Glycosyl hydrolases, genes, vectors, host cells, and uses
By isolating and optimizing the amino acid sequence of glycosyl hydrolases from ginseng plants, and combining them with recombinant expression vectors and host cells, we have achieved highly efficient and selective hydrolysis of the glucose group on the third carbon of PPD-type ginsenosides. This solves the problem of high preparation cost in existing technologies and improves the preparation efficiency and pharmacological activity of rare ginsenosides.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- BEIJING UNIV OF CHINESE MEDICINE
- Filing Date
- 2022-09-08
- Publication Date
- 2026-07-21
AI Technical Summary
Existing technologies are unable to efficiently and selectively hydrolyze the glucose group at the third carbon in ginsenosides, resulting in high production costs and high consumption of plant resources for rare ginsenosides, and a lack of universal glycosyl hydrolases.
A specific glycosyl hydrolase is provided, which can selectively hydrolyze the glucose group on the 3rd carbon of PPD-type ginsenosides. By isolating and optimizing the amino acid sequence from ginseng plants, and combining it with recombinant expression vectors and host cells, rare ginsenosides can be prepared efficiently.
The selective hydrolysis of the glucose group at the third carbon of PPD-type ginsenosides under mild conditions was achieved, which improved the preparation efficiency and cost-effectiveness of rare ginsenosides and enhanced their pharmacological activity.
Smart Images

Figure CN117660416B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a glycosyl hydrolase, its encoding gene, vector, host cell, and applications. Background Technology
[0002] Ginsenosides are the most representative active ingredients in ginseng plants. Due to differences in aglycone structure and the types, numbers, and linkage positions of sugars in the sugar chains, ginsenosides exhibit a rich variety of structures, such as ginsenosides Ra, Rb1, Rb2, Rb3, Rc, Rd, Re, Rf, and Rg1. Pharmacological studies have shown that these ginsenosides possess activities such as delaying aging, neuroprotection, enhancing immunity, and inhibiting tumor cell growth. However, because most ginsenosides contain multiple sugar groups and have relatively large molecular weights, they are not easily absorbed by the human body. Under the influence of intestinal flora, the sugar groups in the structure undergo partial hydrolysis, transforming into rarer ginsenosides with relatively smaller molecular weights, such as Rg3, Rh2, Rh3, and Rk2. These components exhibit increased water and lipid solubility, enhanced pharmacological activity, and particularly superior activity in anti-tumor activity.
[0003] Researchers studying the structure-activity relationship between ginsenosides and their antitumor activity found that, with the decrease in the number of sugar groups, the activity of different types of ginsenosides was as follows: monosaccharides > disaccharides > trisaccharides > tetrasaccharides.
[0004] However, rare ginsenosides with relatively few glycosylation groups are present in very low amounts in ginseng plants. Extraction from plants alone is not only extremely costly but also consumes vast amounts of plant resources. Chemical hydrolysis methods for preparing these rare ginsenosides also suffer from poor selectivity and the potential for damaging aglycone structures. Biological methods, especially enzymatic methods, can selectively hydrolyze specific glycosidic bonds under mild conditions, enabling the green, efficient, and low-cost preparation of rare ginsenosides. Glycosyl hydrolases are a class of enzymes that catalyze these reactions, and methods for preparing specific rare ginsenosides using glycosyl hydrolases are currently attracting attention.
[0005] CN102762738A discloses a ginsenoside glycosidase and its use. This glycosidase selectively hydrolyzes pyranose or arabinose on the 20th or 3rd carbon of ginsenosides Rb1, Rb3, Rd, and Rc, thereby converting PPD-type saponins into deglycosylated, highly active substances that can be absorbed in vivo.
[0006] CN108064309A discloses an enzyme-catalyzed method for synthesizing ginsenoside Rh2. This method uses ginsenoside Rg3 as a substrate and adds a specific glucosidase to carry out a catalytic reaction, hydrolyzing the glucose at position 20 to generate ginsenoside Rh2.
[0007] Although there are reports on the preparation of rare ginsenosides using glycoside hydrolases derived from microorganisms, there are no reports on glycosyl hydrolases that specifically and universally hydrolyze the β-1,2-glucosidic bond at the 3-position of the protopanaxadiol (PPD) type saponins. Summary of the Invention
[0008] In view of this, one object of the present invention is to provide a glycosyl hydrolase for selectively hydrolyzing the glucose group at the third carbon of PPD-type ginsenosides, wherein the catalytic site of the glycosyl hydrolase is specific and can selectively hydrolyze the glucose group at the third carbon of PPD-type ginsenosides.
[0009] Another object of the present invention is to provide a nucleotide sequence encoding the above-mentioned glycosyl hydrolase.
[0010] Another object of the present invention is to provide a recombinant expression vector containing the above-mentioned nucleotide sequence.
[0011] Another object of the present invention is to provide a host cell containing a nucleotide sequence or a recombinant expression vector.
