Application of knocking out the soybean GmDMEb gene in increasing the number of branches in soybean plants and improving soybean yield

Abstract

The application of knocking out the soybean GmDMEb gene in increasing the number of branches in soybean plants and improving soybean yield belongs to the field of genetic engineering technology. To discover genes that can regulate the number of branches in soybean plants, construct ideal soybean plant architecture, and increase soybean yield, this invention utilizes the CRISPR-Cas9 system to construct a soybean GmDMEb gene knockout vector. This vector was transformed into Agrobacterium, and then soybeans were infected with it to obtain transgenic soybeans with the GmDMEb gene knocked out. This demonstrated that knocking out the GmDMEb gene can increase the number of branches in soybean plants and improve soybean yield. This invention provides a theoretical basis for creating superior soybeans and breeding high-yielding soybean varieties, and has significant theoretical and practical value.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of knocking out the soybean GmDMEb gene in increasing the number of branches in soybean plants and improving soybean yield. Background Technology

[0002] The branch number (BN) of soybean serves as the backbone of yield factors and is closely related to soybean plant structure, yield, and adaptability (Wang, B., SMSmith, and J. Li, Genetic Regulation of Shoot Architecture. Annu Rev Plant Biol, 2018. 69: p. 437-468.)(Liang, Q., et al., Natural variation of Dt2 determines branching in soybean. Nat Commun, 2022. 13(1): p. 6429.). The number of branches affects the distribution of light and ventilation in the canopy, which in turn affects the leaf area index and light energy utilization of the canopy, ultimately affecting yield. Related studies have shown that yield compensation is mainly caused by an increase in the number of pods on plant branches (Rameau, C., et al., Multiple pathways regulate shoot branching. Front Plant Sci, 2014. 5: p. 741.). When the yield of the main stem is reduced due to external conditions during plant development, the increase in branch yield can effectively compensate for the loss caused by the reduced main stem yield per unit area (Rameau, C., et al., Multiple pathways regulate shoot branching. Front Plant Sci, 2014.5: p.741.). However, as a complex quantitative trait, the number of branches has low heritability. It often shows a significant decreasing trend with increasing planting density and is highly susceptible to the influence of cultivation conditions and growth environment. Therefore, there are relatively few genetic studies on the branch number trait (Liang, Q., et al., Natural variation of Dt2 determines branching in soybean. Nat Commun, 2022.13(1): p.6429.). Therefore, identifying genes related to branch number regulation is of great significance for constructing an ideal soybean plant architecture and increasing soybean yield. Summary of the Invention

[0003] In order to discover genes that can regulate the number of branches in soybean plants, construct an ideal soybean plant type, and increase soybean yield, this invention uses the CRISPR-Cas9 system to construct a soybean GmDMEb gene knockout vector. This vector is then transformed into Agrobacterium and subsequently used to infect soybeans to obtain transgenic soybeans with the GmDMEb gene knocked out. This demonstrates that knocking out the GmDMEb gene can increase the number of branches in soybean plants and improve soybean yield.

[0004] To solve the above-mentioned technical problems and achieve the corresponding technical effects, the present invention provides the following technical solution:

[0005] The first objective of this invention is to provide the application of knocking out the soybean GmDMEb gene in increasing the number of branches in soybean plants, wherein the nucleotide sequence of the soybean GmDMEb gene is shown in SEQ ID NO.1, and the knockout of the soybean GmDMEb gene results in the loss of function of the GmDMEb gene.

[0006] The second objective of this invention is to provide the application of knocking out the soybean GmDMEb gene in increasing soybean yield, wherein the nucleotide sequence of the soybean GmDMEb gene is shown in SEQ ID NO.1, and the knockout of the soybean GmDMEb gene results in the loss of function of the GmDMEb gene.

[0007] In one embodiment of the present invention, the soybean GmDMEb gene encodes an amino acid sequence as shown in SEQ ID NO.2.

[0008] A third objective of this invention is to provide a method for cultivating soybeans with multiple branches, wherein the method involves knocking out the soybean GmDMEb gene to render it nonfunctional, and the nucleotide sequence of the soybean GmDMEb gene is shown in SEQ ID NO. 1.

[0009] The fourth objective of this invention is to provide a method for cultivating high-yield soybeans, wherein the method involves knocking out the soybean GmDMEb gene to render the GmDMEb gene nonfunctional, and the nucleotide sequence of the soybean GmDMEb gene is shown in SEQ ID NO.1.

