Plant type and yield related gmbbr2 protein and its coding gene and application

Abstract

The application discloses a plant type and yield related GmMBR2 protein and a coding gene and application thereof, and belongs to the field of plant breeding, and relates to a plant type and yield related GmMBR2 protein and a coding gene and application thereof. The protein of the application is any one of the following: A1) a protein with an amino acid sequence shown in SEQ ID No. 1; A2) a protein obtained by substitution, deletion and / or addition of amino acid residues on the protein of A1) and having more than 80% identity with the protein shown in A1) and having the same function; and A3) a fusion protein obtained by connecting a protein tag to the N terminal or / and C terminal of A1) or A2). Experiments prove that the protein GmMBR2 can regulate plant type and yield, and has important theoretical significance for soybean breeding.

Description

Technical Field

[0001] This invention belongs to the field of plant breeding and relates to the GmMBR2 protein and its encoding gene, which are related to plant plant type and yield, and their applications. Background Technology

[0002] With the continuous improvement of people's living standards, the demand for vegetable oil and feed protein has increased dramatically. How to quickly and effectively improve soybean varieties and increase soybean yield through modern biological breeding technology is an important production problem that needs to be solved and a breeding technology bottleneck that needs to be broken through.

[0003] Crop plant architecture plays a decisive role in the morphogenesis of individual plants and crop populations, and is a crucial factor influencing plant yield, crop production level, and economic benefits. Crop plant architecture includes plant height, branching (tillering), leaf shape, and ear type (pod-setting habit). The domestication or improvement of crop plant architecture plays a vital role in achieving significant breakthroughs in crop yield. However, current research on the regulatory mechanisms of soybean plant architecture and key genes involved in this regulation is still in the exploratory stage, with few related research reports. The molecular mechanisms, key genes, and functional networks affecting soybean plant architecture regulation remain unclear. In particular, due to limitations in research materials, there is a lack of research on which plant architecture is more conducive to increasing soybean yield under field production conditions. Therefore, further exploration of more plant architecture regulatory genes is not only of significant theoretical value for discovering superior soybean plant architecture regulatory genes and cultivating high-yielding ideal plant architectures; but also, through the creation of specific materials, allows for the systematic evaluation and selection of ideal soybean plant architectures under production conditions, which has significant practical application value for ultimately realizing breeding applications and improving soybean yield. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to regulate plant shape and increase plant yield.

[0005] To address the problems existing in the prior art, the present invention provides a protein.

[0006] The protein provided by this invention may be any of the following:

[0007] A1) A protein with the amino acid sequence shown in SEQ ID No. 1;

[0008] A2) Proteins obtained by substituting and / or deleting and / or adding amino acid residues of the protein in A1) that have more than 75% identity with the protein shown in A1) and that regulate plant architecture and yield; for example, those skilled in the art can, based on the amino acid sequence shown in SEQ ID No. 1 and conventional techniques such as the conserved substitution of amino acids, obtain protein mutants with the same function as the amino acid sequence shown in SEQ ID No. 1 by substituting, deleting and / or adding one or more amino acids without affecting their activity.

[0009] A3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).

[0010] The protein described in A1 above is named GmMBR2.

[0011] To facilitate the purification or detection of the protein in A1), a tag protein can be attached to the amino or carboxyl terminus of the protein, which consists of the amino acid sequence shown in SEQ ID No. 1 in the sequence listing.

[0012] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0013] The tagged proteins include, but are not limited to: GST (glutathione thiotransferase) tagged protein, His6 tagged protein (His-tag), MBP (maltose-binding protein) tagged protein, Flag tagged protein, SUMO tagged protein, HA tagged protein, Myc tagged protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tagged protein.

[0014] Those skilled in the art can readily mutate the nucleotide sequence encoding the protein GmMBR2 of this invention using known methods, such as directed evolution or point mutation. Any artificially modified nucleotides that possess 75% or more of the nucleotide sequence identity with the protein GmMBR2 isolated in this invention, provided they encode and function as protein GmMBR2, are derived from and equivalent to the nucleotide sequence of this invention.

[0015] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0016] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid or nucleotide sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search to calculate the identity of a pair of amino acid sequences or nucleotide sequences, then the identity value (%) can be obtained.

[0017] In this document, the 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0018] In this document, the 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0019] The protein mentioned above is derived from soybean (Glycine max (L.) Merr.).