[0012] Another object of the present invention is to provide the use of any one of the glycosyl hydrolase, the nucleotide sequence, the recombinant expression vector, and the recombinant host cell as described above in the selective hydrolysis of the glucose group at the third carbon of PPD-type ginsenosides.
[0013] The present invention achieves the above objectives using the following technical solutions.
[0014] On one hand, the present invention provides a glycosyl hydrolase for selectively hydrolyzing the glucose group at the third carbon of PPD-type ginsenosides, wherein the glycosyl hydrolase is (a) or (b):
[0015] (a) A glycosyl hydrolase with an amino acid sequence as shown in SEQ ID NO:1;
[0016] (b) A glycosyl hydrolase derived from (a) with equivalent function formed by replacing, deleting or adding one or more amino acids of the amino acid sequence shown in SEQ ID NO:1.
[0017] The present invention also provides a glycosyl hydrolase, which is derived from ginseng plants and has the same homologous amino acid sequence as described above.
[0018] According to the glycosyl hydrolase of the present invention, preferably, the glycosyl hydrolase has at least 80% similarity to the glycosyl hydrolase according to (a) or (b).
[0019] According to the glycosyl hydrolase of the present invention, preferably, the glycosyl hydrolase is described in any of the following ways:
[0020] (c) Glycosyl hydrolases with amino acid sequences as shown in SEQ ID NO:4;
[0021] (d) A glycosyl hydrolase derived from (c) with equivalent function formed by replacing, deleting or adding one or more amino acids of the amino acid sequence shown in SEQ ID NO:4.
[0022] (e) Glycosyl hydrolases with amino acid sequences as shown in SEQ ID NO:6;
[0023] (f) A glycosyl hydrolase derived from (e) with equivalent function formed by replacing, deleting or adding one or more amino acids of the amino acid sequence shown in SEQ ID NO:6.
[0024] On the other hand, the present invention provides a nucleotide sequence encoding the above-mentioned glycosyl hydrolase.
[0025] According to the nucleotide sequences of the present invention, preferably, the nucleotide sequence encoding (a) the glycosyl hydrolase is shown in SEQ ID NO:2; the nucleotide sequence encoding (c) the glycosyl hydrolase is shown in SEQ ID NO:3; and the nucleotide sequence encoding (e) the glycosyl hydrolase is shown in SEQ ID NO:5.
[0026] In another aspect, the present invention provides a recombinant expression vector containing the above-mentioned nucleotide sequence.
[0027] According to the recombinant expression vector of the present invention, preferably, the expression vector used is pET32a.
[0028] In another aspect, the present invention provides a recombinant host cell containing the above-mentioned nucleotide sequence or the above-mentioned recombinant expression vector.
[0029] The recombinant host cell according to the present invention is preferably selected from bacteria, actinomycetes, filamentous fungi, yeast, plant cells or animal cells.
[0030] In another aspect, the present invention provides the use of any one of the glycosyl hydrolase, the nucleotide sequence, the recombinant expression vector, and the recombinant host cell described above in the selective hydrolysis of the glucose group at the third carbon of PPD-type ginsenosides.
[0031] According to the application of the present invention, preferably, the PPD-type ginsenosides include notoginsenoside R4, ginsenoside Ra1, ginsenoside Ra2, ginsenoside Ra3, ginsenoside Rb1, ginsenoside Rb2, ginsenoside Rb3, ginsenoside Rc, ginsenoside Rd, and ginsenoside Rg3.
[0032] According to the application of the present invention, preferably, the PPD-type ginsenoside is a mixture of dammarane-type ginsenosides with a β-1,2-glucose group on the 3rd carbon.
[0033] This invention has isolated glycosyl hydrolases with homologous sequences from various plants in the genus *Panax* capable of selectively hydrolyzing the glucose group at the 3rd carbon of PPD-type ginsenosides. Glycosyl hydrolases (SEQ ID NO:1), designated PnGH1, were isolated from *Panax notoginseng*; (SEQ ID NO:4), designated PgGH1, from *Panax ginseng*; and (SEQ ID NO:6), designated PqGH1, from *Panax quinquefolius*. This invention has found that glutamic acid at positions 188, 232, and 425 are key sites for the selective hydrolysis of the glucose group by PnGH1, with the glutamic acid at position 425 being particularly important. This invention also discloses optimized nucleotide sequences for encoding the above amino acid sequences, namely SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:5. Attached Figure Description
[0034] Figure 1 This is an agarose gel image of PnGH1, a glycosyl hydrolase gene identified in Panax notoginseng.
[0035] Figure 2 This is an SDS-PAGE gel electrophoresis image of the glycosyl hydrolase PnGH1 (the arrow indicates the target protein).
