gene P450BSβ-F46A <222> (1)…(417) <400> 3 MNEQIPHDKS LDNSLTLLKE GYLFIKNRTE RYNSDLFQAR LLGKNAICMT GAEAAKVFYD 60 TDRFQRQNAL PKRVQKSLFG VNAIQGMDGS AHIHRKMLFL SLMTPPHQKR LAELMTEEWK 120 AAVTRWEKAD EVVLFEEAKE ILCRVACYWA GVPLKETEVK ERADDFIDMV DAFGAVGPRH 180 WKGRRARPRA EEWIEVMIED ARAGLLKTTS GTALHEMAFH TQEDGSQLDS RMAAIELINV 240 LRPIVAISYF LVFSALALHE HPKYKEWLRS GNSREREMFV QEVRRYYPFG PFLGALVKKD 300 FVWNNCEFKK GTSVLLDLYG TNHDPRLWDH PDEFRPERFA EREENLFDMI PQGGGHAEKG 360 HRCPGEGITI EVMKASLDFL VHQIEYDVPE QSLHYSLARM PSLPESGFVM SGIRRKS 417 <210> 4 <211> 417 <212> PRT <213> Bacillus subtilis <221> The amino acid sequence of gene P450BSβ-F79A <222> (1)...(417) <400> 4 MNEQIPHDKS LDNSLTLLKE GYLFIKNRTE RYNSDLFQAR LLGKNFICMT GEAAAKVFYD 60 TDRFQRQNAL PKRVQKSLAG VNAIQGMDGS AHIHRKMLFL SLMTPPHQKR LAELMTEEWK 120 AAVTRWEKAD EVVLFEEAKE ILCRVACYWA GVPLKETEVK ERADDFIDMV DAFGAVGPRH 180 WKGRRARPRA EEWIEVMIED ARAGLLKTTS GTALHEMAFH TQEDGSQLDS RMAAIELINV 240 LRPIVAISYF LVFSALALHE HPKYKEWLRS GNSREREMFV QEVRRYYPFG PFLGALVKKD 300 FVWNNCEFKK GTSVLLDLYG TNHDPRLWDH PDEFRPERFA EREENLFDMI PQGGGHAEKG 360 HRCPGEGITI EVMKASLDFL VHQIEYDVPE QSLHYSLARM PSLPESGFVM SGIRRKS 417 <210> 5 <211> 417 <212> PRT <213> Bacillus subtilis <221> The amino acid sequence of gene P450BSβ-F173A <222> (1)…(417) <400> 5 MNEQIPHDKS LDNSLTLLKE GYLFIKNRTE RYNSDLFQAR LLGKNFICMT GAEAAKVFYD 60 TDRFQRQNAL PKRVQKSLFG VNAIQGMDGS AHIHRKMLFL SLMTPPHQKR LAELMTEEWK 120 AAVTRWEKAD EVVLFEEAKE ILCRVACYWA GVPLKETEVK ERADDFIDMV DAAGAVGPRH 180 WKGRRARPRA EEWIEVMIED ARAGLLKTTS GTALHEMAFH TQEDGSQLDS RMAAIELINV 240 LRPIVAISYF LVFSALALHE HPKYKEWLRS GNSREREMFV QEVRRYYPFG PFLGALVKKD 300 FVWNNCEFKK GTSVLLDLYG TNHDPRLWDH PDEFRPERFA EREENLFDMI PQGGGHAEKG 360 HRCPGEGITI EVMKASLDFL VHQIEYDVPE QSLHYSLARM PSLPESGFVM SGIRRKS 417 <210> 6 <211> 417 <212> PRT <213> Bacillus subtilis <221> Amino acid sequence of gene P450BSβ-F289A <222> (1)…(417) <400> 6 MNEQIPHDKS LDNSLTLLKE GYLFIKNRTE RYNSDLFQAR LLGKNFICMT GAEAAKVFYD 60 TDRFQRQNAL PKRVQKSLFG VNAIQGMDGS AHIHRKMLFL SLMTPPHQKR LAELMTEEWK 120 AAVTRWEKAD EVVLFEEAKE ILCRVACYWA GVPLKETEVK ERADDFIDMV DAFGAVGPRH 180 WKGRRARPRA EEWIEVMIED ARAGLLKTTS GTALHEMAFH TQEDGSQLDS RMAAIELINV 240 LRPIVAISYF LVFSALALHE HPKYKEWLRS GNSREREMFV QEVRRYYPAG PFLGALVKKD 300 FVWNNCEFKK GTSVLLDLYG TNHDPRLWDH PDEFRPERFA EREENLFDMI