Primers for triple pcr detection of morganella morganii, proteus vulgaris and providencia rettgeri and detection method thereof
By designing and optimizing triple PCR detection primers, the problem of rapid detection of Morganella morganii, Proteus vulgaris, and Providencia reticularis in urinary tract infections of Yangtze alligators has been solved, achieving efficient and sensitive pathogen detection, which is suitable for the prevention and control of gout in Yangtze alligators.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- NANJING AGRICULTURAL UNIVERSITY
- Filing Date
- 2024-02-27
- Publication Date
- 2026-06-09
AI Technical Summary
Existing technologies are insufficient for the rapid and accurate detection of Morganella morganii, Proteus vulgaris, and Providencia reticularis in urinary tract infections in Chinese alligators. This results in a lengthy and cumbersome diagnosis of gout in Chinese alligators, and the detection methods for pathogens are not sensitive or specific enough.
Triple PCR primers and detection methods for Morganella morganii, Proteus vulgaris, and Providencia reticularis were designed and optimized. By adding multiple pairs of specific primers to the same PCR reaction system, and using the antigen protein gene of Morganella morganii, the urease gene of Proteus vulgaris, and the tryptophan operon gene of Providencia reticularis as target genes, the primer concentration, annealing time, and annealing temperature of the reaction system were optimized to achieve efficient and rapid triple PCR detection.
It enables rapid and accurate detection of the pathogen causing gout in Yangtze alligators, improves detection speed and sensitivity, simplifies the operation process, is suitable for the detection of large numbers of samples, and has broad application potential.
Smart Images

Figure CN118109617B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of veterinary medicine, and in particular relates to primers and detection methods for triple PCR detection of Morganella morganii, Proteus vulgaris, and Providencia reticularis. Background Technology
[0002] Under artificial breeding conditions, gout frequently occurs in Yangtze alligators, and the age of onset is getting younger and younger. In the early stages, there are no obvious symptoms, while in the later stages, symptoms such as motor impairment and slow movement appear. There is no specific treatment for this disease, and the mortality rate is high. The occurrence of gout in Yangtze alligators is related to multiple factors, such as a high-purine diet and genetics. Infectious factors are also an important one; any pathogenic microorganism that can cause kidney damage can potentially cause impaired excretion of urate in the body, thereby triggering gout.
[0003] Gout is closely related to kidney damage. When the kidneys are damaged, the body's uric acid excretion is impaired, leading to gout. One of the most common causes of kidney damage is urinary tract infection (UTI), which is frequently caused by Gram-negative bacteria. Escherichia coli is the primary pathogen, followed by Proteus, Morganella morganii, and Providencia reticularis. Gram-negative bacteria can cause UTIs because they express various virulence factors related to adhesion, motility, biofilm formation, immune avoidance, and nutrient acquisition, as well as factors that damage the host. After attaching to the bladder via pili, the motile cells differentiate into colony cells and further migrate upwards along the ureter to the kidneys. Under the influence of adhesins, Proteus colonies the renal epithelial cells. Once attached, the colony cells secrete large amounts of urease and hemolysin, leading to inflammation, cell damage, and stone formation. In recent years, opportunistic infections, especially urinary tract infections, have increased due to the increased virulence and antibiotic resistance of *Morganella morganii* and *Providencedium repens*. The Chinese alligator is a poikilothermic animal with a long hibernation period. During this time, it stops eating, and its physiological metabolic activity, immune function, and disease resistance are greatly reduced. When water quality deteriorates or feed spoils, its resistance to disease decreases. Therefore, under the stimulation of various pathogens that can cause urinary tract infections, the likelihood of gout in Chinese alligators increases significantly.
[0004] Therefore, providing a detection primer and detection method that can rapidly detect these three pathogens is of great practical significance for the prevention and control of gout in the Yangtze alligator. Summary of the Invention
[0005] Purpose of the invention: In order to solve the above-mentioned technical problems, the present invention aims to provide primers and detection methods for triple PCR detection of Morganella morganii, Proteus vulgaris and Providencia reticularis. This detection method can promptly identify pathogenic microorganisms that promote the occurrence of gout in Chinese alligators, and take corresponding prevention and control measures in a timely manner, thus solving the problems of long time consumption, cumbersome operation and time-consuming and labor-intensive nature in disease diagnosis.