[0036] Figure 3 The figure shows the EIC diagram of the PnGH1-catalyzed PPD-type ginsenoside reaction; the labels in the figure are explained as follows: 1-Ginsenoside R4, 2-Ginsenoside Ra2, 3-Ginsenoside Ra3, 4-Ginsenoside Rb1, 5-Ginsenoside Rc, 6-Ginsenoside Ra1, 7-Ginsenoside Rb2, 8-Ginsenoside Rb3, 9-Ginsenoside Rd, 10-Ginsenoside Rg3; 11-PN04*, 12-PN02, 13-PN03, 14-Gynostemma pentaphyllum saponin XVII, 15-Ginsenoside Fe, 16-PN01, 17-Ginsenoside Rd2, 18-Ginsenoside Fd, 19-Ginsenoside F2, 20-Ginsenoside Rh2; "*" represents new compounds.
[0037] Figure 4This is a schematic diagram of the stability experiment of PnGH1.
[0038] Figure 5 This is an HPLC chromatogram of the reaction of ginsenoside Rb3 catalyzed by PnGH1 and its homologous proteins PgGH1 and PqGH1.
[0039] Figure 6 The graph shows the conversion rate of ginsenoside Rb3 by the mutant in the mutation experiment.
[0040] Figure 7 This is a schematic diagram comparing the sequence listings of PnGH1 with its homologous sequences PgGH1 and PqGH1. Detailed Implementation
[0041] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto.
[0042] <Glycosyl hydrolases and gene sequences>
[0043] In this field, the biosynthetic pathways of secondary metabolites in closely related plants are similar, and the structures and functions of the enzymes (i.e., proteins) catalyzing these biosynthetic reactions are also similar. The presence of homologous protein sequences indicates that two or more protein sequences share a common ancestor, and proteins with homologous sequences generally have similar functions. Therefore, in closely related plants, identifying the first protein sequence with a specific catalytic function is crucial. Based on this, obtaining homologous proteins with similar structures and functions from closely related plants is relatively straightforward.
[0044] The genus *Panax* is a genus within the family Araliaceae. This genus has a relatively small number of plants; currently, only eight species have been discovered worldwide, and they are all biologically very closely related. Therefore, if a protein sequence in one species of this genus possesses a selective catalytic function, it is easy to isolate a homologous and functionally similar protein sequence from other species of the genus.
[0045] This invention first isolated a protein sequence from *Panax notoginseng* (Burkill) FHChen exC.H., a plant in the genus *Panax*, capable of selectively hydrolyzing glycosyl groups. This protein selectively catalyzes the hydrolysis of the glucose group at the third carbon of PPD-type ginsenosides, without affecting glycosyl groups at other positions in the ginsenoside structure. Subsequently, the inventors isolated homologous sequences of this protein sequence from *Panax ginseng* and *Panax quinquefolius*, respectively, and found that both possessed the same catalytic function. This confirms the theory that when a protein sequence in a closely related species possesses a specific selective catalytic function, it is very easy to isolate and identify homologous proteins with similar functions from other related plants in the same genus. This invention also isolated an enzyme from *Panax notoginseng* capable of selectively catalyzing the hydrolysis of the glucose group at the third carbon of PPD-type ginsenosides. After further screening, identification, and optimization, the glycosyl hydrolase of this invention and the nucleotide sequence encoding the glycosyl hydrolase of this invention were obtained.
[0046] The glycosyl hydrolase of the present invention may be a natural protease or an enzyme containing mutations that still has selective glycosyl hydrolysis activity. Preferably, the glycosyl hydrolase of the present invention comprises (a) the amino acid sequence shown in SEQ ID NO:1, or comprises (b) the amino acid sequence shown in SEQ ID NO:1 formed by substitution, deletion, or addition of one or more amino acids to form an amino acid sequence with equivalent function.
[0047] In some embodiments, the amino acid sequence of the glycosyl hydrolase has 85% or more, preferably 90% or more, more preferably 92% or more, even more preferably 95% or more, further preferably 98% or more, and even more preferably 99% or more homology with the sequence shown in SEQ ID NO:1, and originates from the same species, Panax notoginseng. In other embodiments, the glycosyl hydrolase may be produced by recombinant cells containing the gene encoding the enzyme, and may be located intracellularly or secreted extracellularly. In this application, "homology" refers to the similarity between two sequences, which can be determined by any algorithm known in the art. For example, the degree of identity between two amino acid sequences can be determined using the Needleman-Wunsch algorithm. The amino acid sequence SEQ ID NO:1 is sometimes abbreviated as "PnGH1".
[0048] The glycosyl hydrolase of the present invention may be derived from ginseng plants and has a homologous amino acid sequence of the glycosyl hydrolase described in (a) or (b) as described above. Preferably, the glycosyl hydrolase has at least 80% similarity to the glycosyl hydrolase described in (a) or (b).
[0049] Glycosyl hydrolases can be any of the following:
[0050] (c) Glycosyl hydrolases with amino acid sequences as shown in SEQ ID NO:4;
[0051] (d) A glycosyl hydrolase derived from (c) with equivalent function formed by replacing, deleting or adding one or more amino acids of the amino acid sequence shown in SEQ ID NO:4.
