A molecular marker associated with immune traits in sheep and use thereof

By amplifying and sequencing the sheep GRB10 gene, polymorphic sites were identified, and sheep genotypes were detected using PCR and fluorescent probe methods. This solved the problem of genetic improvement of sheep immune traits, enabling the breeding of sheep with high immune traits and improving economic benefits.

CN118667966BActive Publication Date: 2026-07-03LANZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
LANZHOU UNIV
Filing Date
2024-06-20
Publication Date
2026-07-03

AI Technical Summary

Technical Problem

The mechanism of action of the sheep GRB10 gene in immune function remains unclear, which affects the genetic improvement of sheep immune traits and the breeding of high-quality meat sheep.

Method used

By amplifying and sequencing the DNA sequence of the sheep GRB10 gene, polymorphic sites were identified. Primer pairs and kits were designed, and PCR and fluorescent probe methods were used to detect the GRB10 genotype and screen sheep with high immune traits.

Benefits of technology

This has enabled the effective identification and breeding of sheep with high immunity traits, improved the immunity of sheep flocks, and enhanced the economic benefits of sheep farming.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118667966B_ABST
    Figure CN118667966B_ABST
Patent Text Reader

Abstract

The application provides a molecular marker related to an immune trait of sheep and application thereof. The molecular marker is designed according to a primer of a GRB10 gene sequence, DNA is extracted from sheep blood, PCR amplification, DNA sequencing and sequence analysis are carried out, a G / A polymorphic site is found at 119bp of the amplified fragment, further, the polymorphic site of 1086 Hu sheep is detected by using an AQP primer, a least square model is established, genotype and immune traits are associated, and finally it is determined that the G / A polymorphic site at 119bp of the amplified GRB10 gene fragment can be used as the molecular marker related to the immune trait of sheep. By detecting the genotype of the molecular marker, the application can select and keep GG homozygous sheep into a core group for breeding, can be used for improving the immune capacity of sheep, and is helpful to increasing economic benefits.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, specifically relating to a molecular marker related to sheep immune traits and its application. Background Technology

[0002] The Hu sheep is a unique local sheep breed in China, originating from Jiaxing, Zhejiang Province, and the Taihu Lake basin. It prefers dry conditions and dislikes dampness, possessing excellent breed characteristics such as tolerance to roughage, strong environmental adaptability, year-round estrus, high lambing rate, good milk production, rapid growth and development, tolerance to heat and humidity, and suitability for pen rearing. As a meat sheep breed, Hu sheep have delicate and delicious meat with relatively mild gamey and muttony odors. They have a high slaughter rate, fine bones, and abundant meat, resulting in excellent meat value. Immunity is the body's own defense mechanism, its ability to recognize and eliminate any foreign invaders (viruses, bacteria, etc.), process aging, damaged, dead, and degenerated cells, and recognize and process mutated and virus-infected cells. Meat sheep with strong immunity are more resistant to disease during growth and development, leading to higher economic benefits in meat sheep farming. Therefore, breeding fast-growing meat sheep with strong immunity has become a key research focus in the livestock industry.

[0003] Growth factor receptor-bound protein 10 (GRB10) is a member of the GRB7 family, which includes three members: GRB7, GRB10, and GRB14. These members are present in mammalian cells and can recognize downstream signals of cell surface binding receptors and protein interactions.

[0004] In recent years, an increasing number of studies have shown that GRB10 may be closely related to animal reproduction and development. Charalambous et al. found that GRB10 transgenic mice exhibited growth disorders, while GRB10 knockout experiments in mice revealed significant proliferation in the embryo and placenta, indicating that GRB10 may be involved in regulating embryonic cell growth and the insulin signaling pathway. Lui et al. found that GRB10 is an effective leptin sensitizer; overexpression of the GRB10 gene in neuronal cells exacerbated diet-induced obesity in mice, affecting their growth and development. Wang et al., through cell experiments, found that transient overexpression of the GRB10 gene significantly reduced cell proliferation rate. During normal cell growth, the GRB10 gene can act as an active, stimulating signaling linker, promoting mitotic activity and maintaining normal reproductive activity. Shiura et al. found that 3-4 week old GRB10 transgenic mice exhibited growth retardation and growth disorders; knockout of the GRB10 gene caused excessive growth and skeletal muscle hypertrophy in mice, indicating that GRB10 is closely related to growth and development. However, the mechanism of action of this gene in sheep immune function has not yet been reported, and its function is still unclear.