[0006] Technical solution: In order to achieve the above objectives, the present invention provides primers for triple PCR detection of Morganella morganii, Proteus vulgaris, and Providencia reticularis, wherein the primers are Mm-F, Mm-R, ureC-F, ureC-R, trpD-F, and trpD-R, respectively, and their nucleotide sequences are shown in SEQ ID NO.1 to 6.
[0007] This invention also provides a triple PCR detection method for detecting Morganella morganii, Proteus vulgaris, and Providencia reticularis, comprising the following steps: using a mixture of bacterial genomic DNA extracted from Morganella morganii, Proteus vulgaris, and Providencia reticularis as a DNA template, performing PCR amplification with three pairs of primers, and observing the electrophoresis results.
[0008] Furthermore, the PCR reaction system includes 2×RapidTaq Master Mix, upstream and downstream primers for Morganella morganii (Mm-F, Mm-R), upstream and downstream primers for Proteus vulgaris (ureC-F, ureC-R), and upstream and downstream primers for Providencia reticularis (trpD-F, trpD-R). The mixture of the genomic DNA of the three bacteria serves as the DNA template, and ddH2O is added.
[0009] Further, the PCR reaction system is as follows: 12.5-15 μL of 2×Rapid Taq Master Mix, 1.6-2 μL each of Morganella morganii upstream and downstream primers (Mm-F, Mm-R), 0.4-0.8 μL each of Proteus vulgaris upstream and downstream primers (ureC-F, ureC-R), 0.4-0.8 μL each of Providencia reticularis upstream and downstream primers (trpD-F, trpD-R), 1-2 μL of the three bacterial genomic DNA mixed in equal volumes as template, and the remainder made up to 25-35 μL with ddH2O.
[0010] Furthermore, the concentrations of the primers for Morganella morganii, Proteus vulgaris, and Providencia reticularis are 0.08–0.64 μmol / L, 0.08–0.64 μmol / L, and 0.08–0.64 μmol / L, respectively.
[0011] Furthermore, the PCR reaction program is as follows: pre-denaturation at 90–95℃ for 5–10 min; denaturation at 90–95℃ for 10–15 s, annealing at 49.4℃–61℃ for 10–45 s, extension at 72–75℃ for 30–50 s, for a total of 22–36 cycles; final extension at 72–75℃ for 10–15 min.
[0012] Preferably, the triple PCR detection method for simultaneously detecting Morganella morganii, Proteus vulgaris, and Providencia reticularis includes the following steps:
[0013] (1) Preparation of template DNA: Genomic DNA was extracted according to the kit instructions. The concentration of the obtained DNA product was determined using Nanodrop 2000 software, and the concentration and OD were recorded. 260 / 280 The genome was stored at -20°C.
[0014] (2) PCR amplification and identification: Using bacterial genomic DNA extracted from three strains as templates, PCR amplification was performed in a PCR system with a total reaction volume of 25 μL using three pairs of primers. The reaction system consisted of: 12.5 μL of 2×RapidTaq Master Mix, 1.6 μL each of upstream and downstream primers for Morganella morganii, 0.4 μL each of upstream and downstream primers for Proteus vulgaris, 0.4 μL each of upstream and downstream primers for Providencia reticularis, 1 μL of template, and the remainder was brought to 25 μL with ddH2O.
[0015] The reaction program was as follows: pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 15 s, annealing at 54.3℃ for 15 s, extension at 72℃ for 30 s, for a total of 36 cycles; final extension at 72℃ for 10 min.
[0016] Finally, 10 μL of the amplification product was added to a 1.5% agarose gel, electrophoresed at 160 V for 15 min, and then placed in a gel imaging system to observe the electrophoresis results.
[0017] The application of the primers described in this invention in detecting the pathogen of the Chinese alligator gouty disease.
[0018] The invention relates to the application of the detection method in detecting tissue samples or environmental samples of Chinese alligators.
[0019] Among them, the detection method of the present invention is applied to the detection of pathogenic bacteria in Chinese alligators suffering from gout.