[0020] The present invention also provides biomaterials related to the above-mentioned proteins, said biomaterials may be any of the following:

[0021] B1) Nucleic acid molecules that encode the proteins described above;

[0022] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0023] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0024] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0025] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);

[0026] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0027] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2);

[0028] C1) Nucleic acid molecules that inhibit, reduce, or silence the expression of the genes encoding the proteins described above;

[0029] C2) expresses the gene encoding the nucleic acid molecule described in C1);

[0030] C3) contains an expression cassette encoding the gene described in C2);

[0031] C4) A recombinant vector containing the encoding gene described in C2), or a recombinant vector containing the expression cassette described in C3);

[0032] C5) A recombinant microorganism containing the encoding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4);

[0033] C6) A transgenic plant cell line containing the encoding gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4);

[0034] C7) Transgenic plant tissue containing the encoding gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4);

[0035] C8) A transgenic plant organ containing the encoding gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).

[0036] In the above-mentioned biological materials, the nucleic acid molecule described in B1) may be a gene as shown in E1) or E2) below:

[0037] E1) The coding sequence is the cDNA molecule or DNA molecule of SEQ ID No. 2;

[0038] The nucleotides encoding the E2) chain are the cDNA or DNA molecules of SEQ ID No. 3.

[0039] The DNA molecule shown in SEQ ID No. 2 (the GmMBR2 gene that regulates plant architecture and yield traits) encodes the protein GmMBR2, whose amino acid sequence is the same as that in SEQ ID No. 1.

[0040] The nucleotide sequence shown in SEQ ID No. 2 is the nucleotide sequence of the gene encoding the protein GmMBR2 (CDS).

[0041] The GmMBR2 gene described in this invention can be any nucleotide sequence capable of encoding the protein GmMBR2. Considering codon degeneracy and the codon preferences of different species, those skilled in the art can use codons suitable for expression in specific species as needed.

[0042] B1) The nucleic acid molecule may also include a nucleic acid molecule obtained by codon preference modification based on the nucleotide sequence shown in SEQ ID No. 2.

[0043] B1) The nucleic acid molecule may also include nucleic acid molecules that have a nucleotide sequence identity of more than 95% with the nucleotide sequence shown in SEQ ID No. 2 and originate from the same species.

[0044] The nucleic acid molecules mentioned in this article can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecules can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0045] The vectors described herein are well-known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors. Specifically, it may be the vector cas9 / gRNA.

[0046] Recombinant expression vectors containing the GmMBR2 gene can be constructed using existing plant expression vectors. These plant expression vectors include, but are not limited to, binary Agrobacterium vectors and vectors suitable for plant microbombardment. The plant expression vectors may also contain the 3' untranslated region of the exogenous gene, i.e., containing a polyadenylate signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylate signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor; similar functions exist for the untranslated regions transcribed at the 3' end of genes including, but not limited to, Agrobacterium crown gall-inducing (Ti) plasmids (such as the Nos gene for lipase synthesis) and plant genes (such as the soybean storage protein gene).

[0047] When constructing a recombinant plant expression vector using the GmMBR2 gene, any enhancing or constitutive promoter can be added before its transcription initiation nucleotide, including but not limited to the cauliflower mosaic virus (CAMV) 35S promoter and the maize ubiquitin promoter. These can be used alone or in combination with other plant promoters. Furthermore, when constructing a plant expression vector using the gene of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.

[0048] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.

[0049] In one specific embodiment, the recombinant vector is GmMBR2-sgRNA, and the structure of the recombinant vector GmMBR2-sgRNA is described as follows: a DNA molecule with a target sequence of 5'-AGATTATTGTGTTTGGAGAG-3' is inserted into a linear cas9 / gRNA vector via homologous recombination, while keeping other sequences of the cas9 / gRNA vector unchanged, resulting in a recombinant expression vector. The nucleotide sequence of the recombinant vector GmMBR2-sgRNA is sequence 4 in the sequence listing.

[0050] The microorganisms described in this article can be yeast, bacteria, algae, or fungi. Among them, bacteria can originate from genera such as *Escherichia*, *Erwinia*, *Agrobacterium*, *Flavobacterium*, *Alcaligenes*, *Pseudomonas*, and *Bacillus*. Specifically, *Agrobacterium tumefaciens* EHA105 is an example.