[0052] (e) Glycosyl hydrolases with amino acid sequences as shown in SEQ ID NO:6;
[0053] (f) A glycosyl hydrolase derived from (e) with equivalent function formed by replacing, deleting or adding one or more amino acids of the amino acid sequence shown in SEQ ID NO:6.
[0054] In certain specific embodiments, a glycosyl hydrolase obtained from ginseng (scientific name: Panax ginseng CAMeyer), the amino acid sequence of which is shown in SEQ ID NO:4 (hereinafter sometimes simply referred to as "PgGH1"). The glycosyl hydrolase encoded by the amino acid sequence of SEQ ID NO:4 has similar selective hydrolytic activity to PnGH1.
[0055] In other specific embodiments, a glycosyl hydrolase obtained from American ginseng (scientific name: Panax quiquefolium L.) with the amino acid sequence shown in SEQ ID NO:6 (hereinafter sometimes referred to as "PqGH1") is used. The glycosyl hydrolase encoded by the amino acid sequence of SEQ ID NO:6 has similar selective hydrolytic activity to PnGH1.
[0056] The present invention also provides a nucleotide sequence encoding the above-described glycosyl hydrolase. In some embodiments, the nucleotide sequence encoding (a) the glycosyl hydrolase is shown in SEQ ID NO:2. In other embodiments, the nucleotide sequence encoding (c) the glycosyl hydrolase is shown in SEQ ID NO:3. In some embodiments, the nucleotide sequence encoding (e) the glycosyl hydrolase is shown in SEQ ID NO:5.
[0057] <Recombinant Expression Vectors and Recombinant Host Cells>
[0058] The gene encoding the aforementioned glycosyl hydrolase was cloned into an expression vector to construct a recombinant expression vector. The expression vector used could be pET32a.
[0059] The gene encoding the aforementioned glycosyl hydrolase or the aforementioned recombinant expression vector is expressed in a host cell to form a recombinant host cell. The host cell used is selected from bacteria, actinomycetes, filamentous fungi, yeast, plant cells, or animal cells. Preferably, the host cell used is *Escherichia coli*.
[0060] <Application>
[0061] This invention also provides the application of any one of the glycosyl hydrolase, nucleotide sequence, recombinant expression vector, and recombinant host cell described above in the selective hydrolysis of the glucose group at the third carbon of PPD-type ginsenosides. The glucose group at the third carbon of PPD-type ginsenosides present in various monomers, mixtures, and biological samples can be selectively hydrolyzed.
[0062] In this invention, PPD-type ginsenosides include notoginsenoside R4, ginsenoside Ra1, ginsenoside Ra2, ginsenoside Ra3, ginsenoside Rb1, ginsenoside Rb2, ginsenoside Rb3, ginsenoside Rc, ginsenoside Rd, and ginsenoside Rg3.
[0063] In some embodiments, PPD-type ginsenosides are one or more of the following: notoginsenoside R4, ginsenoside Ra1, ginsenoside Ra2, ginsenoside Ra3, ginsenoside Rb1, ginsenoside Rb2, ginsenoside Rb3, ginsenoside Rc, ginsenoside Rd, and ginsenoside Rg3.
[0064] According to one embodiment of the present invention, the PPD-type ginsenoside is a mixture of dammarane-type ginsenosides with a β-1,2-glucose group at the 3rd carbon. This ginsenoside mixture may be derived from plant tissues, cells, or microbial cell cultures of the genus *Panax*.
[0065] According to a preferred embodiment of the present invention, the PPD-type ginsenoside is ginsenoside Rb3.
[0066] In this invention, PnGH1 can selectively hydrolyze notoginsenoside R4, ginsenoside Ra1, ginsenoside Ra2, ginsenoside Ra3, ginsenoside Rb1, ginsenoside Rb2, ginsenoside Rb3, ginsenoside Rc, ginsenoside Rd, and ginsenoside Rg3. The raw materials and selective hydrolysis products are shown in Tables 1 and 2. Rare saponins can be prepared.
[0067] Table 1. Substrates for PnGH1-catalyzed hydrolysis of PPD-type ginsenosides
[0068]
[0069] Table 2. PnGH1-catalyzed conversion products of PPD-type ginsenosides
[0070]
[0071] The correspondence between the substrate raw materials in Table 1 and the conversion products in Table 2 is explained in Table 3.
[0072] Table 3
[0073]
[0074] In this invention, the selective hydrolysis reaction includes the following steps: mixing a solution containing glycosyl hydrolase with a substrate (PPD type ginsenoside), reacting at 35-55°C for 1-55 h, terminating the reaction, and centrifuging; wherein the mass ratio of glycosyl hydrolase to substrate is 1:8-16, preferably 1:10-15, and more preferably 1:12-14.