[0020] Furthermore, the application process for detecting the pathogenic bacteria of gout in Yangtze alligators is as follows: using bacterial genomic DNA extracted from strains of *Morganella morganii*, *Proteus vulgaris*, and *Providencera reticularis* as templates, PCR amplification is performed in a PCR system using the three pairs of primers. The amplification products are then subjected to gel electrophoresis. By observing the electrophoretic detection pattern and comparing it with the standard molecular weight, if a band appears at 857 bp in the sample, it proves that *Morganella morganii* is present in the sample; if a band appears at 388 bp, it proves that *Proteus vulgaris* is present in the sample; and if a band appears at 479 bp, it proves that *Providencera reticularis* is present in the sample.
[0021] This invention utilizes multiple pairs of specific primers in the same PCR reaction system for PCR amplification and detection. This method is characterized by high specificity and sensitivity, and it greatly improves the detection speed of mixed pathogens, making it suitable for the detection of large numbers of samples.
[0022] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:
[0023] This invention designs three pairs of primers based on the conserved sequence of the antigen protein gene of *Morganella morganii*, the urease gene *ureC* of *Proteus vulgaris*, and the tryptophan operon gene *trpD* of *Providence bacillus reticularis*, establishing a highly specific, sensitive, rapid, and accurate triplet PCR detection method. This method is used for clinical and laboratory PCR detection of *Morganella morganii*, *Proteus vulgaris*, and *Providence bacillus reticularis* in alligator gout, and has broad application potential in rapid pathogen detection and epidemiological investigation of alligator gout.
[0024] This invention optimizes the primer concentration, annealing time, and annealing temperature of the triple PCR reaction system, enabling efficient amplification of the target bands of Morganella morganii, Proteus vulgaris, and Providencia reticularis, while avoiding non-specific amplification between primers.
[0025] The triple PCR detection method of this invention can be used for the identification and detection of mixed infections of Morganella morganii, Proteus vulgaris, and Providencia reticularis, and can be completed in one step, making the operation simple and quick. Attached Figure Description
[0026] Figure 1 The figure shows the results of the annealing temperature optimization, where M represents the DNA standard DL 2000; 1-8 represent annealing temperatures of 49.4℃, 50.7℃, 52.6℃, 54.3℃, 56.1℃, 57.8℃, 59.7℃, and 61℃, respectively.
[0027] Figure 2The result of annealing time optimization is shown in the figure, where M: DNA standard DL 2000; 1-8: annealing times are 10s, 15s, 20s, 25s, 30s, 35s, 40s, and 45s, respectively.
[0028] Figure 3 The figure shows the optimized concentrations of single PCR primers for three bacteria, where M represents DNA standard DL 2000; 1-8 represent primer concentrations of 0.08 μmol / L, 0.16 μmol / L, 0.24 μmol / L, 0.32 μmol / L, 0.4 μmol / L, 0.48 μmol / L, 0.56 μmol / L, and 0.64 μmol / L, respectively; A represents Morganella morganii; B represents Proteus vulgaris; and C represents Providencia reticularis.
[0029] Figure 4 The figure shows the results of primer concentration optimization, where M represents DNA standard DL 2000; and 1-8 represent primer concentration (μmol / L) combinations for Morganella morganii, Proteus vulgaris, and Providencia reticularis: 0.64, 0.16, 0.16; 0.64, 0.16, 0.24; 0.64, 0.24, 0.16; 0.64, 0.24, 0.24; 0.56, 0.16, 0.16; 0.56, 0.16, 0.24; 0.56, 0.24, 0.16; 0.56, 0.24, 0.24.
[0030] Figure 5 The graph shows the results of the cycle number optimization, where M represents the DNA standard DL 2000; and 1-8 represent cycle numbers of 22, 24, 26, 28, 30, 32, 34, and 36, respectively.