[0005] This invention explores the association between different genotypes of the GRB10 gene and sheep immune traits by sequencing and analyzing the gene. The aim is to provide genetic material for improving the genetic traits of sheep immune traits and to accelerate the breeding process of a new breed of high-quality meat sheep with rapid growth and strong immune function with independent intellectual property rights. Summary of the Invention

[0006] The purpose of this invention is to provide a molecular marker associated with sheep immune traits and its application. This molecular marker is obtained by amplifying and sequencing the DNA sequence of the sheep GRB10 gene to identify polymorphic sites. By analyzing the correlation between different genotypes of these polymorphic sites and sheep immunity, a detection method for molecular markers containing polymorphic sites is established. This molecular marker can then be applied to the breeding of new sheep breeds that improve immune traits.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] A molecular marker associated with sheep immune traits, the nucleotide sequence of which is shown in SEQ ID NO.1, wherein the R at 119 bp is either G or A, and this mutation results in a G / A polymorphism of the molecular marker.

[0009] As mentioned above, the application of molecular markers in screening sheep for high immunity traits shows that when the genotype of the polymorphic locus is GG, its immunity is significantly higher than that of the AA type.

[0010] The application of a primer pair for detecting the above-mentioned molecular markers associated with sheep immune traits in the breeding of sheep with high immune traits, preferably, the sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0011] The application of an AQP primer pair for detecting the above-mentioned molecular markers associated with sheep immune traits in the breeding of sheep with high immune traits, preferably, the sequences of the AQP primers are shown in SEQ ID NO.4-6.

[0012] The application of a kit for detecting the above-mentioned molecular markers associated with sheep immune traits in the breeding of sheep with high immune traits, preferably, the kit includes ordinary PCR primer pairs or AQP sequence pairs, the sequences of the ordinary PCR primer pairs are shown in SEQ ID NO.2 and SEQ ID NO.3; the sequences of the AQP primers are shown in SEQ ID NO.4-6.

[0013] A method for detecting the above-mentioned molecular markers associated with sheep immune traits includes the following steps:

[0014] 1) Amplify sheep genomic DNA using the above-mentioned ordinary PCR primer pairs, AQP primer pairs, or kits containing the above primer pairs;

[0015] 2) The polymorphic sites of the amplification products obtained in step 1) are identified by typing.

[0016] In step 2), the above-mentioned typing and identification methods include, but are not limited to, direct sequencing, fluorescent probe method, gene chip method, and high-resolution melting curve method.

[0017] Furthermore, preferably, when using ordinary PCR primer pairs for amplification, the polymorphic sites of the amplification products are identified by direct sequencing.

[0018] Furthermore, preferably, when using AQP primer pairs for amplification, a C1000 Touch is used. TM The Thermal Cycler instrument detects fluorescence signals and displays typing results.

[0019] The application of the above-described method in the detection of sheep immune traits, by analyzing the genotype of polymorphic loci, can determine the level of sheep's immune function and thus screen out sheep with higher immune function. When the genotype of the polymorphic locus is GG, its mean erythrocyte hemoglobin concentration, white blood cell count, lymphocyte count, and eosinophil count are significantly higher than those of the AA genotype, that is, when the genotype of the polymorphic locus is GG, its immune capacity is significantly higher than that of the AA genotype.

[0020] The application of the molecular marker PCR primer pairs, AQP primers, or kits described above in sheep breeding involves amplifying and detecting the GRB10 gene in sheep genomic DNA using the aforementioned primer pairs or kits. This allows for the determination of the molecular marker genotype in the sample to be tested, thereby enabling the selection of sheep breeds with better immunity.