[0075] In some embodiments, the reaction system of the present invention may further include a buffer solution. The buffer solution may be Tris-HCl, 0.5 mM, pH = 7.4.
[0076] In some implementations, the reaction system, in 100 μL, contains 50 μM substrate, 2–5 μg glycosyl hydrolase, and 20 mM buffer, as well as a scaled-up reaction system.
[0077] In this invention, methanol, ethanol, etc. can be used to terminate the reaction.
[0078] The reaction temperature can be 35–55°C, preferably 40–55°C, and more preferably 50–55°C. The reaction time can be 1–55 h, preferably 1.5–50 h, and more preferably 2–12 h.
[0079] According to one embodiment of the present invention, a solution containing glycosyl hydrolase is mixed with a substrate (PPD type ginsenoside), and the mixture is reacted at 45-50°C for 1-10 hours, the reaction is terminated, and the mixture is centrifuged.
[0080] Example 1 Glycosyl hydrolase PnGh1 and the acquisition of its encoding genes
[0081] Fresh Panax notoginseng leaf tissue was selected, and total RNA was extracted using a liquid nitrogen quick-freezing and grinding method and an RNA extraction kit. RNA quality was initially assessed by gel electrophoresis, and RNA concentration was determined using a Nanodrop 2000 spectrophotometer. After passing gel electrophoresis analysis and concentration determination, a portion of the extracted RNA was submitted for transcriptome sequencing, while the other portion was used for reverse transcription amplification of cDNA templates.
[0082] 1 μL of Panax notoginseng leaf RNA (10 pg - 5 μg) was placed in an RNase-free centrifuge tube (200 μL), 7 μL of dd H2O was added, and the mixture was heated at 65 °C for 5 min. The tube was then rapidly cooled on ice and incubated for 2 min. 2 μL of 5×g DNA wiper Mix was added to the mixture from the previous step, and the mixture was gently pipetted in. The mixture was heated at 42 °C for 2 min. Then, 2 μL of 10×RT Mix, 2 μL of HiScript III Enzyme Mix, 1 μL of Oligo(dT)20VN, and 5 μL of dd H2O were added to the 20 μL mixture. The mixture was gently pipetted in, and reverse transcription was performed on a PCR instrument at 37 °C for 45 min and then at 85 °C for 5 s to obtain cDNA. Using reverse-transcribed Panax notoginseng leaf cDNA as a template, specific primers were designed and synthesized based on transcriptome sequencing results. The forward primer was ATGCTCAGCCCTGCTCTTGT, and the reverse primer was TTAAGATGAACTTGTCGTAATATGGG. PCR amplification was performed using Phanta Super-Fidelity DNA Polymerase. The amplification reaction system consisted of: forward primer (10 μM): 2 μL; reverse primer (10 μM): 2 μL; cDNA template: 1 μL; dNTP Mix (10 mM): 1 μL; Phanta Super-Fidelity DNA Polymerase: 1 μL; 5×SF Buffer: 10 μL; dd H2O: 33 μL; total 50 μL. The amplification program was: 95℃, 3 min; 95℃, 10 s, 58℃, 15 s, 72℃, 1 min, 35 cycles; 72℃, 5 min. The PCR product was recovered using a product recovery kit to obtain the full-length sequence of PnGh1. The agarose gel electrophoresis image is shown below. Figure 1 As shown.
[0083] Example 2: Screening, construction, and expression of recombinant plasmids
[0084] The target gene PnGh1 obtained from Example 1 was ligated with the expression vector pET32a using ClonExpress seamless cloning ligase at 37°C for 30 min according to the seamless cloning ligation system. The ligation product was transformed into competent cells of the cloning strain Trans1-T1Phage Resistant and cultured overnight. After colony PCR screening, the positive clones were amplified and cultured in LB medium (containing ampicillin, 100 mg / mL). The cells were collected, and plasmids were extracted using a plasmid miniprep kit and sequenced to verify the sequence.
[0085] The correctly sequenced recombinant plasmid pET32a-PnGh1 was transformed into the E. coli expression strain E. coli Transetta (DE3). The cells were screened and cultured on LB solid medium plates containing ampicillin. Single colonies that were positive and correctly sequenced by colony PCR were picked and cultured in small quantities in LB liquid medium and activated overnight at 37°C (containing ampicillin, 100 mg / mL).
