Protein gmtp and encoding gene thereof for regulating soybean plant type and improving yield and application thereof

By regulating the activity and/or content of GmLTPP protein in soybeans and knocking out the GmLTPP gene using the CRISPR/Cas9 system, soybean plant architecture was altered and yield was increased, solving the problem of low soybean yield and achieving a significant increase in yield.

CN118812681BActive Publication Date: 2026-05-29INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410880282.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-02
Publication Date
2026-05-29
Estimated Expiration
2044-07-02

AI Technical Summary

Technical Problem

Soybean yields are too low to meet daily production and living needs, and existing technologies are insufficient to effectively regulate plant structure to increase yields.

Method used

By regulating the activity and/or content of GmLTPP protein in soybeans, or by regulating the expression level of its encoding gene, gene editing technologies such as CRISPR/Cas9 systems can be used to knock out or silence the GmLTPP gene, thereby altering plant architecture and increasing yield.

Benefits of technology

It significantly alters soybean plant architecture, increases the number of pods and seeds per plant, enhances branching ability, and achieves a significant increase in soybean yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure HDA0004924300200000011
    Figure HDA0004924300200000011
  • Figure HDA0004924300200000012
    Figure HDA0004924300200000012
Patent Text Reader

Abstract

The application discloses a protein GmLTPP for regulating soybean plant type and improving yield, a coding gene thereof and application. The application belongs to the field of plant breeding and relates to the protein GmLTPP for regulating soybean plant type and improving yield, the coding gene thereof and application. The protein GmLTPP can regulate plant type and yield, and the protein specifically refers to the following: A1) a protein with an amino acid sequence shown in SEQ ID No. 2; A2) a protein obtained by substitution, deletion and / or addition of amino acid residues of the protein of A1) and having more than 80% identity with the protein shown in A1) and the same function; and A3) a fusion protein obtained by connecting a protein tag to the N terminal or / and C terminal of A1) or A2). Experiments prove that knocking out the protein GmLTPP can change the soybean plant type and improve the yield, and has important theoretical significance for soybean breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant breeding and relates to the protein GmLTPP, which regulates soybean plant architecture and increases yield, its encoding gene, and its applications. Background Technology

[0002] Soybeans, as an important crop used for both grain and oilseed production, play a crucial role in ensuring my country's food security and agricultural trade. With the continuous improvement of people's living standards, the demand for vegetable oil and feed protein has increased dramatically. However, my country's soybean production is relatively low, failing to meet daily production and living needs. Improving soybean yield per unit area is a critical production problem that urgently needs to be solved and a breeding technology bottleneck that urgently needs to be overcome.

[0003] Crop plant architecture includes plant height, branching (tillering), leaf shape, and spike type (pod-setting habit), and plant architecture domestication or improvement plays a crucial role in achieving significant breakthroughs in crop yield. Improving soybean plant architecture has significant practical value for ultimately achieving breeding applications and increasing soybean yield. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to regulate plant shape and increase plant yield.

[0005] The present invention first provides a method for regulating plant architecture and increasing yield, including regulating the activity and / or content of proteins in the target plant, and / or the expression level of the gene encoding the protein, to regulate plant architecture and increase yield.

[0006] The protein mentioned above can be any of the following:

[0007] A1) A protein with the amino acid sequence shown in SEQ ID No. 2;

[0008] A2) Proteins obtained by substituting and / or deleting and / or adding amino acid residues of the protein in A1) that have more than 75% identity with the protein shown in A1) and that regulate plant architecture and yield; for example, those skilled in the art can, based on the amino acid sequence shown in SEQ ID No. 2 and conventional techniques such as the conserved substitution of amino acids, obtain protein mutants with the same function as the amino acid sequence shown in SEQ ID No. 2 by substituting, deleting and / or adding one or more amino acids without affecting their activity.

[0009] A3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).

[0010] The protein described in A1 above is named GmLTPP.

[0011] To facilitate the purification or detection of the protein in A1), a tag protein can be attached to the amino or carboxyl terminus of the protein, which consists of the amino acid sequence of SEQ ID No. 2 in the sequence listing.

[0012] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0013] The tagged proteins include, but are not limited to: GST (glutathione thiotransferase) tagged protein, His6 tagged protein (His-tag), MBP (maltose-binding protein) tagged protein, Flag tagged protein, SUMO tagged protein, HA tagged protein, Myc tagged protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tagged protein.