[0021] The beneficial effects of this invention are as follows:

[0022] This invention provides molecular markers related to sheep immune traits and their G / A polymorphic sites. By detecting the genotype of this polymorphism, it is possible to effectively identify whether a sheep has a strong immune function, providing an effective detection method for breeding sheep with better immunity.

[0023] This invention, through the detection of genotypes at polymorphic sites of molecular markers related to sheep immune traits, can be used to select GG homozygous sheep as breeding stock to improve the immunity of sheep flocks during their growth process, thereby helping to improve the economic benefits of sheep farming. Attached Figure Description

[0024] Figure 1 This is a gel electrophoresis image of the sheep GRB10 gene fragment from Example 1.

[0025] Figure 2 The sequencing results are for the g.6478288G>A mutation site in the sheep GRB10 gene in Example 1.

[0026] Figure 3 The AQP typing results are for the amplified fragment of the GRB10 gene from sheep in Example 2. Detailed Implementation

[0027] This invention analyzes the relationship between single nucleotide polymorphisms (SNPs) in the GRB10 gene of Hu sheep and immune traits. This invention can provide valuable molecular markers for sheep breeding.

[0028] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence are within the scope of the present invention.

[0029] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, all reagents used in this method are of analytical grade or higher.

[0030] Example 1: Amplification of the GRB10 gene

[0031] (1) Using sheep GRB10 gene DNA (GenBank accession number: NC_040255.1) as a template, a pair of primers, GF and GR, were designed using Oligo 7.0 software. The primer sequences are as follows:

[0032] GF (SEQ ID NO.2): 5'-TTCTTCACATCCCGTGCT-3'

[0033] GR (SEQ ID NO.3): 5'-TGTCTAACTCTGCGACCTCA-3'

[0034] (2) Amplification and sequencing of the GRB10 gene

[0035] The total volume of the PCR reaction was 35 μL, including: 17.5 μL of 2×PCR Master Mix, 1.1 μL of GF (10 μmol / L) upstream primer, 1 μL of GR (10 μmol / L) downstream primer, 1.4 μL of DNA template, and 14 μL of ddH2O. The DNA template was genomic DNA extracted from sheep blood; the DNA template consisted of DNA from 9 different sheep plus a mixed sample, for a total of 10 samples. The mixed sample was a mixture of DNA from 9 sheep.

[0036] The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, for 36 cycles, and finally 72℃ extension for 10 min.

[0037] The PCR amplification products were detected by 1% agarose gel electrophoresis, and the results are as follows: Figure 1 As shown, lane M represents a 1500 molecular weight marker, and lanes 1-10 represent the amplification results of the GRB10 gene. The amplified PCR fragment was sequenced, and its nucleotide sequence, as shown in SEQ ID NO.1, is 785 bp. A polymorphic site exists within this fragment, specifically at position 119 bp in the sequence shown in SEQ ID NO.1, where R is either G or A. That is, the amplified GRB10 gene fragment (SEQ ID NO.1) exhibits G / A polymorphism at position 119 bp (see [link to SEQ ID NO.1]). Figure 2 (where A is type GG, B is type AG, and C is type AA).

[0038] Among them, SEQ ID NO.1:

[0039] TTCTTCACATCCCCGTGCTCAAGTCCTGGTTTCAAGAGTTCTTTGTCTTGGGCACCCACCTGTGTCCTTGAGTTAGGGAGTGGGGCAGCCCTCTGCCTGGGTACACTGTGAGGCGTGGRTCAGAGAGGGCATCACAGACTTCAAACTTGATCCTGCCTTTAATAGAAGATGCAGCCTTTCTGAAGTCAGTGTTTCCACTGTGTGATAAATTAAAAGGACCATCATTTTAAATACAGATTGTCCATAATCGTGCCTAGAGGGATGTTTTTAGTACTGGCATATCTGTAAGTAGGTTTTCCCCACTTGGAAGCTAACCTTTATCGTCTTTGTTTTTCCACATCCTAGAATTTCTTCCCGGAACAGATGGTTACGTGGTGCCAGCAGTCCAACGGCAGTCACACCCAGCTGTTGCAGGTACTGGGCAGGAAGAGGCTTCTGCTGGAGTTTTTGCATAGATGCTCTCGGGCTGCCCCAGGGGCCTGGTAGAAACTTGGATCAGTTGAGCTCGTCCTCACAAATATGAGCCTTGGCTCCTGTTGGAATTTAGAGTATCCAGGAATACATATTTGCTTGGGAAAGCTGTGTGTAGCCAGGCTTCCCAGGTGATGCTACTGGTAAAGAACCCACCTGCCACTGCAGGAGACATGAGAGACTCAGGTTCGATCCCTGGGTGGGGAAGATCCCCTAGAGGAGGGCCTGGCAACCCACTCCAGTATTCTTGCTGGAGAGTCCCATGGGCAGAGGAGCCTGGCAGGCTACAGTCCATGAGGTCGCAGAGTTAGACA。

[0040] DNA sequence homology search and identification:

[0041] The DNA sequence shown in SEQ ID NO.1 was compared with known physiologically functional genes published in the GenBank database using the BLAST (Basic Local Alignment Search Tool) software on the website of the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) to identify and obtain functional information of the DNA sequence. The search results showed that the sequence obtained had 98.1% homology with a partial sequence of the sheep GRB10 gene DNA (GenBank accession number: NC_040255.1).

[0042] Example 2: Establishment of a Genotyping Detection Method

[0043] 1. Primer sequence design

[0044] AQP primer pairs were designed targeting the G / A polymorphic site shown in SEQ ID NO.1 of the amplified fragment in Example 1. TM Genotyping systems, also known as allele-specific quantitative PCR (AQP) genotyping assays, are genotyping systems that combine PCR amplification and quantitative PCR techniques to specifically detect polymorphic sites. The optimized AQP primer pairs include the following nucleotide sequences:

[0045] The forward primer G1 used to detect AlleleG is shown in SEQ ID NO.4.

[0046] SEQ ID NO.4: GAAGGTGACCAAGTTCATGCTGGTACACTGTGAGG CGTGGG;

[0047] The forward primer G2 used to detect AlleleA is shown in SEQ ID NO.5.

[0048] SEQ ID NO.5:GAAGGTCGGAGTCAACGGATTGGTACACTGTGAGGCGTGGA;

[0049] The universal reverse primer C is shown in SEQ ID NO.6.

[0050] SEQ ID NO. 6: TTGAAGTCTGGTGATGCCCTCTCTGA.

[0051] The primers were synthesized by Beijing Sangon Biotech Co., Ltd. Each primer pair in the above AQP primers was diluted to 100 μmol / L and mixed in a volume ratio of primer G1: primer G2: primer C: sterile water of 12:12:30:46 to prepare a primer mixture.

[0052] 2. Extracted genomic DNA and subjected to quality control.

[0053] Genomic DNA can be extracted from sheep blood using a DNA extraction kit. The extracted genomic DNA is then tested for quality using 1% agarose gel electrophoresis and Nanodrop 2100. The extracted DNA must meet the following requirements: (1) Agarose gel electrophoresis shows a single DNA band without significant diffusion. (2) Nanodrop 2100 analysis shows A260 / A280 between 1.8 and 2.0; A260 / A230 between 1.8 and 2.0; and no significant light absorption at A270nm. DNA that does not meet these requirements needs to be extracted again until it meets the criteria. Based on the AQPTM detection technology and genome size calculation from Beijing Jiacheng Biotechnology Co., Ltd., the required DNA dosage is 10–20 ng / sample. The extracted genomic DNA is then diluted to a concentration of 10–20 ng / μL as a DNA template.