[0010] In one embodiment of the present invention, the knockout is performed by knocking out the GmDMEb gene in recipient soybean using the CRISPR-Cas9 system.

[0011] In one embodiment of the present invention, the upstream and downstream primer nucleotide sequences of the gRNA target in the CRISPR-Cas9 system are shown in SEQ ID NO.7 and SEQ ID NO.8, respectively.

[0012] The fifth objective of this invention is to provide an application of a soybean GmDMEb gene knockout vector in increasing the number of branches in soybean plants or cultivating soybeans with more branches. The GmDMEb gene knockout vector is constructed using CRISPR-Cas9 editing technology, and the nucleotide sequence of the soybean GmDMEb gene is shown in SEQ ID NO.1.

[0013] The sixth objective of this invention is to provide an application of a soybean GmDMEb gene knockout vector in increasing soybean yield or cultivating high-yield soybeans. The GmDMEb gene knockout vector is constructed using CRISPR-Cas9 editing technology, and the nucleotide sequence of the soybean GmDMEb gene is shown in SEQ ID NO.1.

[0014] The seventh objective of this invention is to provide a formulation for increasing the number of branches in soybean plants or improving soybean yield, characterized in that the active ingredient of the formulation includes a soybean GmDMEb gene knockout vector, which is constructed using CRISPR-Cas9 editing technology, and the nucleotide sequence of the soybean GmDMEb gene is shown in SEQ ID NO.1.

[0015] The beneficial effects of this invention are:

[0016] This invention knocks out the GmDMEb gene, a DNA demethylating glycosylase, in wild soybean, obtaining a GmDMEb gene knockout mutant soybean. Compared to wild-type soybean, the mutant soybean showed increased branching, altered plant architecture, and improved pod number and yield per plant. This invention provides important evidence for elucidating DME function and advancing epigenetic research, and is of great significance for constructing an ideal soybean plant architecture and increasing soybean yield. Attached Figure Description

[0017] Figure 1 Figure 1 shows the results of the expression analysis of the GmDMEb gene in 50 tissues of Dongnong.

[0018] Figure 2 Figure showing the expression levels of the GmDMEb gene at different developmental stages of axillary buds; Figure 2 **P < 0.01;

[0019] Figure 3 A schematic diagram illustrating the construction of the soybean GmDMEb gene knockout vector;

[0020] Figure 4 The image shows the PCR detection results of the Agrobacterium tumefaciens bacterial culture obtained through transformation.

[0021] Figure 5 This is a schematic diagram of the soybean plant tissue culture process after transformation; Figure 5 In this context, A represents recovery culture. Figure 5 In this context, B represents screening with a screening agent. Figure 5 C in the text represents elongation culture. Figure 5 In this context, D stands for rooting culture. Figure 5 E in the text stands for seedling hardening;

[0022] Figure 6 The image shows the detection results of soybean mutants; among them, Figure 6 In the figure, A represents the electrophoresis result obtained by PCR detection of sgRNA in T2 generation transgenic seedlings. Figure 6 B in the figure represents the DNA sequencing results of the PCR products obtained from PCR detection of sgRNA in T2 generation transgenic seedlings.

[0023] Figure 7 The graph shows the statistical results of phenotype, branch number, number of pods per plant, and yield per plant for wild-type soybean and the mutant dmeb; among them, Figure 7 In the diagram, A represents the phenotypic diagram of wild-type soybean and the mutant dmeb. Figure 7 In the figure, B represents the statistical results of the number of branches in wild-type soybean and the mutant dmeb. Figure 7 In the figure, C represents the statistical results of the number of pods per plant in wild-type soybean and mutant dmeb. Figure 7 In the figure, D represents the statistical results of single-plant yield of wild-type soybean and mutant dmeb; *P<0.05, **P<0.01. Detailed Implementation

[0024] The following embodiments are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods and apparatus used in the following embodiments are conventional methods and apparatus. Unless otherwise specified, the experimental materials used in the following embodiments were purchased from conventional biochemical reagent stores. The determination of mutation sites in the mutants in the following embodiments was performed by conventional sequencing companies. To make the objectives, technical solutions, and advantages of this invention clearer, the specific implementation methods of this invention are described in detail below with reference to specific embodiments and accompanying drawings.

[0025] It should also be noted that, in order to avoid obscuring the technical solution of this invention patent due to unnecessary details, only the technical solutions and / or processing steps closely related to the solution of this invention patent are shown in the embodiments, while other details that are not closely related are omitted.