PQGGGHAEKG 360 HRCPGEGITI EVMKASLDFL VHQIEYDVPE QSLHYSLARM PSLPESGFVM SGIRRKS 417 <210> 7 <211> 417 <212> PRT <213> Bacillus subtilis <221> Amino acid sequence of gene P450BSβ-F292A <222> (1)…(417) <400> 7 MNEQIPHDKS LDNSLTLLKE GYLFIKNRTE RYNSDLFQAR LLGKNFICMT GAEAAKVFYD 60 TDRFQRQNAL PKRVQKSLFG VNAIQGMDGS AHIHRKMLFL SLMTPPHQKR LAELMTEEWK 120 AAVTRWEKAD EVVLFEEAKE ILCRVACYWA GVPLKETEVK ERADDFIDMV DAFGAVGPRH 180 WKGRRARPRA EEWIEVMIED ARAGLLKTTS GTALHEMAFH TQEDGSQLDS RMAAIELINV 240 LRPIVAISYF LVFSALALHE HPKYKEWLRS GNSREREMFV QEVRRYYPFG PALGALVKKD 300 FVWNNCEFKK GTSVLLDLYG TNHDPRLWDH PDEFRPERFA EREENLFDMI PQGGGHAEKG 360 HRCPGEGITI EVMKASLDFL VHQIEYDVPE QSLHYSLARM PSLPESGFVM SGIRRKS 417 <210> 8 <211> 1254 <212> DNA <213> Bacillus subtilis <221> Nucleotide sequence of gene P450BSβ <222> (1)…(1254) <400> 8 atgaatgagc agattccaca tgacaaaagt ctcgataaca gtctgacact gctgaaggaa 60 gggtatttat ttattaaaaa cagaacagag cgctacaatt cagatctgtt tcaggcccgt 120 ttgttgggaa aaaactttat ttgcatgact ggcgctgagg cggcgaaggt gttttatgat 180 acggatcgat tccagcggca gaacgctttg cctaagcggg tgcagaaatc gctgtttggt 240 gttaatgcga ttcagggaat ggatggcagc gcgcatatcc atcggaagat gctttttctg 300 tcattgatga caccgccgca tcaaaaacgt ttggctgagt tgatgacaga ggagtggaaa 360 gcagcagtca caagatggga gaaggcagat gaggttgtgt tatttgaaga agcaaaagaa 420 atcctgtgcc gggtagcgtg ctattgggca ggtgttccgt tgaaggaaac ggaagtcaaa 480 gagagagcgg atgacttcat tgacatggtc gacgcgttcg gtgctgtggg accgcggcat 540 tggaaaggaa gaagagcaag gccgcgtgcg gaagagtgga ttgaagtcat gattgaagat 600 gctcgtgccg gcttgctgaa aacgacttcc ggaacagcgc tgcatgaaat ggcttttcac 660 acacaagaag atggaagcca gctggattcc cgcatggcag ccattgagct gattaatgta 720 ctgcggccta ttgtcgccat ttcttacttt ctggtgtttt cagctttggc gcttcatgag 780 catccgaagt ataaggaatg gctgcggtct ggaaacagcc gggaaagaga aatgtttgtg 840 caggaggtcc gcagatatta tccgttcggc ccgtttttag gggcgcttgt caaaaaagat 900 tttgtatgga ataactgtga gtttaagaag ggcacatcgg tgctgcttga tttatatgga 960 acgaaccacg accctcgtct atgggatcat cccgatgaat tccggccgga acgatttgcg 1020 gagcgggaag aaaatctgtt Tgatatgatt cctcaaggcg gggggcacgc cgagaaaggc 1080 caccgctgtc caggggaagg cattacaatt gaagtcatga aagcgagcct ggatttcctc 1140 gtccatcaga ttgaatacga tgttccggaa caatcactgc attacagtct cgccagaatg 1200 ccatcattgc ctgaaagcgg cttcgtaatg agcggaatca gacgaaaaag ttaa 1254