[0086] The activated bacterial culture was cultured at a ratio of 1:100 (V / V) in LB liquid medium (containing ampicillin, 100 mg / mL) and cultured at 37°C until OD reached. 600 When the value is between 0.4 and 0.6, add IPTG to a final concentration of 0.5 mM, continue low-temperature culture at 18°C and induce expression for 18 h. Collect bacterial cells by centrifugation (7500×g) at 4°C for 5 min, resuspend the collected bacterial cells in pre-chilled lysis buffer, add 1% (v / v) glycerol, and sonicate on ice for 10 min using a program of 2 s lysis, 4 s pause. Centrifuge the lysate at 8000×g at 4°C for 40 min, collect the supernatant containing the target protein, purify PnGH1 protein using a nickel affinity chromatography column, elute the target protein with a 20–500 mM imidazole gradient, combine the fractions containing the target protein, concentrate by centrifugation in Centricon Plus-30 Millipore ultrafiltration centrifuge tubes, elute with desalting buffer to remove imidazole, concentrate to an appropriate concentration, aliquot and store at -80°C. Detect protein purity by SDS-PAGE gel electrophoresis, and the results are as follows. Figure 2 As shown, protein concentration was simultaneously determined using the BCA method.
[0087] Example 3 Glycosyl hydrolases PnGH1 Hydrolysis of ginsenoside Rb3 yields notoginsenosides. Fd
[0088] Using ginsenoside Rb3 as a substrate, an in vitro enzymatic reaction was carried out with the action of PnGH1 enzyme. The enzyme reaction products were analyzed using LCMS-IT-TOF. A 100 μL system contained enzyme (PnGH1, 0.03 μg / μL), substrate (ginsenoside Rb3, 0.5 mM), and buffer (Tris-HCl, 0.5 mM, pH 7.4). The reaction was carried out in a water bath at 50 °C for 2 h. The reaction was terminated by adding 2 times the volume of methanol, and after shaking to mix, the mixture was centrifuged at 12,000 rpm for 30 min. The supernatant was collected for liquid chromatography analysis. 20 μL was injected into an Agilent 1260 analytical high-performance liquid chromatograph for analysis, and 15 μL was injected into an LCMS-IT-TOF liquid chromatography-mass spectrometry system for analysis.
[0089] Liquid chromatography conditions: Column: Aglient C 18The column (4.6 mm × 250 mm, 5 μm) was used with a flow rate of 0.8 mL / min. A DAD detector was used for full-wavelength scanning. The mobile phase consisted of a gradient elution of 0.1% formic acid water (A) and acetonitrile (B). The elution program was as follows: 0–3 min, 15% B; 3–12 min, 15%–35% B; 12–18 min, 35%–40% B; 18–23 min, 40%–50% B; 23–25 min, 50%–95% B; 25–35 min, 95%–15% B.
[0090] Liquid chromatography-mass spectrometry (LC-MS) conditions: Column: Agilent Extend C 18 The chromatographic column (4.6 mm × 250 mm, 5 μm) was used at a flow rate of 0.8 mL / min. A full-wavelength scan was performed using an SPD-M20A detector. The mobile phase consisted of a gradient elution of acetonitrile and 0.1% formic acid in water, with the same elution program as the liquid chromatography program. The product structure was analyzed based on the mass spectrometry data of the enzyme reaction product and by comparison with the mass spectrometry data of the standard. The enzyme reaction product was identified as notoginsenoside Fd. The NMR data of the product are as follows:
[0091] HR-ESI-MS provides [M+HCOO] - Peak, m / z: 961.5378, predicted molecular formula is C 47 H 80 O 17 . 1 ¹H NMR (500MHz, pyridine-d5)δ H : 4.06(1H,m,H-1a), 2.83(1H,overlap,H-1b), 2.40(1H,overlap,H-2a), 1.44(1H,overlap,H-2b), 2.59(1H,overlap,H-3a), 2.42(1H,overlap,H-3b), 2.63(1H,overlap,H-6a), 2.32(1H,d,J=19.0Hz,H-6b), 1.98(1H,overlap,H-8a), 1.98(1H,overlap,H-8b), 3.87( 1H,m,H-9a), 3.20(1H,m,H-9b), 2.71(1H,overlap,H-10a), 1.98(1H,overlap,H-10b), 2.83(1H,overlap,H-11a), 2.71(1H,overlap,H-11b), 2.51(1H,overlap,H-14a), 1.90(1H,d,J=15.0Hz,H-14b), 2.09(1H,m,H-15), 1.13(3H,d,J=6.5Hz,H3-16). 13 C NMR (125 MHz, pyridine-d5)δ C:39.4(C-1), 26.2(C-2), 89.1(C-3), 39.8(C-4), 56.7(C-5), 18.7(C-6), 35.3(C-7), 40.3( C-8), 50.6(C-9), 37.3(C-10), 31.1(C-11), 70.4(C-12), 49.5(C-13), 51.8(C-14), 31.2(C- 15), 27.2(C-16), 52.0(C-17), 16.3(C-18), 16.7(C-19), 83.8(C-20), 36.8(C-21), 36.8(C -22), 23.5(C-23), 126.4(C-24), 131.4(C-25), 26.9(C-26), 18.3(C-27), 28.5(C-28), 17.2 (C-29), 17.8(C-30), 107.4(C-glc-1'), 75.3(C-glc-2'), 79.8(C-glc-3'), 71.5(C-glc-4 '), 78.8(C-glc-5'), 63.9(C-glc-6'), 98.5(C-glc-1”), 75.3(C-glc-2”), 78.4(C-glc-3”) The values were 72.3 (C-glc-4”), 77.4 (C-glc-5”), 71.5 (C-glc-6”), 106.3 (C-glc-1”’), 76.2 (C-glc-2”’), 79.2 (C-glc-3”’), 72.0 (C-glc-4”’), and 68.1 (C-glc-5”’). Comparative analysis with literature data identified the enzyme reaction product as notoginsenoside Fd.