[0051] In one specific embodiment, the recombinant microorganism may be recombinant Agrobacterium EHA105 / GmMBR2-sgRNA.

[0052] The recombinant Agrobacterium EHA105 / GmMBR2-sgRNA is a recombinant bacterium obtained by introducing the recombinant vector GmMBR2-sgRNA into Agrobacterium tumefaciens EHA105.

[0053] The present invention also provides a method for regulating plant architecture and increasing yield, comprising regulating the activity and / or content of the proteins described above in the target plant, and / or the expression level of the genes encoding the proteins, to regulate plant architecture and increase yield.

[0054] In the above method, regulating the activity and / or content of the protein GmMBR2 in the target plant, or / and the expression level of the gene encoding the protein, includes introducing the gene encoding the protein GmMBR2 to the recipient plant to inhibit, reduce, or silence the protein, thereby obtaining a target plant with altered plant architecture and increased yield; the gene encoding the GmMBR2 encodes the protein GmMBR2.

[0055] The importation refers to the importation through recombination methods, including but not limited to Agrobacterium-mediated transformation, bio-projectile methods, electroporation, in-planta technology, and so on.

[0056] In the above applications and methods, the regulation can be to increase, enhance, or upregulate.

[0057] In the above applications and methods, the regulation can be suppression, reduction, or silencing.

[0058] In this article, regulating the expression of the gene encoding the protein can be achieved by inhibiting, reducing, or downregulating the expression of the gene. Inhibition, reduction, or downregulation of the gene expression can be achieved through gene knockout or gene silencing.

[0059] Gene knockout refers to the phenomenon of inactivating a specific target gene through gene editing technology. Gene knockout inactivates a specific target gene by altering its DNA sequence.

[0060] Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing presupposes no change in the DNA sequence, resulting in the absence or reduction of gene expression. Gene silencing can occur at two levels: transcriptional silencing due to DNA methylation, heterochromatinization, and position effects; and post-transcriptional gene silencing, which inactivates the gene at the post-transcriptional level through specific inhibition of target RNA. This includes antisense RNA, co-suppression, gene quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.

[0061] To facilitate the identification and screening of transgenic cells or plants, the recombinant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color reactions, antibiotic resistance markers, or chemical reagent resistance marker genes. Alternatively, without adding any selective marker genes, transformed plants can be directly screened for resistance under stress.

[0062] The plants obtained by the above methods can be transgenic plants or plants obtained through conventional breeding techniques such as hybridization. In the above methods, the transgenic plants are understood to include not only first- and second-generation transgenic plants, but also their progeny. For transgenic plants, the gene can be propagated within the species, or it can be transferred into other varieties of the same species using conventional breeding techniques, particularly commercial varieties. The transgenic plants include seeds, callus tissue, complete plants, and cells.

[0063] The present invention also provides a method for cultivating plants with altered plant structure and increased yield, comprising: 1) inhibiting, reducing or silencing the expression level of the coding gene of the protein described above in the target plant, and / or inhibiting, reducing or silencing the activity and / or content of the coding gene of the protein described above, to obtain plants with altered plant structure and increased yield.

[0064] 2) Increase, enhance, or upregulate the expression level of the coding genes of the proteins mentioned above in the target plant, or / and increase, enhance, or upregulate the activity and / or content of the coding genes of the proteins mentioned above, to obtain plants with altered plant type and reduced yield.

[0065] In one specific embodiment, a method for cultivating plants with altered plant type and increased yield includes the following steps: inhibiting the expression of nucleic acid molecules encoding GmMBR2 protein in the target plant to obtain transgenic plants with altered plant type and increased yield. Specifically, the inhibition of nucleic acid molecule expression encoding GmMBR2 protein in the target plant can be achieved by introducing a knockout vector targeting the nucleic acid molecule encoding GmMBR2 protein into the target plant.

[0066] The knockout vector may be a gene editing vector.

[0067] As one embodiment of the present invention, the method for cultivating plants with altered plant type and increased yield includes the following steps:

[0068] (1) Construct a gene editing vector containing the gene that inhibits the expression of GmMBR2 as shown in SEQ ID No. 4;

[0069] (2) Introduce the gene editing vector constructed in step (1) into plants;

[0070] (3) Plants with altered plant type and increased yield obtained through screening and identification.