Claims

1. A mutant of a P450 enzyme that degrades a phenoxy carboxylic acid herbicide, characterized in that: The P450 enzyme mutant is named P450 BSβ -F46A; wherein the P450 BSβ The F46A is formed by mutating the 46th amino acid of the P450 enzyme with the amino acid sequence shown as SEQ ID NO. 1 from phenylalanine to alanine, and the amino acid sequence thereof is shown as SEQ ID NO.

3.

2. The method for preparing the mutant of P450 enzyme degrading phenoxy carboxylic acid herbicide according to claim 1, the steps are: (1) P450 with nucleotide sequence as shown in SEQ ID NO. 8 BSβ As a template, the P450 gene with nucleotide sequence as shown in SEQ ID NO. 8 was subjected to PCR amplification with F46A-F and F46A-R as primers, respectively, to obtain PCR products named P450 BSβ F46A Then, the E. coli expression vector pET28b was used as a carrier to construct an expression vector carrying the gene of the PCR product P450 BSβ F46A The constructed expression vector pET28b- P450 BSβ F46A was transformed into E. coli BL21(DE3) chemically competent cells, and the corresponding transformants were named BL21(DE3)-pET28b-P450 BSβ -F46A. wherein The above primer nucleotide sequences are respectively: F46A-F: AAAAACGCAATTTGCATGACTGGC F46A-R: GCAAATTGCGTTTTTTCCCAACAA (2) The transformant obtained above was inoculated into LB liquid medium containing 50 mg / L kanamycin, and cultured at 37 °C, 220 rpm overnight to prepare a fermentation seed solution; the fermentation seed solution obtained was inoculated into TB medium, and cultured at 37 °C, 220 rpm until OD 600 = 1.0 ± 0.1, then 0.2 mM IPTG was added, and the fermentation culture was carried out at 18 °C, 180 rpm for 24 ± 2 h; the bacterial solution after culture was centrifuged to discard the supernatant, and the bacterial body was collected to obtain a protein-producing bacterial body, which was named BL21(DE3)-pET28b-P450 BSβ -F46A, and stored at -80 °C; (3) The P450 enzyme mutant protein was obtained by ultrasonic disruption of the protein-producing bacteria and then purified by nickel column affinity chromatography. The obtained purified protein was named P450 BSβ - F46A, frozen in liquid nitrogen, stored at -80°C.

3. A recombinant expression vector capable of expressing the P450 enzyme mutant of claim 1, characterized by: The recombinant expression vector capable of expressing the P450 enzyme mutant of claim 1 is pET28b- P450 BSβ F46A or pET30a- P450 BSβ - F46A .

4. A genetically engineered bacterium capable of expressing the P450 enzyme mutant of claim 1, characterized by: The genetically engineered bacteria is the recombinant expression vector pET28b- P450 BSβ F46A or pET30a- P450 BSβ F46A transformed E. coli.

5. The genetically engineered bacteria according to claim 4, characterized in that: The genetically engineered bacteria is BL21(DE3)-pET28b-P450 BSβ -F46A.

6. Use of a P450 enzyme mutant of claim 1 for degrading phenoxy carboxylic acid herbicides; wherein the P450 enzyme mutant is P450 BSβ - F46A, the phenoxy carboxylic acid herbicide refers to 2,4-D (2,4-dichlorophenoxyacetic acid), 2,4-DP (2,4-dichlorophenoxypropionic acid), 2,4-DB (2,4-dichlorophenoxybutyric acid), MCPA (dimethyl tetrachloride), MCPP (2 methyl 4 chloropropionic acid) or MCPB (2 methyl 4 chlorobutyric acid).

7. Use according to claim 6, characterized in that: The P450 enzyme mutant in the application and phenoxy carboxylic acid herbicide 200 μL enzyme reaction degradation system is: 1 ± 0.2 μM P450 BSβ -F46A, 500 ± 20 μM 2,4-D (2,4-dichlorophenoxyacetic acid) or 2,4-DP (2,4-dichlorophenoxypropionic acid) or 2,4-DB (2,4-dichlorophenoxybutyric acid) or MCPA (MCPA) or MCPP (2 methyl 4 chloro propionic acid) or MCPB (2 methyl 4 chloro butyric acid), 5 ± 1 μM aldose oxidase AldO, 10 ± 2 % glycerol, reaction at 30 ± 2℃ for 6 ± 1 hours.

8. Use according to claim 7, characterized in that: The P450 enzyme mutant and phenoxy carboxylic acid herbicide 200 μL enzyme reaction degradation system in the application is: 1 μM P450 BSβ - F46A, 500 μM 2,4-D (2,4-dichlorophenoxyacetic acid) or 2,4-DP (2,4-dichlorophenoxypropionic acid) or 2,4-DB (2,4-dichlorophenoxybutyric acid) or MCPA (MCPA) or MCPP (2-methyl-4-chloropropionic acid) or MCPB (2-methyl-4-chlorobutyric acid), 5 μM alditol oxidase AldO, 10 % glycerol, reaction at 30 °C for 6 hours.

9. Use of a gene encoding a mutant P450 enzyme degrading phenoxy carboxylic acid herbicides according to claim 1 for breeding transgenic crops resistant to phenoxy carboxylic acid herbicides; wherein the mutant P450 enzyme according to claim 1 is a P450 BSβ - F46A; and the crops are cotton, soybean, peanut, rice, wheat, maize, millet or sugar cane.

Citation Information

Patent Citations

  • P450 peroxygenase mutant and application of P450 peroxygenase mutant in degradation of phenol environmental pollutants

    CN120400086A