[0054] 3. Perform genotyping

[0055] Firstly, according to the AQP of Beijing Jiacheng Biotechnology Co., Ltd. TM The detection technology and genome size calculations determined the DNA usage to be 10–20 ng / sample. The extracted genomic DNA was then diluted to a concentration of 10–20 ng / μL to serve as a DNA template.

[0056] Each primer in the AQP primer pair is 100 μmol / L and is mixed with sterile water in a volume ratio of 12:12:30:46 (primer G1: primer G2: primer C: sterile water) to prepare a primer mixture for later use.

[0057] Then, using a pipette, add 0.07 μL of primer mixture, 0.5 μL of sterile water, 2.5 μL of HiGeno 2×Probe Mix, and 2 μL of DNA to each well of a 384-well plate. After adding the components, seal the plate, centrifuge with shaking, and then place it on a C1000Touch™ Thermal Cycler instrument for PCR amplification. The specific procedure is as follows:

[0058] Pre-denaturation at 95℃ for 10 minutes;

[0059] 95℃, 20 seconds (denaturation) — 61℃-55℃, 40 seconds (annealing & extension), amplification for 10 cycles, with a decrease of 0.6℃ per cycle;

[0060] 95℃, 20 seconds (denaturation) — 55℃, 40 seconds, continue amplification for 34 cycles.

[0061] After amplification, use C1000 Touch TM The Thermal Cycler instrument was used to detect fluorescence signals and examine genotyping at 37°C. Some results are shown below. Figure 3 As shown in the figure. HEX is the horizontal axis and FAM is the vertical axis. Each graph in the figure represents a sample of the test material. The blue square near the left indicates that the locus is homozygous genotype "GG"; the green triangle near the middle indicates that the locus is heterozygous genotype "AG"; and the orange dot near the right indicates that the locus is homozygous genotype "AA".

[0062] 4. Application of the molecular markers of this invention in the association analysis of sheep immune traits

[0063] The experiment examined the polymorphism of 1086 Hu sheep, determined their genotypes, and established the least squares model as described below. SPSS software was used to perform association analysis between genotype and immune traits.

[0064] Y ijk =μ+Genotype i +P j +S k +ε ijk

[0065] Among them, Y ijk The observed values ​​for immune traits are given, μ is the population mean, and Genotype is the genotype. i For genotype effect, P j Due to the batch effect, S k Due to seasonal effects, ε ijk Assuming random error, let ε ijk They are mutually independent and follow N(0, σ). 2 )distributed.

[0066] Genotyping results showed that among 1086 individuals, 472 had the GG genotype, 507 had the AG genotype, and 107 had the AA genotype. The results of the association analysis between genotype and trait are shown in Table 1. The data in Table 1 were collected during sheep farm production practice and are the results of routine blood tests on 180-day-old sheep. The values ​​are the mean ± standard deviation of all genotypes. P-values ​​and significance were obtained using SPSS software. Table 1: Association Analysis of GRB10 Gene Polymorphism and Immunity Trait in Sheep

[0067]

[0068] Note: Different superscript letters between data in the same row indicate significant differences (P<0.05), with extremely significant differences represented by P<0.01. The same letter or no letter indicates no significant difference (P>0.05).

[0069] Hematocrit and mean corpuscular volume (MCV) are standards for assessing blood concentration. The average values ​​of MCV, MHC, and MHC concentration are calculated based on red blood cell count, hemoglobin measurement, and hematocrit results, and are valuable in diagnosing anemia. White blood cells include lymphocytes, neutrophils, eosinophils, basophils, and monocytes. White blood cells play a role in phagocytizing foreign substances and producing antibodies, healing bodily injuries, resisting pathogen invasion, and providing immune resistance to diseases. Within the normal range, a higher white blood cell count indicates stronger immunity.