[0026] In this example, the soybean cultivar Dongnong 50 was selected. Dongnong 50 is an Electron small-grain soybean cultivar introduced from Canada in 2003. Its approval number is Heishendou 2007022, and it is described in the following literature: Yu JIN, Juanjuan QU, Guangming REN, Lei DONG. Effects of Transgenic DREB Soybean Dongnong50 on the Diversity of Soil Ammonia-oxidizing Bacteria. Agricultural Science & Technology. 2013, 14(7):988-992. In the following text, the soybean cultivar Dongnong 50 is referred to as Dongnong 50.

[0027] Example 1: The role of the soybean GmDMEb gene in regulating axillary bud differentiation and branching.

[0028] To investigate the role of the soybean GmDMEb gene in regulating axillary bud differentiation and branching, this invention analyzed the tissue specificity and expression pattern of the soybean GmDMEb gene, as detailed below:

[0029] First, RNA was extracted from the roots, stems, leaves, seeds, flowers, and axillary buds of Dongnong 50 soybean, and then reverse transcribed into cDNA. Real-time quantitative PCR primers were then designed to determine the expression of the GmDMEb gene (the nucleotide sequence of the GmDMEb gene is shown in SEQ ID NO.1, and the amino acid sequence encoded by this gene is shown in SEQ ID NO.2) in each of these tissues. The primer sequences are as follows:

[0030] qRT-DMEb-F (SEQ ID NO.3): CACGGATGCATCTTATTCAAGG;

[0031] qRT-DMEb-R(SEQ ID NO.4):GCAGAGCTTGAAAGATGATCTG

[0032] SEQ ID NO.1:

[0033]

[0034] SEQ ID NO.2:

[0035]

[0036] Depend on Figure 1 It can be seen that the expression of the GmDMEb gene varies in different tissues of Dongnong 50. Compared with the expression level of the GmDMEb gene in roots, stems and leaves, the expression level of the GmDMEb gene in soybean seeds, flowers and axillary buds is significantly higher.

[0037] Furthermore, this invention involves taking fresh axillary buds on the 20th and 40th days after emergence of Dongnong 50 seedlings (flower bud differentiation period, also known as branching period), and using the same real-time quantitative fluorescent PCR primers to detect the expression of the GmDMEb gene at different developmental stages of the axillary buds. Figure 2 It can be seen that the expression level of the GmDMEb gene is higher at the beginning of soybean axillary bud differentiation than at the end of axillary bud differentiation, which further illustrates that GmDMEb plays a role in regulating axillary bud differentiation and branching.

[0038] Example 2: Construction of soybean mutant gmdmeb

[0039] First, sgRNAs targeting the exon regions of the GmDMEb gene were designed using the online CRISPR-GE tool (http: / / skl.scau.edu.cn / home / ). Two relatively excellent target sequences were ultimately identified: sgRNA1-GAATGAAGTTAGGGAACATTGCGA (SEQ ID NO.5); and sgRNA2-AAGGCCACAGAGATGCTGGA (SEQ ID NO.6). Taking advantage of the difference between the Bsa I recognition and cleavage sites, primers sgRNA-F and sgRNA-R (nucleotide sequences shown in SEQ ID NO.7 and SEQ ID NO.8, respectively; the bolded bases represent the Bsa I recognition site, and the underlined bases represent the Bsa I cleavage site) were designed. Using the pGES401 vector plasmid as a template, PCR amplification of the sgRNA-sgRNA scaffold-tRNA-sgRNA fragment was performed using sgRNA-F and sgRNA-R, and the PCR product was purified. The vector was constructed using the Golden Gate one-step method, which involves simultaneously adding BsaI restriction enzyme and T4 ligase to the reaction system to ligate the purified fragment with the pGES401 plasmid during enzyme digestion (see schematic diagram of vector construction). Figure 3As shown), and introduced into EHA105 Agrobacterium, for colony PCR detection. Using detection primers STU-TEST-3F and STU-TEST-4R (nucleotide sequences shown in SEQ ID NO. 9 and SEQ ID NO. 10, respectively), the target sequence (944 bp in size) was finally detected at 1000 bp. Figure 4 Based on the company's sequencing results, the specific sgRNA target was preliminarily identified and successfully ligated into the pGES401 vector. The obtained Agrobacterium was transformed into the recipient soybean variety DN50 using the soybean cotyledon node transformation method, followed by plant tissue culture (e.g., ...). Figure 5 DNA was extracted from the obtained tissue culture seedlings, and sgRNA was amplified by PCR. Positive plants were selected by agarose gel electrophoresis and DNA sequencing.