[0031] Figure 6 This is a sensitivity detection graph, where M: DNA standard DL 2000; 1-8: 10% of the mixed DNA. 0 ~10 7 Serial dilution;
[0032] Figure 7 This is a specific detection diagram, where M: DNA standard DL 2000; 1: Morganella morganii + Proteus vulgaris + Providencia reticularis; 2: Morganella morganii + Proteus vulgaris; 3: Morganella morganii + Providencia reticularis; 4: Proteus vulgaris + Providencia reticularis; 5: Lactococcus lactis; 6: Aeromonas hydrophila; 7: Staphylococcus hemolyticus; 8: Bacillus cereus; 9: Acinetobacter johnsonii; 10: Zygophora fluvialis; 11: ddH2O. Detailed Implementation
[0033] The technical solution of the present invention will be further described below with reference to the accompanying drawings.
[0034] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. Experimental methods not specifically described in the examples are generally performed under standard conditions or as recommended by the manufacturer.
[0035] Lactococcus lactis, Aeromonas hydrophila, Staphylococcus hemolyticus, Bacillus cereus, Acinetobacter johnsonii, and Zygophora riverine were all preserved and provided by the Veterinary Microbiology Laboratory of the College of Veterinary Medicine, Nanjing Agricultural University.
[0036] 2×RapidTaq Master Mix: Purchased from Nanjing Novizan Biotechnology Co., Ltd. (P222-01);
[0037] Bacterial genome extraction kit: purchased from Nanjing Novizan Biotechnology Co., Ltd. (DC112-01);
[0038] DNA Standard DL 2000: Purchased from Nanjing Novizan Biotechnology Co., Ltd. (MD101-01).
[0039] Example 1
[0040] Primer design
[0041] Based on sequence information in GenBank and referring to relevant literature, conserved sequences of antigen protein genes from *Morganella morganii* (Gen Registry No.: NZ_LR699007.1), urease genes from *Proteus vulgaris* (Gen Registry No.: NZ_CP023965.1), and tryptophan operon genes from *Providence bacillus* (Gen Registry No.: NZ_AP022375.1) were used as target genes. PCR primers for amplifying the corresponding genes were synthesized at Shanghai Sangon Biotech Co., Ltd. (sequences shown in SEQ ID NO. 1-6).
[0042] Table 1 Information on synthetic primers
[0043]
[0044]
[0045] As shown in Table 1, Mm-F: ATGCATTATGATACCCATCAGA (SEQ ID NO.1);
[0046] Mm-R: TCATTCACCCTTATGAAAGA (SEQ ID NO. 2);
[0047] ureC-F: TGGCGACCGTCTGCGATTAG (SEQ ID NO.3);
[0048] ureC-R:ACCTTCTTGTGCTTGTTGAG(SEQ ID NO.4);
[0049] trpD-F: CTTTCCCCGCCCTGACTACC (SEQ ID NO.5);
[0050] trpD-R: AAACCTCATCCATCCCTCCA (SEQ ID NO. 6).
[0051] Example 2
[0052] Optimal annealing temperature screening
[0053] The reaction system consisted of 25 μL, including 12.5 μL of 2×RapidTaq Master Mix, and 1 μL (10 μmol / L) of each primer (Mm-F, Mm-R, ureC-F, ureC-R, trpD-F, trpD-R, nucleotide sequences as shown in SEQ ID NO.1~6, respectively). Genomic DNA was extracted from Morganella morganii, Proteus vulgaris, and Providencia reticularis using a bacterial genomic DNA extraction kit. The extracted genomic DNA from the three groups was mixed in equal volumes and used as a DNA template. 1 μL of the mixture was used as a template, and the remainder was brought to 25 μL with ddH2O.
[0054] The reaction program was as follows: pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 15 s; annealing temperatures of 49.4℃, 50.7℃, 52.6℃, 54.3℃, 56.1℃, 57.8℃, 59.7℃, and 61℃ for 15 s; extension at 72℃ for 30 s; for a total of 35 cycles; and final extension at 72℃ for 10 min. 10 μL of the amplification product was loaded into a 1.5% agarose gel, electrophoresed at 160 V for 15 min, and then placed in a gel imaging system. The results showed that... Figure 1 As shown, the target band was most clearly amplified when the annealing temperature was 54.3℃.