[0014] Those skilled in the art can readily mutate the nucleotide sequence encoding the protein GmLTPP of this invention using known methods, such as directed evolution or point mutation. Any artificially modified nucleotides that possess 75% or more of the nucleotide sequence identity with the protein GmLTPP isolated in this invention, provided they encode and function as protein GmLTPP, are derived from and equivalent to the nucleotide sequence of this invention.

[0015] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0016] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid or nucleotide sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search to calculate the identity of a pair of amino acid sequences or nucleotide sequences, then the identity value (%) can be obtained.

[0017] In this document, the 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0018] In this document, the 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0019] The protein mentioned above is derived from soybean (Glycine max (L.) Merr.).

[0020] In the above method, regulating the activity and / or content of the protein GmLTPP in the target plant, or / and the expression level of the gene encoding the protein, includes introducing the gene encoding the protein GmLTPP into the recipient plant to inhibit, reduce, or silence the protein, thereby obtaining a target plant with altered plant architecture and increased yield; the gene encoding the GmLTPP encodes the protein GmLTPP.

[0021] The importation refers to the importation through recombination methods, including but not limited to Agrobacterium-mediated transformation, bio-projectile methods, electroporation, in-planta technology, and so on.

[0022] The aforementioned protein GmLTPP also falls within the scope of protection of this invention.

[0023] The present invention also provides biomaterials related to the above-mentioned proteins, said biomaterials may be any of the following:

[0024] B1) Nucleic acid molecules that encode the proteins described above;

[0025] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0026] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0027] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0028] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);

[0029] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0030] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2);

[0031] C1) Nucleic acid molecules that inhibit, reduce, or silence the expression of the genes encoding the proteins described above;

[0032] C2) expresses the gene encoding the nucleic acid molecule described in C1);

[0033] C3) contains an expression cassette encoding the gene described in C2);

[0034] C4) A recombinant vector containing the encoding gene described in C2), or a recombinant vector containing the expression cassette described in C3);

[0035] C5) A recombinant microorganism containing the encoding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4);

[0036] C6) A transgenic plant cell line containing the encoding gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4);

[0037] C7) Transgenic plant tissue containing the encoding gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4);

[0038] C8) A transgenic plant organ containing the encoding gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).

[0039] In the above-mentioned biological materials, the nucleic acid molecule described in B1) may be a gene as shown in E1) or E2) below:

[0040] E1) The coding sequence is the cDNA molecule or DNA molecule of SEQ ID No. 3;

[0041] E2) The nucleotide is the cDNA molecule or DNA molecule of SEQ ID No. 1.

[0042] The DNA molecule shown in SEQ ID No. 3 (the GmLTPP gene that regulates plant architecture and yield traits) encodes the protein GmLTPP of SEQ ID No. 2.

[0043] The nucleotide sequence shown in SEQ ID No. 3 is the nucleotide sequence of the gene encoding the protein GmLTPP (CDS).

[0044] The GmLTPP gene described in this invention can be any nucleotide sequence capable of encoding the protein GmLTPP. Considering codon degeneracy and codon preferences among different species, those skilled in the art can use codons suitable for expression in specific species as needed.

[0045] B1) The nucleic acid molecule may also include nucleic acid molecules obtained by codon preference modification based on the nucleotide sequence shown in SEQ ID No.3.

[0046] B1) The nucleic acid molecule may also include nucleic acid molecules that have a nucleotide sequence identity of more than 95% with that shown in SEQ ID No. 3 and originate from the same species.

[0047] The nucleic acid molecules mentioned in this article can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecules can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0048] The vectors described herein are well-known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors. Specifically, it may be the vector cas9 / gRNA.

[0049] Recombinant expression vectors containing the GmLTPP gene can be constructed using existing plant expression vectors. These plant expression vectors include, but are not limited to, binary Agrobacterium vectors and vectors suitable for plant microbombardment. The plant expression vectors may also contain the 3' untranslated region of the exogenous gene, i.e., containing a polyadenylate signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylate signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor; similar functions exist for the untranslated regions transcribed at the 3' end of genes including, but not limited to, Agrobacterium crown gall-inducing (Ti) plasmids (such as the Nos gene for lipase synthesis) and plant genes (such as the soybean storage protein gene).

[0050] When constructing recombinant plant expression vectors using the GmLTPP gene, any enhancing or constitutive promoter can be added before its transcription initiation nucleotide, including but not limited to the cauliflower mosaic virus (CAMV) 35S promoter and the maize ubiquitin promoter. These can be used alone or in combination with other plant promoters. Furthermore, when constructing plant expression vectors using the gene of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.