[0070] Lymphocytes are cell lines with specific immune recognition functions, playing a crucial role in the body's immune processes, including anti-infection and anti-tumor responses. They are important cellular components of the body's immune response, the main executors of almost all immune functions in the lymphatic system, and the frontline "soldiers" fighting external infections and monitoring cellular mutations within the body. Eosinophils have the function of killing bacteria and parasites and are also extremely important cells in immune and allergic reactions. Eosinophils can release the contents of their granules, causing tissue damage and promoting the progression of inflammation. Therefore, this invention uses hematocrit and mean corpuscular volume, erythrocyte hemoglobin, white blood cell count, lymphocytes, and eosinophils to measure immune capacity.

[0071] Table 1 shows that the mutation site at position 119 bp shown in SEQ ID NO.1 is significantly associated with sheep immune traits. Sheep carrying the GG genotype had significantly higher mean erythrocyte hemoglobin concentration, white blood cell count, lymphocyte count, and eosinophil count than those carrying the AA genotype, indicating that sheep carrying the GG genotype have better immune function than those carrying the AA genotype (P<0.05). This suggests that the G allele is the dominant allele. The G>A mutation at this site can serve as a potential molecular marker affecting sheep immune traits (P<0.05). Selecting the GG genotype for breeding during the preservation of sheep can enhance their immune function during growth, resulting in a superior flock with better immunity.

Claims

1. A reagent for detecting a molecular marker related to the immune traits of Hu sheep in the application of screening Hu sheep breeding with high immune traits, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where R at 119bp is G or A, and this mutation leads to G / A polymorphism of the molecular marker; when the genotype of the polymorphic site of the molecular marker is GG, its immune capacity is significantly higher than that of the AA genotype.

2. The application of a primer pair for detecting molecular markers associated with immune traits in Hu sheep in the breeding of Hu sheep with high immune traits, characterized in that, The sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.3; the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein R at 119bp is G or A, and this mutation leads to G / A polymorphism of the molecular marker; when the genotype of the polymorphic site of the molecular marker is GG, its immune capacity is significantly higher than that of the AA genotype.

3. The application of an AQP primer pair for detecting molecular markers associated with immune traits in Hu sheep in the breeding of Hu sheep with high immune traits, characterized in that, The sequence of the AQP primer is shown in SEQ ID NO.4-6; the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein R at 119bp is G or A, and this mutation leads to G / A polymorphism of the molecular marker; when the genotype of the polymorphic site of the molecular marker is GG, its immune capacity is significantly higher than that of the AA genotype.

4. The application of a kit for detecting molecular markers associated with immune traits in Hu sheep in the breeding of Hu sheep with high immune traits, characterized in that, The kit includes a standard PCR primer pair or an AQP sequence pair. The sequences of the standard PCR primer pairs are shown in SEQ ID NO.2 and SEQ ID NO.

3. The sequences of the AQP primers are shown in SEQ ID NO.4-6. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein R at position 119 bp is G or A, and this mutation leads to G / A polymorphism of the molecular marker. When the genotype of the polymorphic site of the molecular marker is GG, its immune capacity is significantly higher than that of the AA genotype.

5. The application of a method for detecting molecular markers associated with immune traits in Hu sheep in the breeding of Hu sheep with high immune traits, characterized in that, It includes the following steps: 1) Amplify the genomic DNA of Hu sheep using the ordinary PCR primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3, or the AQP primer pairs shown in SEQ ID NO.4-6, or a kit containing the above ordinary PCR primer pairs or AQP primer pairs; 2) The polymorphic site at position 119 of the amplification product obtained in step 1) as shown in SEQ ID NO.1 is identified by typing; wherein, when the genotype of the polymorphic site of the molecular marker is GG, its immune capacity is significantly higher than that of the AA genotype.

6. The application as described in claim 5, characterized in that, When amplification was performed using the ordinary PCR primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3, the polymorphic sites of the amplification products were identified by direct sequencing.

7. The application as described in claim 5, characterized in that, When amplification was performed using AQP primer pairs with sequences as shown in SEQ ID NO.4-6, the fluorescence signal was detected and the genotyping results were viewed using a C1000 TouchThermal Cycler instrument.