[0071] Specifically, the gene editing vector is a vector based on Cas9 gene editing technology. Specifically, the gene editing vector expresses sgRNA and Cas9 protein. The sgRNA targets a nucleic acid molecule encoding the GmMBR2 protein. Specifically, the target of the sgRNA is 5'-AGATTATTGTGTTTGGAGAG-3'.

[0072] In the above method, the target site for gene editing by the CRISPR / Cas9 system is positions 810-829 of SEQ ID No. 3, which corresponds to positions 159-178 of SEQ ID No. 2 (coding sequence).

[0073] In the above method, the CRISPR / Cas9 system gene editing can be performed by making the following mutation in the gene encoding the protein GmMBR2 in the soybean genome: replacing “5'-AGATTATTGTGTTTGGAGAG-3' (SEQ ID No. 3, positions 810-829, corresponding to positions 159-178 of SEQ ID No. 2 (coding sequence CDS))” with 5'-AGATTATTGTGTTTGGAG-3', that is, deleting two bases at positions 174-175 of sequence 2, thereby knocking out the gene encoding the GmMBR2 protein.

[0074] In this article, the substance that regulates gene expression can be a substance that performs at least one of the following six types of regulation:

[0075] 1) Regulation occurring at the transcriptional level of the aforementioned gene;

[0076] 2) Regulation that occurs after the gene is transcribed (i.e., regulation of the splicing or processing of the primary transcript of the gene);

[0077] 3) Regulation of RNA transport of the gene (that is, regulation of the transport of mRNA of the gene from the nucleus to the cytoplasm);

[0078] 4) Regulation of the translation of the aforementioned genes;

[0079] 5) Regulation of mRNA degradation of the aforementioned gene;

[0080] 6) Post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0081] This invention also provides the use of the protein GmMBR2 described above, or an expression substance regulating the gene, or a substance regulating the activity or content of said protein, in any of the following:

[0082] The application of the protein or gene expression substance or substance that regulates the activity or content of the protein described in U1) in regulating plant architecture and yield.

[0083] The application of the protein or gene-regulating substance or substance regulating the activity or content of the protein described in U2) in the preparation of products that regulate plant architecture and yield.

[0084] The application of the protein or gene-regulating substance described in U3) or the substance regulating the activity or content of the protein in cultivating plants with altered plant structure and increased yield.

[0085] The application of the protein or gene-regulating substance or substance regulating the activity or content of the protein described in U4) in the preparation of products that cultivate plants with altered plant type and increased yield.

[0086] The application of the protein or gene expression substance or substance that regulates the activity or content of the protein described in U5) in plant breeding.

[0087] In this article, the substance that regulates the activity and / or content of the protein may be a substance that regulates gene expression, wherein the gene encodes the protein GmMBR2.

[0088] In the above applications, the substance that regulates gene expression or the substance that regulates the activity or content of the protein can be a biological material related to the protein, and the biological material can be the biological material described above.

[0089] In this invention, the purpose of plant breeding includes cultivating plants with altered plant type and increased / decreased yield.

[0090] In this article, plant type traits may include plant height, number of pods per plant, number of grains per plant, number of nodes, and number of branches.

[0091] In the above applications or methods, the plant is any one of the following:

[0092] N1) Dicotyledons:

[0093] N2) Leguminosae;

[0094] N3) Leguminosae (family legumes);

[0095] N4) Soybean genus plants;

[0096] N5) soybeans.

[0097] This invention cloned the plant architecture and yield-related protein GmMBR2 from the soybean variety Jack. Through sequence analysis, primer sequences targeting the GmMBR2 target site were designed. The GmMBR2 gene was knocked out using a CRISPR-Cas9 vector. The resulting homozygous mutants of gmmbr2 showed a significant increase in the number of pods and seeds per plant compared to the wild type. Regarding plant architecture, compared to the control plant height of 148.3 cm, the average plant height of the homozygous mutants of gmmbr2 was 118.5 cm, a significant decrease. This invention is of great significance for the breeding of superior soybean varieties and the development of germplasm resources. Attached Figure Description

[0098] Figure 1 The mutation type and sequencing results of the GmMBR2 mutant gmmbr2.

[0099] Figure 2 The phenotypes of the GmMBR2 mutant gmmbr2 and wild-type soybean are compared. Detailed Implementation

[0100] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0101] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0102] Unless otherwise specified, all quantitative experiments in the following examples are performed in triplicate.