[0092] Example 4: Glycosyl hydrolase PnGH1 hydrolyzes other PPD-type ginsenosides
[0093] The reaction products were analyzed by LC-MS to identify the products obtained after selective hydrolysis of different substrates. The results showed that PnGH1 could catalyze the hydrolysis of the glycosyl group at the C-3 position (3rd carbon) of the protopanaxadiol-type triterpenoid saponins, including ginsenoside Rb1, ginsenoside Rb2, ginsenoside Ra1, ginsenoside Ra2, ginsenoside Ra3, ginsenoside Rc, ginsenoside Rd, ginsenoside Rg3, and notoginsenoside R4 (see Tables 1, 2, and 3 above). Furthermore, when the reaction time was extended to 48 h, the substrates could be completely converted. EIC analysis is shown below. Figure 3 As shown.
[0094] Example 5: Stability assessment of PnGH1 protein
[0095] Prepare precise standard stock solutions of ginsenoside Rb3 and notoginsenoside Fd with a concentration of 1 mg / mL for later use. Set up different groups according to the following requirements, with each system consisting of 100 μL:
[0096] Control group: 100 μL system containing enzyme (PnGH1, 0.03 μg / μL);
[0097] The control group contained ginsenoside Rb3: 100 μL of system containing substrate (ginsenoside Rb3, 0.5 mM); the control group contained notoginsenoside Fd: 100 μL of system containing product (notoginsenoside Fd, 0.5 mM).
[0098] Protein drying group: 100 μL system contains drying rehydration enzyme (PnGH1 protein solution dried at 70℃, powder rehydrated by vortexing with ddH2O, 0.03 μg / μL) and substrate (ginsenoside Rb3, 0.5 mM);
[0099] Protein drying group: 100 μL system contains drying rehydration enzyme (PnGH1 protein solution dried at room temperature, powder rehydrated by vortexing with ddH2O, 0.03 μg / μL) and substrate (ginsenoside Rb3, 0.5 mM).
[0100] The protein lyophilized group: 100 μL system contains lyophilized rehydratase (PnGH1 protein solution was lyophilized, powder was rehydrated by vortexing with ddH2O, 0.03 μg / μL), substrate (ginsenoside Rb3, 0.5 mM);
[0101] Protein inactivation group: 100 μL system contains inactivating enzyme (PnGH1, 0.03 μg / μL, heated at 99℃ for 10 min and then cooled on ice) and substrate (ginsenoside Rb3, 0.5 mM);
[0102] Experimental group: 100 μL system contains enzyme (PnGH1, 0.03 μg / μL) and substrate (ginsenoside Rb3, 0.5 mM);
[0103] The above groups were incubated in a water bath at 50°C for 2 hours; the reaction was terminated by adding 200 μL of methanol, and the products were detected according to the method in Example 3. Results are shown below. Figure 4 As shown. Figure 4 The following assays were performed: (I) Reaction of protein dried at 70℃ with ginsenoside Rb3; (II) Reaction of protein solution dried at room temperature (approximately 30℃) with ginsenoside Rb3; (III) Reaction of protein solution freeze-dried at -80℃ with ginsenoside Rb3; (IV) Reaction of protein heated at 99℃; (V) Reaction of PnGH1 protein with ginsenoside Rb3; (VI) Ginsenoside Rb3 standard; (VII) Panax notoginseng saponin Fd standard.
[0104] Conclusion: PgGH1 has the function of stably catalyzing the conversion of ginsenoside Rb3 to notoginsenoside Fd. It can still maintain a high catalytic function at 50℃, but it is deactivated after drying at 70℃.
[0105] Example 6: Catalytic activity of PnGH1 homologous protein from the Panax genus on ginsenoside Rb3
[0106] Following the method in Example 1, two homologous sequences, PgGH1 and PqGH1, were found in ginseng and American ginseng, respectively. Their amino acid sequences are shown in the sequence listing SEQ ID NO:4 and SEQ ID NO:6, with similarities of 88.28% and 90.11% to PnGH1, respectively. A comparison of the sequence listings of the three sequences is shown in [link to sequence listing]. Figure 7 Following the method in Example 1, RNA was extracted from ginseng and American ginseng and reverse transcribed into cDNA. Specific primers were designed and synthesized based on the base sequences (see Table 4, sequence listing as SEQ ID NO:7). Following the methods in Examples 2 and 3, proteins PgGH1 and PqGH1 were expressed and isolated, and it was verified that both could hydrolyze the glucose group outside the third carbon of Rb3. HPLC analysis is shown below. Figure 5 .