[0051] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.

[0052] In a specific embodiment, the recombinant vector C4) can be GmLTPP-sgRNA, and the structure of the recombinant vector GmLTPP-sgRNA is described as follows: a recombinant expression vector is obtained by inserting a DNA molecule with a target sequence of 5'-AATCAGATGATGCAAACCCA-3' into the cas9 / gRNA vector through homologous recombination, while keeping other sequences of the cas9 / gRNA vector unchanged.

[0053] The microorganisms mentioned in C5 of this article can be yeast, bacteria, algae, or fungi. Among them, bacteria can be from the genera *Escherichia*, *Erwinia*, *Agrobacterium*, *Flavobacterium*, *Alcaligenes*, *Pseudomonas*, *Bacillus*, etc. Specifically, it can be *Agrobacterium tumefaciens* EHA105.

[0054] In one specific embodiment, the recombinant microorganism may be recombinant Agrobacterium EHA105 / GmLTPP-sgRNA.

[0055] The recombinant Agrobacterium EHA105 / GmLTPP-sgRNA is a recombinant bacterium obtained by introducing the recombinant vector GmLTPP-sgRNA into Agrobacterium tumefaciens EHA105.

[0056] The present invention also provides the use of the protein GmLTPP described above, or a substance regulating gene expression, or a substance regulating the activity or content of said protein, in any of the following:

[0057] The application of the protein or gene expression substance or substance that regulates the activity or content of the protein described in U1) in regulating plant architecture and yield.

[0058] The application of the protein or gene-regulating substance or substance regulating the activity or content of the protein described in U2) in the preparation of products that regulate plant architecture and yield.

[0059] The application of the protein or gene-regulating substance described in U3) or the substance regulating the activity or content of the protein in cultivating plants with altered plant structure and increased yield.

[0060] The application of the protein or gene-regulating substance or substance regulating the activity or content of the protein described in U4) in the preparation of plant products with altered plant type and increased yield.

[0061] The application of the protein or gene expression substance or substance that regulates the activity or content of the protein described in U5) in plant breeding.

[0062] In this article, the substance that regulates the activity and / or content of the protein may be a substance that regulates gene expression, wherein the gene encodes the protein GmLTPP.

[0063] In this article, the substance that regulates gene expression can be a substance that performs at least one of the following six types of regulation:

[0064] 1) Regulation occurring at the transcriptional level of the aforementioned gene;

[0065] 2) Regulation that occurs after the gene is transcribed (i.e., regulation of the splicing or processing of the primary transcript of the gene);

[0066] 3) Regulation of RNA transport of the gene (that is, regulation of the transport of mRNA of the gene from the nucleus to the cytoplasm);

[0067] 4) Regulation of the translation of the aforementioned genes;

[0068] 5) Regulation of mRNA degradation of the aforementioned gene;

[0069] 6) Post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0070] In the above applications, the substance that regulates gene expression or the substance that regulates the activity or content of the protein can specifically be a biological material related to the protein, and the biological material can be the biological material described above.

[0071] In this article, regulating the expression of the gene encoding the protein can be achieved by inhibiting, reducing, or downregulating the expression of the gene. Inhibition, reduction, or downregulation of the gene expression can be achieved through gene knockout or gene silencing.

[0072] Gene knockout refers to the phenomenon of inactivating a specific target gene through gene editing technology. Gene knockout is achieved by altering the DNA sequence to inactivate a specific target gene.

[0073] In this invention, the purpose of plant breeding includes cultivating plants with altered plant type and increased / decreased yield.

[0074] The present invention also provides a method for cultivating plants with altered plant shape and / or yield, comprising:

[0075] 1) Inhibit, reduce or silence the expression level of the coding genes of the proteins mentioned above in the target plant, or / and inhibit, reduce or silence the activity and / or content of the coding genes of the proteins mentioned above, to obtain plants with altered plant type and increased yield.

[0076] 2) Increase, enhance, or upregulate the expression level of the coding genes of the proteins mentioned above in the target plant, or / and increase, enhance, or upregulate the activity and / or content of the coding genes of the proteins mentioned above, to obtain plants with altered plant type and reduced yield.