[0055] Example 3
[0056] Optimal annealing time selection
[0057] The reaction system consisted of 25 μL, including 12.5 μL of 2×RapidTaq Master Mix, 1 μL (10 μmol / L) of each primer (Mm-F, Mm-R, ureC-F, ureC-R, trpD-F, trpD-R, nucleotide sequences as shown in SEQ ID NO.1~6, respectively), 1 μL of the genomes of Morganella morganii, Proteus vulgaris, and Providencia reticularis were mixed in equal volumes and used as DNA templates. The remaining amount was brought to 25 μL with ddH2O.
[0058] The reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s; annealing at 55℃ for 10 s, 15 s, 20 s, 25 s, 30 s, 35 s, 40 s, 45 s; extension at 72℃ for 30 s, for a total of 35 cycles; final extension at 72℃ for 10 min. 10 μL of the amplification product was loaded into a 1.5% agarose gel, electrophoresed at 160 V for 15 min, and then placed in a gel imaging system. The results showed that... Figure 2 As shown, the target band is most clearly amplified when the annealing time is 15s.
[0059] Example 4
[0060] Optimal primer concentration screening
[0061] The PCR reaction system of Example 2 was used, with the primer concentration remaining constant at 10 μmol / L. The only difference was that the volume of each primer added to the reaction system was optimized in 0.2 μL increments, resulting in primer additions of 0.2 μL, 0.4 μL, 0.6 μL, 0.8 μL, 1.0 μL, 1.2 μL, 1.4 μL, and 1.6 μL, respectively. The final concentrations were 0.08 μmol / L, 0.16 μmol / L, 0.24 μmol / L, 0.32 μmol / L, 0.40 μmol / L, 0.48 μmol / L, 0.56 μmol / L, and 0.64 μmol / L, respectively. The genomes of three bacteria were amplified using these methods. Based on the nucleic acid gel electrophoresis results, such as... Figure 3As shown, the optimal primer concentrations for each genome group were selected. The optimal concentration for *Morganella morganii* was 0.64 μmol / L, and the optimal concentrations for *Proteus vulgaris* and *Providence bacillus reticularis* were 0.16 μmol / L. Through the above experimental screening, the primer addition amounts for *Morganella morganii* (1.4 μL, 1.6 μL), *Proteus vulgaris* (0.4 μL, 0.6 μL), and *Providence bacillus reticularis* (0.4 μL, 0.6 μL) were selected, forming the following combinations: (1.6 μL, 0.4 μL, 0.4 μL; 1.6 μL, 0.4 μL, 0.6 μL; 1.6 μL, 0.6 μL, 0.4 μL; 1.6 μL, 0.6 μL, 0.6 μL; 1.4 μL, 0.4 μL, 0.4 μL; 1...) 0.4 μL, 0.4 μL, 0.6 μL; 1.4 μL, 0.6 μL, 0.4 μL; 1.4 μL, 0.6 μL, 0.6 μL) were used as DNA templates by mixing equal volumes of genomic DNA from three bacteria (Morganella morganii, Proteus vulgaris, and Providencia reticularis). The only difference was the amount of primers added; other reaction systems and conditions were the same as in Example 2, "Screening for Optimal Annealing Temperature." Triple PCR amplification of the bacteria was performed at the optimal annealing temperature and the optimal annealing time obtained in Example 2. The results showed that, as Figure 4 As shown, the primer concentrations for Morganella morganii, Proteus vulgaris, and Providencia reticularis were 0.64 μmol / L, 0.16 μmol / L, and 0.16 μmol / L, respectively, which means that the amplification effect was best when the added amounts were 1.6 μL, 0.4 μL, and 0.4 μL, respectively.
[0062] Example 5
[0063] Optimal cycle number selection
[0064] The reaction system was 25 μL. The genomes of Morganella morganii, Proteus vulgaris, and Providencia reticularis were mixed in equal volumes as templates. The remaining components and contents were the same as those in the optimal annealing temperature screening in Example 2.
[0065] The reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 30 s, with cycle numbers set to 22, 24, 26, 28, 30, 32, 34, and 36, respectively; and a final extension at 72℃ for 10 min. 10 μL of the amplification product was loaded into a 1.5% agarose gel, electrophoresed at 160 V for 15 min, and then placed in a gel imaging system. The results showed that... Figure 5 As shown, the target band is most clearly amplified when the cycle number is 36.