[0040] sgRNA-F (SEQ ID NO.7):

[0041] TGGTCTCg TGCA GAATGAAGTTAGGGAACATTgttttagagctagaaatagc;

[0042] sgRNA-R (SEQ ID NO.8):

[0043] TGGTCTCg AAAC TCCAGCATCTCTGTGGCCTTtgcaccagccgggaatcgaa;

[0044] STU-TEST-3F (SEQ ID NO.9): TGCTACCCTCATCCATCAGTC;

[0045] STU-TEST-4R (SEQ ID NO.10): TGTTGTGTGGAATTGTGAGCG

[0046] The soybean mutant gmdmeb seeds were cultivated using the following method.

[0047] Black soil and vermiculite were mixed at a mass ratio of 3:1 and sterilized at high temperature. Soybean mutant T2 generation seeds were sown in the mixed soil and cultured in an incubator at 25℃ with 16 hours of light. Water and fertilizer management was adjusted according to the plants' growth. After the plants were robust and stable, leaves were harvested for DNA extraction. Using the extracted DNA as a template, specific primers GmDMEb-TEST-F and GmDMEb-TEST-R (nucleotide sequences shown in SEQ ID NO.11 and SEQ ID NO.12, respectively) were designed for the sgRNA and its two ends. PCR detection was performed on the T2 generation transgenic seedlings, yielding the target band (611 bp). Figure 6 As shown in A, the PCR product, which met the expected size, was sequenced for DNA. Seven editing types were ultimately detected. The mutation information of the soybean mutant gmdmeb is shown below. Figure 6 As shown in B, five mutations caused premature termination of GmDMEb (mutation type 1, mutation type 2, mutation type 3, mutation type 4, and mutation type 6). Mutation type 1 corresponds to dmeb-1 in Example 3, mutation type 2 corresponds to dmeb-2 in Example 3, mutation type 3 corresponds to dmeb-3 in Example 3, mutation type 4 corresponds to dmeb-4 in Example 3, and mutation type 6 corresponds to dmeb-6 in Example 3.

[0048] GmDMEb-TEST-F (SEQ ID NO. 11): CAGAAAGCAACCCAGCGAAG;

[0049] GmDMEb-TEST-R(SEQ ID NO.12):ATCCATTATTTCCTTCCTGACACAA

[0050] Example 3: Application of soybean GmDMEb gene knockout in increasing soybean plant branch number and improving soybean yield

[0051] Wild-type soybean (WT / DN50) and the prematurely terminated soybean mutant gmdmeb T2 generation plants were bred using the following method.

[0052] Soybeans were planted at a transgenic facility, with water and fertilizer management tailored to weather and growth conditions. Weeding was carried out before flowering. Wild-type soybeans and the prematurely terminated soybean mutants dmeb (dmeb-1, dmeb-2, dmeb-3, dmeb-4, dmeb-6) were planted and managed using the same methods. After plant maturity, phenotype, number of branches, number of pods per plant, and yield per plant were investigated and recorded. The phenotypes of wild-type soybeans and the dmeb mutants are as follows: Figure 7 As shown in Figure A, the statistical results of the number of branches in wild-type soybean and mutant dmeb are as follows. Figure 7As shown in B, the statistical results of the number of pods per plant are shown in the figure below. Figure 7 As shown in C, the statistical results of single-plant yield are shown in the figure below. Figure 7 As shown in D in the figure. P-values ​​were tested using a two-tailed Student's t-test (*P < 0.05, **P < 0.01). The results showed that the number of branches, the number of pods per plant, and the yield were all significantly increased in all five mutant lines. This indicates that knocking out the soybean GmDMEb gene can increase the number of branches in soybean plants and improve soybean yield.

[0053] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. Knock out soybeans GmDMEb The application of genes in increasing the number of branches in soybean plants is characterized by, soybeans GmDMEb The nucleotide sequence of the gene is shown in SEQ ID NO.

1. Knockout soybean GmDMEb Genes are what make GmDMEb Loss of gene function; the knockout is achieved using the CRISPR-Cas9 system to target the gene in recipient soybeans. GmDMEb For gene knockout, the upstream and downstream primer nucleotide sequences of the gRNA target in the CRISPR-Cas9 system are shown in SEQ ID NO.7 and SEQ ID NO.8, respectively.

Images