[0107] Table 4
[0108]
[0109] Example 7 Key Catalytic Sites of PnGH1, PgGH1, and PqGH1
[0110] To investigate the key catalytic sites of PnGH1, this application conducted a mutation experiment. Using the specific primers in Table 4, and with pET32a-PnGh1 plasmid as a template, amplification was performed using Vazyme 2×TransStart FastPfu Fly PCR SuperMix. The amplification system and PCR program are shown in Table 5. 10 μL of the PCR product was taken, and the band size was detected by 1% agarose gel electrophoresis. When the target band size was correct, 1 μL of LMT enzyme was added to the PCR product, mixed well, and incubated at 37°C for 1 h. 5 μL of the LMT enzyme digestion product was then transformed into DMT competent cells. Positive mutant single clones were obtained by colony PCR and sequencing verification. The plasmid of the positive mutant was extracted using Vazyme DC201-01 and transformed into the Transetta(DE3) expression strain.
[0111] Table 5. Mutant Construction System and Procedure
[0112]
[0113] Next, following the method in Example 2, mutant proteins E188A, E188D, E232A, E232D, E425A, and E425D were expressed and isolated, and the activity of the mutants was tested according to the method in Example 3. The activity was as follows: Figure 6 As shown.
[0114] Glycoside hydrolases are catalyzed by two amino acid residues: one is a proton donor, and the other is a carboxylic acid residue (glutamate or aspartic acid) that acts as a nucleophile. Figure 5 It is evident that mutating glutamic acid (Glu, E) at positions 188, 232, and 425 to alanine (Ala, A) almost completely eliminates the activity of PnGH1 compared to the wild-type (WT) form. However, mutating these sites to another acidic amino acid, aspartic acid (Asp, E), restores the activity to varying degrees. Therefore, glutamic acid at positions 188, 232, and 425 can be identified as key sites for PnGH1's glucose hydrolysis, with glutamic acid at position 425 being particularly important. Even when glutamic acid at position 425 is replaced by aspartic acid, its activity remains low, possibly due to spatial deformation. While it can act as a nucleophile, it hinders substrate binding, resulting in low activity.
[0115] Comparative analysis of two genes with the same function in American ginseng and ginseng revealed that glutamic acid is present at positions 188, 232, and 425 (using PnGH1 as the reference site) (see SEQ ID NO:7 in the sequence listing). Therefore, these three amino acids can be considered key sites for the hydrolysis of PPD-type ginsenosides by this protein, specifically the glucose atom outside the third carbon. This also proves that these three amino acid sequences are homologous proteins with the same catalytic function and mechanism.
[0116] This invention is not limited to the above-described embodiments. Any modifications, improvements, or substitutions that can be conceived by those skilled in the art without departing from the essential content of this invention fall within the scope of this invention.
Claims
1. A glycosyl hydrolase for selectively hydrolyzing the glucose group at the 3rd carbon of PPD-type ginsenosides, characterized in that, The glycosyl hydrolase is (a), (c), or (e): (a) A glycosyl hydrolase with an amino acid sequence as shown in SEQ ID NO:1; (c) A glycosyl hydrolase with an amino acid sequence as shown in SEQ ID NO: 4; (e) Glycosyl hydrolases with amino acid sequences as shown in SEQ ID NO:
6.
2. The nucleotide sequence encoding the glycosyl hydrolase of claim 1.
3. The nucleotide sequence according to claim 2, characterized in that, The nucleotide sequence encoding (a) of the glycosyl hydrolase is shown in SEQ ID NO:2; the nucleotide sequence encoding (c) of the glycosyl hydrolase is shown in SEQ ID NO:3; and the nucleotide sequence encoding (e) of the glycosyl hydrolase is shown in SEQ ID NO:
5.
4. A recombinant expression vector, characterized in that, The recombinant expression vector contains the nucleotide sequence as described in claim 2 or 3.
5. A recombinant host cell, characterized in that, The recombinant host cell contains the nucleotide sequence of claim 2 or the recombinant expression vector of claim 4.
6. The recombinant host cell according to claim 5, characterized in that, The host cells used are selected from bacteria, actinomycetes, filamentous fungi, yeast, plant cells, or animal cells.
7. The use of any one of the glycosyl hydrolase of claim 1, the nucleotide sequence of claim 2 or 3, the recombinant expression vector of claim 4, and the recombinant host cell of claim 5 or 6 in the selective hydrolysis of the glucose group at the 3rd carbon of PPD-type ginsenosides.
Citation Information
Patent Citations
Rhodanobacter ginsenosidimutans kctc22231t-derived ginsenoside glycosidase, and use thereof
CN102762738A
Enzymatic synthesis method of ginsenoside Rh2
CN108064309A
Enzymatic modification of saponins
CN119403935A