[0077] In one specific embodiment, a method for cultivating plants with altered plant type and increased yield includes the following steps: inhibiting the expression of nucleic acid molecules encoding GmLTPP protein in the target plant to obtain transgenic plants with altered plant type and increased yield. Specifically, the inhibition of nucleic acid molecule expression encoding GmLTPP protein in the target plant can be achieved by introducing a knockout vector targeting the nucleic acid molecule encoding GmLTPP protein into the target plant.

[0078] The knockout vector may be a gene editing vector. Specifically, the gene editing vector is a vector based on Cas9 gene editing technology. Specifically, the gene editing vector expresses sgRNA and Cas9 protein.

[0079] As one embodiment of the present invention, the method for cultivating plants with altered plant type and increased yield includes the following steps:

[0080] (1) Construct the gene editing vector of SEQ ID No. 4 that inhibits the expression of the GmLTPP gene;

[0081] (2) Introduce the gene editing vector constructed in step (1) into plants;

[0082] (3) Plants with altered plant type and increased yield obtained through screening and identification.

[0083] The sgRNA targets nucleic acid molecules encoding the GmLTPP protein. Specifically, the sgRNA sequence is: 5'-AATCAGATGATGCAAACCCA-3'.

[0084] In the above method, the target site for gene editing by the CRISPR / Cas9 system is the reverse complementary sequence at positions 3298-3317 of SEQ ID No. 1, which corresponds to the reverse complementary sequence at positions 246-265 of SEQ ID No. 3 (coding sequence).

[0085] In the above method, the CRISPR / Cas9 system gene editing can be performed by mutating the gene encoding the protein GmLTPP in the soybean genome as follows: deleting the nucleotide "5'-GCCATGGGTTTGCA-3'" at positions 3294-3303 of SEQ ID No. 1 (corresponding to positions 242-251 of SEQ ID No. 3 (coding sequence CDS)) and inserting the nucleotide "T" between positions 3293-3294 of SEQ ID No. 1 (corresponding to positions 241-242 of SEQ ID No. 3 (coding sequence CDS)), causing a frameshift mutation in the GmLTPP protein; thereby knocking out the gene encoding the GmLTPP protein.

[0086] In the above applications and methods, the regulation can be to increase, enhance, or upregulate.

[0087] In the above applications and methods, the regulation can be suppression, reduction, or silencing.

[0088] To facilitate the identification and screening of transgenic cells or plants, the recombinant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color reactions, antibiotic resistance markers, or chemical reagent resistance marker genes. Alternatively, without adding any selective marker genes, transformed plants can be directly screened for resistance under stress.

[0089] The plants obtained by the above methods can be transgenic plants or plants obtained through conventional breeding techniques such as hybridization. In the above methods, the transgenic plants are understood to include not only first- and second-generation transgenic plants, but also their progeny. For transgenic plants, the gene can be propagated within the species, or it can be transferred into other varieties of the same species using conventional breeding techniques, particularly commercial varieties. The transgenic plants include seeds, callus tissue, complete plants, and cells.

[0090] In this article, plant type traits may include plant height, number of pods per plant, number of seeds per plant and / or number of branches.

[0091] In the above applications or methods, the plant is any one of the following:

[0092] N1) Dicotyledons:

[0093] N2) Leguminosae;

[0094] N3) Leguminosae (family legumes);

[0095] N4) Soybean genus plants;

[0096] N5) soybeans.

[0097] This invention isolates and clones the GmLTPP gene from soybean, and knocks out the gene using gene editing technology to obtain the mutant gmltpp. Compared with the control plant height of 148.3 cm, the average plant height of the GmLTPP homozygous mutant is 119.6 cm, significantly lower than the control. Regarding branching phenotype, the control plant has 1.5 branches, while the GmLTPP homozygous mutant plant has 3.0 branches, a significant increase in branching. In terms of yield per plant, the control plant has an average of 106.5 pods and 257.8 seeds per plant, while the GmLTPP homozygous mutant plant has an average of 142.0 pods and 318.6 seeds per plant, significantly higher than the wild type. The experiment demonstrates that knocking out the GmLTPP protein can alter soybean plant architecture and increase yield, providing important guidance for soybean breeding. Attached Figure Description

[0098] Figure 1 This refers to the mutation type of the gmltpp mutant.

[0099] Figure 2 The strain type is the gmltpp mutant. Detailed Implementation

[0100] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0101] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0102] Unless otherwise specified, all quantitative experiments in the following examples are performed in triplicate.