[0066] Example 6
[0067] Sensitivity detection
[0068] After optimizing the reaction conditions, the optimal triplet PCR method was determined to be a 25 μL reaction system, comprising 12.5 μL of 2×Rapid Taq Master Mix, 1.6 μL each of upstream and downstream primers for *Morganella morganii* (0.64 μmol / L), 0.4 μL each of upstream and downstream primers for *Proteus vulgaris* (0.16 μmol / L), and 0.4 μL each of upstream and downstream primers for *Proteus repens* (0.16 μmol / L). An equal volume of genomic DNA from the three bacteria (*Morganella morganii*, *Proteus vulgaris*, and *Proteus repens*) was mixed as a 1 μL DNA template, and the remaining amount was brought to 25 μL with ddH2O. The reaction program was: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 54.3℃ annealing for 15 s, 72℃ extension for 30 s, for a total of 36 cycles; and a final extension at 72℃ for 10 min.
[0069] The concentrations of the extracted genomic DNA were determined, and the initial concentrations of *Morganella morganii*, *Proteus vulgaris*, and *Providencera retardata* DNA were 374.7 ng / μL, 115.1 ng / μL, and 106.5 ng / μL, respectively. Equal volumes of the genomic DNA from these three strains were mixed and diluted 10-fold as a DNA template. The optimal triplet PCR detection method established in Example 6 was used to detect the sensitivity of *Morganella morganii*, *Proteus vulgaris*, and *Providencera retardata*. The results showed that... Figure 6 As shown, the detection limits of this method for Morganella morganii, Proteus vulgaris, and Providencia reticularis are 374.7 pg / μL, 115.1 pg / μL, and 10.65 pg / μL, respectively, indicating that the triple PCR detection method has good sensitivity and can reduce the possibility of template-primer mismatch and non-specific amplification.
[0070] Example 7
[0071] Specific detection
[0072] Genomes were extracted from laboratory-isolated and preserved strains of Lactococcus lactis, Aeromonas hydrophila, Staphylococcus hemolyticus, Bacillus cereus, Acinetobacter johnsonii, and Zygophora riverines using a bacterial genome extraction kit. The extracted genomic DNA of the above six bacteria was used as a template for PCR to test whether the designed primers could specifically amplify the target gene of the target bacteria.
[0073] The reaction system consisted of 25 μL, including 12.5 μL of 2×RapidTaq Master Mix, 1 μL (10 μmol / L) of each primer (Mm-F, Mm-R, ureC-F, ureC-R, trpD-F, trpD-R), 1 μL of bacterial genomic DNA template for the corresponding group, and the remainder was brought up to 25 μL with ddH2O. The corresponding DNA templates are as follows: 1 μL of a mixture of the genomic DNA of three bacteria: Morganella morganii, Proteus vulgaris, and Providencia reticularis; 1 μL of a mixture of the genomic DNA of two bacteria: Morganella morganii and Proteus vulgaris; 1 μL of a mixture of the genomic DNA of two bacteria: Morganella morganii and Providencia reticularis; 1 μL of a mixture of the genomic DNA of two bacteria: Proteus vulgaris and Providencia reticularis; 1 μL of Lactococcus lactis; 1 μL of Aeromonas hydrophila; 1 μL of Staphylococcus hemolyticus; 1 μL of Bacillus cereus; 1 μL of Acinetobacter johnsonii; and 1 μL of Zoococcus fluvialis.
[0074] The reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 54.3℃ annealing for 15 s, 72℃ extension for 30 s, for a total of 36 cycles; final extension at 72℃ for 10 min. 10 μL of the amplification product was added to a 1.5% agarose gel, electrophoresed at 160 V for 15 min, and then placed in a gel imaging system. The results showed that... Figure 7 As shown, among the common bacterial DNA detected, each pair of primers designed could only specifically amplify a single target band of the target bacteria (Morganella morganii, Proteus vulgaris, and Providencia reticularis), and did not bind to the DNA of other bacteria after amplification, indicating that the three pairs of primers designed had good specificity.