[0103] MS salt in the following examples: PhytoTech, catalog number: M524; MS organic: PhytoTech, catalog number: M533; B5 organic: Phytotech, catalog number: G219; B5 salt: Phytotech, catalog number: G768.

[0104] The culture medium preparation method used in this invention is as follows:

[0105] 1) YEP solid medium consists of a solvent and a solute; the solutes and their concentrations in YEP solid medium are: NaCl 5g / L, yeast extract 5g / L, tryptone 10g / L, and agar 15g / L; the solvent is water. The pH of YEP solid medium is 7.0.

[0106] 1) Germination medium (pH 5.8): 3.12 g / L B5 salt, 1 ml / L B5 organic, 20 g / L sucrose, 7.5 g / L agar, with the remainder being water.

[0107] 2) Liquid culture medium (pH 5.4): 0.43 g / L MS salt, 1 ml / L B5 organic, 40 mg / L acetylsuccinone, 150 mg / L dithiothreitol, 100 mg / L L-cysteine, 30 g / L sucrose, 3.9 mg / L 2-morpholinoethanesulfonic acid, with the remainder being water.

[0108] 3) Co-culture medium (pH 5.4): 0.43 g / L MS salt, 1 ml / L B5 organic, 40 mg / L acetylsuccinone, 150 mg / L dithiothreitol, 100 mg / L L-cysteine, 30 g / L sucrose, 7.5 g / L agar, 3.9 mg / L 2-morpholinoethanesulfonic acid, with the remainder being water.

[0109] 4) Recovery medium (pH 5.4): 3.1 g / L B5 salt, 1 ml / L B5 organic, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 1 mg / L 6-BA, 0.98 g / L 2-morpholinoethanesulfonic acid, 7.5 g / L agar, 4 ml / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, with the remainder being water.

[0110] 5) Screening medium (pH 5.4): 3.1 g / L B5 salt, 1 ml / L B5 organic, 0.98 g / L 2-morpholinoethanesulfonic acid, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 1 mg / L 6-BA, 6 mg / L glufosinate, 7.5 g / L agar, 4 ml / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, with the remainder being water.

[0111] 6) Elongation medium (pH 5.6): 4.0 g / L MS salt, 1 ml / L B5 organic, 0.6 g / L 2-morpholinoethanesulfonic acid, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 0.1 mg / L IAA, 0.5 mg / L GA, 1 mg / L 6-BA, 6 mg / L glufosinate, 7.5 g / L agar, 4 ml / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, balance water.

[0112] 7) Rooting medium (pH 5.7): 2.165 g / L MS salt, 1 ml / L B5 organic, 0.6 g / L 2-morpholinoethanesulfonic acid, 20 g / L sucrose, 7.5 g / L agar, 50 mg / L L-asparagine, 50 mg / L L-glutamine, with the remainder being water.

[0113] The cultivated soybean Jack in the following examples has been described in: Chen L, Cai Y, Liu X, Yao W, Guo C, Sun S, Wu C, Jiang B, Han T, Hou W (2018), Improvement of soybean Agrobacterium-mediated transformation efficiency by adding glutamine and asparagine into the culture media. International Journal of Molecular Sciences 19, 3039. This biological material is available to the public from the applicant and is intended solely for the purpose of replicating the experiments of this invention and shall not be used for any other purpose.

[0114] The Agrobacterium tumefaciens EHA105 in the following examples has been described in: Cai Y, Chen L, Liu X, Guo C, Sun S, Wu C, Jiang B, Han T and Hou W (2018a), CRISPR / Cas9-mediated targeted mutationnesis of GmFT2a delays flowering time in soya bean. Plant Biotechnol J16, 176-185. This biological material is available to the public from the applicant and is intended solely for the purpose of repeating experiments of this invention and shall not be used for any other purpose.

[0115] The Cas9 / gRNA vector used in the following examples was purchased from Beijing Weishang Lide Biotechnology Co., Ltd., catalog number: VK005-15. This vector contains a Cas9 protein expression unit.

[0116] The data in the following examples were processed using SPSS 11.5 statistical software. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used, and P < 0.05 (*) indicates a significant difference, and P < 0.01 (**) indicates a highly significant difference.

[0117] Example 1: Construction of GmLTPP gene editing CRISPR vector

[0118] The gene for the soybean protein GmLTPP is located on soybean chromosome 12 and encodes the protein GmLTPP. Using the soybean variety Jack as a reference genome, the genomic sequence of the GmLTPP gene is SEQ ID No. 1, the coding sequence of the GmLTPP gene is SEQ ID No. 3, and the protein GmLTPP with the amino acid sequence SEQ ID No. 2 is encoded.

[0119] 1. Obtaining sgRNA

[0120] The target sequence for GmLTPP sgRNA was selected using the online CRISPR-P tool (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR). The target site is located in the first exon region of GmLTPP, and the sgRNA sequence is 5'-AATCAGATGATGCAAACCCA-3' (i.e., the reverse complementary sequence of positions 3298-3317 of SEQ ID No. 1, corresponding to the reverse complementary sequence of positions 246-265 of SEQ ID No. 3 (coding sequence)). After the target site was designed, the sgRNA was integrated into the vector.

[0121] First, the target primers for synthesizing sgRNA are as follows:

[0122] GmLTPP-F: 5'-TTG AATCAGATGATGCAAACCCA -3';

[0123] GmLTPP-R: 5'-AAC TGGGTTTGCATCATCTGATT -3';

[0124] (The underlined sequence is a 20bp sgRNA)

[0125] Add 5 μL each of GmLTPP-F and GmLTPP-R primers and 15 μL of water to a 25 μL system. Anneal at 95 °C for 3 min, then anneal at 0.1 °C / s to 16 °C and hold at 16 °C for 10 min to complete the annealing process, and obtain the gRNA annealed product with sticky ends.

[0126] 2. Preparation of GmLTPP gene editing expression vector GmLTPP-sgRNA

[0127] Take 1 μL of the gRNA annealing product with sticky ends obtained in step 2 above and perform T4 ligation with the cas9 / gRNA vector to obtain the recombinant vector Cas9-sgRNA. This vector expresses sgRNA. The target sequence binding region sequence in the sgRNA is the reverse complementary sequence of positions 3298-3317 of SEQ ID No. 1, which corresponds to the reverse complementary sequence of positions 246-265 of SEQ ID No. 3 (coding sequence).

[0128] The prepared recombinant vector Cas9-sgRNA was transformed into *E. coli* DH5α and plated on LB+Kan solid medium. Single clones were picked, plasmids were extracted, and sequenced. Sequencing primer SQ: 5'-GATGAAGTGGACGGAAGGAAGGAG-3'. The plasmid with the correctly inserted fragment was named the recombinant vector GmLTPP-sgRNA.

[0129] The structure of the recombinant vector GmLTPP-sgRNA is described as follows: A DNA molecule with the sequence 5'-AATCAGATGATGCAAACCCA-3' is linearly inserted into the cas9 / gRNA vector via homologous recombination, while keeping other sequences of the cas9 / gRNA vector unchanged, to obtain the recombinant expression vector.

[0130] The recombinant vector GmLTPP-sgRNA contains an sgRNA gene expression cassette with nucleotide sequences from positions 35 to 582 of SEQ ID No. 4. The sgRNA gene is shown as nucleotides from positions 480 to 499 of SEQ ID No. 4 in the sequence listing. Nucleotides 35-479 are the promoter for initiating sgRNA gene transcription, and nucleotides 576-582 are the terminator for terminating sgRNA gene transcription. Cas9-sgRNA also contains a Cas9 protein gene expression cassette with nucleotide sequences from positions 584 to 5568 of SEQ ID No. 4, and can express the Cas9 protein.

[0131] Example 2: Obtaining the GmLTPP gene-editing mutant

[0132] 1. Obtaining and phenotypic identifying GmLTPP mutants

[0133] The recombinant vector GmLTPP-sgRNA obtained in Example 1 was transformed into Agrobacterium EHA105 by electroporation. The plasmid was extracted and sequenced for verification. The recombinant strain that was correctly sequenced was named EHA / GmLTPP-sgRNA.

[0134] 2. Agrobacterium-mediated transformation

[0135] The EHA / GmLTPP-sgRNA constructed in step 1 was transformed into the soybean variety Jack (hereinafter referred to as wild-type soybean or WT) using Agrobacterium-mediated transformation. The specific method is as follows:

[0136] A. Seed sterilization

[0137] 1) Take healthy, plump, uniform, and dry Jack soybean seeds that are free from pests, diseases, and spots, spread them evenly in a petri dish, and then place the petri dish in a desiccator.