[0075] Example 8
[0076] Application of triple PCR detection method
[0077] The optimal triple PCR method established in Example 6 was used to detect 30 tissue samples and environmental samples from Yangtze alligators. Simultaneously, bacteria were isolated, cultured, and identified in each sample (specific bacterial isolation and identification steps: Sun Rongrong. Isolation, Identification, and Drug Sensitivity Analysis of Pathogens of Hemorrhagic Pneumonia in Mink [J]. Special Economic Animals and Plants, 2024, 27(01):11-14.). The results showed that, as shown in Table 2, the positive detection rates of the established triple PCR method for Morganella morganii, Proteus vulgaris, and Providencia reticularis were consistent with those of bacterial isolation and identification, indicating that the established triple PCR method is accurate and reliable and can be used to detect pathogens related to gout in Yangtze alligators. As shown in Table 3, compared with bacterial isolation and identification, the triple PCR method has advantages such as fast detection time, simple operation, suitability for large-scale sample detection, high sensitivity, strong specificity, and high efficiency, making it suitable for rapid detection of clinical and laboratory samples.
[0078] Table 2 Sample test results
[0079]
[0080] Note: "+" indicates a positive result, and "-" indicates a negative result.
[0081] Table 3 Comparison of Triple PCR Detection Method and Bacterial Isolation and Identification
[0082]
Claims
1. A primer for triple PCR detection of Morganella morganii, Proteus vulgaris, and Providencia reticularis, characterized in that, The primers are Mm-F, Mm-R, ureC-F, ureC-R, trpD-F, and trpD-R, respectively, and their nucleotide sequences are shown in SEQ ID NO.1~6.
2. A triple PCR detection method for detecting Morganella morganii, Proteus vulgaris, and Providencia reticularis using the primers described in claim 1 for non-diagnostic or therapeutic purposes, characterized in that, The procedure includes the following steps: using a mixture of bacterial genomic DNA extracted from Morganella morganii, Proteus vulgaris, and Providencia reticularis as a DNA template, performing PCR amplification with the three pairs of primers, and observing the electrophoresis results.
3. The detection method according to claim 2, characterized in that, The PCR reaction system includes 2×Rapid TaqMaster Mix, upstream and downstream primers for Morganella morganii (Mm-F, Mm-R), upstream and downstream primers for Proteus vulgaris (ureC-F, ureC-R), upstream and downstream primers for Providencia reticularis (trpD-F, trpD-R), a mixture of the genomic DNA of the three bacteria, and ddH2O.
4. The detection method according to claim 3, characterized in that, The PCR reaction system consisted of: 12.5–15 μL of 2×Rapid TaqMaster Mix, 1.6–2 μL each of upstream and downstream primers for Morganella morganii, 0.4–0.8 μL each of upstream and downstream primers for Proteus vulgaris, 0.4–0.8 μL each of upstream and downstream primers for Providencia reticularis, and 1–2 μL of DNA template after equal volumes of the three bacterial genomic DNAs were mixed. The remainder was brought to 25–35 μL with ddH2O.
5. The detection method according to claim 4, characterized in that, The primer concentrations for Morganella morganii, Proteus vulgaris, and Providencia reticularis were 0.08–0.64 μmol / L, 0.08–0.64 μmol / L, and 0.08–0.64 μmol / L, respectively.
6. The detection method according to claim 2, characterized in that, The PCR reaction program is as follows: pre-denaturation at 90-95 ℃ for 5-10 min; denaturation at 90-95 ℃ for 10-15 s, annealing at 49.4-61 ℃ for 10-45 s, extension at 72-75 ℃ for 30-50 s, for a total of 22-36 cycles; final extension at 72-75 ℃ for 10-15 min.
7. The use of the primer of claim 1 in the preparation of a reagent for detecting Chinese alligator tissue samples or environmental samples.
8. The use of the primer of claim 1 in the preparation of a reagent for detecting the pathogen of the Chinese alligator dysentery.
Citation Information
Patent Citations
System for detecting and distinguishing proteus mirabilis, proteus vulgaris and proteus pennerei and method thereof
CN110951895A
Method for detecting morganella morganii by direct PCR of bacterial liquid
CN111187771A