[0138] 2) After completing step 1), place a 100ml beaker in the desiccator, pour 80ml of 12M sodium hypochlorite aqueous solution into the beaker, then slowly add 4ml of concentrated hydrochloric acid, and then quickly cover the desiccator, seal it with petroleum jelly, and place it for 16 hours for chlorine sterilization.

[0139] B. Preparation of infecting bacterial solution

[0140] 1) Incubate the EHA / GmLTPP-sgRNA bacterial culture obtained in step 4 above at 28℃, resuspend it in liquid culture medium, and obtain OD. 600nm =0.6% of the infecting bacterial solution.

[0141] 2) Place the seeds treated in step A into a clean bench. Under a microscope, peel off the seed coat, separate the two cotyledons along the long axis, and keep the cotyledon with the complete hypocotyl. Make scratches at the junction of the hypocotyl and cotyledon, usually 3-5 scratches per cotyledon. Then, immerse the seeds in a 28℃ incubator for 2 hours.

[0142] 3) Place the cotyledons with the inner (smooth) side up on a co-culture medium lined with sterile filter paper, and incubate in the dark at 22°C for 5 days.

[0143] 4) After 5 days of co-culture, the hypocotyl of the explants elongated to 2 cm. Part of the hypocotyl was cut off, leaving 0.5 cm. The treated explants were then placed in recovery medium and cultured at 28°C under 16 h light / 8 h dark conditions for 7 days.

[0144] 5) Remove the explants from the recovery medium, remove the new shoots, cut off part of the hypocotyl, leaving 0.5 cm of the hypocotyl, and then transfer the trimmed explants into the selection medium and culture them at 28℃ for 21 days under 16h light / 8h dark conditions.

[0145] 6) After 21 days of selection and induction, the explants produced a large number of adventitious buds. The cotyledons and brown leaves were removed, and the remaining parts were transferred to elongation medium for culture at 28°C under 16h light / 8h dark conditions.

[0146] 7) In the elongation medium, when the clustered buds produce 5-8cm young stems, cut them off from the base of the adventitious buds; dip the stem base in 1mg / LIBA solution for 1min, and then transfer it to the rooting medium for culture. Culture at 28℃ under 16h light / 8h dark conditions for one week. After a large number of roots are produced at the base of the stem, transplant them into pots. The resulting plants are T0 generation transformed soybeans.

[0147] 3. Molecular detection of edited plants

[0148] DNA was extracted from the leaves of T0 generation transformed soybean obtained in step 5 and used as a template for PCR molecular detection, with wild-type soybean as a control.

[0149] The PCR primer set LTPP-F / LTPP-R was designed near the target site of the GmLTPP gene to amplify the GmLTPP gene by PCR and then sequenced.

[0150] LTPP-F: 5'-TCCGTCAGACCTACAAGTTG-3';

[0151] LTPP-R: 5'-ACAGTGTTGACAGGATTGTA-3'.

[0152] PCR reaction system: 12.5 μL 2×PhantaMax Buffer, 0.5 μL dNTP Mix (10 mM), 1 μL DNA (200 ng / μL), 1 μL LTPP-F (10 pmol / μL), 1 μL LTPP-R (10 pmol / μL), 0.5 μL Super-Fidelity DNA Polymerase, 8.5 μL ddH2O, total volume 25 μL. Amplification reaction system: 95℃ for 3 min; 95℃ for 30 sec, 58℃ for 30 sec, 72℃ for 1 min, 35 cycles; 72℃ for 5 min. PCR products were sent to the company for sequencing verification.

[0153] The plants exhibiting overlapping peaks near the target site were heterozygous edited plants, named T0 generation GmLTPP gene-edited soybeans.

[0154] T0 generation GmLTPP gene-edited soybeans were sown and seeds of T1 generation GmLTPP gene-edited soybeans were harvested to obtain T1 generation GmLTPP gene-edited soybeans.

[0155] PCR was used to detect the GmLTPP gene-edited soybean of generation T1. Sequencing results of the amplified products showed that, compared with the genomic DNA of soybean variety Jack (wild type, abbreviated as WT), the gene encoding the GmLTPP protein in the two homologous chromosomes of the GmLTPP homozygous mutant had the following mutation: the nucleotide "5'-GCCATGGGTTTGCA-3'" at positions 3294-3303 of SEQ ID No. 1 (corresponding to positions 242-251 of SEQ ID No. 3 (coding sequence CDS) was deleted, and the nucleotide "T" was inserted between positions 3293-3294 of SEQ ID No. 1 (corresponding to positions 241-242 of SEQ ID No. 3 (coding sequence CDS)), thereby knocking out the gene encoding the GmLTPP protein. The sequencing results of this mutation site and its surrounding nucleotides are shown in [Figure 1]. Figure 1 .

[0156] The T1 generation GmLTPP gene-edited soybean mutant plants with the above-mentioned GmLTPP gene mutation type were further cultured and screened to obtain the T2 generation GmLTPP gene-edited soybean homozygous mutant GmLTPP without transgenic elements.

[0157] Example 3: Phenotypic Identification of GmLTPP Gene-Edited Soybean Mutants

[0158] The plants to be tested were soybean varieties Jack and GmLTPP gene-edited soybean gmltpp, grown in a net house under natural light conditions in Beijing during the summer. The planting conditions were: plant spacing 10cm and row spacing 50cm.

[0159] Plant morphological traits (plant height, number of nodes, number of branches, number of pods per plant, and number of grains per plant) of the wild-type soybean variety Jack (control plant) and the homozygous mutant gmltpp of GmLTPP were statistically analyzed. The experimental materials were replicated three times, with at least six plants from each line measured each time.

[0160] The research results show (Table 1 and...) Figure 2 Regarding plant type, compared with the control plant height of 148.3 cm, the average height of the GmLTPP homozygous mutant was 119.6 cm, which was significantly lower than that of the control. Regarding branching phenotype, the control plant had 1.5 branches, while the GmLTPP homozygous mutant plant had 3.0 branches, which was significantly increased. Regarding the number of nodes, the control plant had 25.0 nodes, while the GmLTPP homozygous mutant plant had an average of 25.2 nodes, which was not significantly different from that of the control.

[0161] In terms of yield per plant, the control plants had an average of 106.5 pods and 257.8 seeds per plant, while the GmLTPP homozygous mutant had an average of 142.0 pods and 318.6 seeds per plant. The number of pods and seeds per plant in the GmLTPP homozygous mutant was significantly increased compared to the wild type.

[0162] Table 1. Statistics on soybean plant type data

[0163]

[0164] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method for regulating plant height, number of branches, number of pods per plant, and number of seeds per plant, characterized in that, This includes reducing the protein content in the target plant, or reducing the expression level of the gene encoding the protein, in order to reduce plant height and increase the number of branches, pods per plant, and grains per plant. The protein is a protein with an amino acid sequence as shown in SEQ ID No. 2; The plant in question is soybean.

2. The method according to claim 1, characterized in that, The method includes introducing a substance into a recipient plant that inhibits the expression of the gene encoding the protein, thereby reducing plant height and increasing the number of branches, pods per plant, and grains per plant; the gene encoding the protein as described in claim 1.

3. The method according to claim 2, characterized in that, The encoding gene is the gene shown in E1) or E2) below: E1) The coding sequence is the cDNA molecule of SEQ ID No. 3; E2) The nucleotide sequence is the DNA molecule of SEQ ID No.

1.

4. The use of a substance that inhibits the expression of the protein-coding gene as described in claim 1 or a substance that reduces the content of said protein in any of the following: U1) Application in reducing plant height and increasing the number of branches, pods per plant, and grains per plant; U2) Application in the preparation of products that reduce plant height and increase the number of branches, pods per plant, and grains per plant; U3) Application in cultivating plants with reduced plant height and increased number of branches, number of pods per plant and number of grains per plant; U4) Application in the preparation of plant products with reduced plant height, increased number of branches, increased number of pods per plant, and increased number of seeds per plant; U5) Application in plant breeding; the purpose of the breeding is to select plant varieties with reduced plant height and increased number of branches, number of pods per plant and number of grains per plant. The plant in question is soybean; The substance is any one of the following: C1) A nucleic acid molecule that inhibits the expression of the gene encoding the protein described in claim 1; C2) expresses the gene encoding the nucleic acid molecule described in C1); C3) contains an expression cassette containing the gene encoding described in C2); C4) A recombinant vector containing the encoding gene described in C2), or a recombinant vector containing the expression cassette described in C3); C5) A recombinant microorganism containing the encoding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4).

5. A method for cultivating plants with reduced plant height and increased number of branches, number of pods per plant, and number of grains per plant, comprising reducing the expression level of the gene encoding the protein of claim 1 in the target plant, or reducing the content of the protein of claim 1, to obtain plants with reduced plant height and increased number of branches, number of pods per plant, and number of grains per plant; wherein the plant is soybean.