[0103] The cultivated soybean Jack in the following examples has been described in: Chen L, Cai Y, Liu X, Yao W, Guo C, Sun S, Wu C, Jiang B, Han T, Hou W (2018), Improvement of soybean Agrobacterium-mediated transformation efficiency by adding glutamine and asparagine into the culture media. International Journal of Molecular Sciences 19, 3039. This biological material is available to the public from the applicant and is intended solely for the purpose of replicating the experiments of this invention and shall not be used for any other purpose.

[0104] The Agrobacterium tumefaciens EHA105 in the following examples has been described in: Cai Y, Chen L, Liu X, Guo C, Sun S, Wu C, Jiang B, Han T and Hou W (2018a), CRISPR / Cas9-mediated targeted mutationnesis of GmFT2a delays flowering time in soya bean. Plant Biotechnol J16, 176-185. This biological material is available to the public from the applicant and is intended solely for the purpose of repeating experiments of this invention and shall not be used for any other purpose.

[0105] MS Salt: PhytoTech, Catalog No.: M524.

[0106] MS Organic: PhytoTech, Catalog No.: M533.

[0107] B5 Organic: Phytotech, catalog number: G219.

[0108] B5 Salt: Phytotech, Catalog No.: G768.

[0109] The linear cas9 / gRNA vectors used in the following examples were purchased from Beijing Weishang Lide Biotechnology Co., Ltd., catalog number: VK005-15.

[0110] The data in the following examples were processed using SPSS 11.5 statistical software. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used, and P < 0.05 (*) indicates a significant difference, and P < 0.01 (**) indicates a highly significant difference.

[0111] Example 1: Obtaining the GmMBR2 protein and its encoding gene

[0112] The genome sequence of soybean GmMBR2 was obtained from the Phytozome database. GmMBR2 is located on chromosome 4, and the protein it encodes is named GmMBR2. The GmMBR2 gene in the genomic DNA of soybean variety Jack is shown in SEQ ID No. 3 of the sequence listing, the coding sequence of the GmMBR2 gene is shown in SEQ ID No. 2 of the sequence listing, and the protein encoding GmMBR2 has the amino acid sequence shown in SEQ ID No. 1 of the sequence listing.

[0113] Example 2: Obtaining GmMBR2 gene-edited plants

[0114] 1. Obtaining sgRNA

[0115] The target sequence for GmMBR2 sgRNA was selected using the online CRISPR-P tool (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR). The target site is located in the second exon region of GmMBR2, and the target sequence is 5'-AGATTATTGTGTTTGGAGAG-3' (ses 810-829 of SEQ ID No. 3, corresponding to ses 159-178 of SEQ ID No. 2 (coding sequence)).

[0116] After the target site is designed, it needs to be integrated into the vector. First, synthesize the target primers for the sgRNA (the underlined sequence is a 20bp sgRNA). The primer sequence information is as follows:

[0117] GmMBR2-F:5'-TTG AGATTATTGTGTTTGGAGAG -3';

[0118] GmMBR2-R: 5'-AAC CTCTCCAAACACAATAATCT -3';

[0119] Add 5 μL of GmMBR2-F and GmMBR2-R primers and 15 μL of water to a 25 μL system. Anneal at 95 °C for 3 min, then anneal at 0.1 °C / s to 16 °C and hold at 16 °C for 10 min to complete the annealing process, and obtain gRNA annealed products with sticky ends.

[0120] 2. Preparation of GmMBR2 gene editing expression vector GmMBR2-sgRNA

[0121] Take 1 μL of the gRNA annealing product with sticky ends obtained in step 1 above and perform T4 ligation with the Cas9 / gRNA vector (Beijing Weishang Lide Biotechnology Co., Ltd., catalog number: VK005-15, which contains Cas9 protein expression units) to obtain the recombinant vector Cas9-sgRNA. This vector expresses sgRNA. The coding sequence of the target sequence binding region in the sgRNA is positions 810-829 of SEQ ID No. 3, which corresponds to positions 159-178 of SEQ ID No. 2 (coding sequence).

[0122] 3. Preparation of recombinant bacteria

[0123] The recombinant vector Cas9-sgRNA prepared in step 2 was transformed into E. coli DH5α and plated on LB+Kan solid medium. Single clones were picked, plasmids were extracted, and sent for sequencing.

[0124] Sequencing primer SQ: 5'-GATGAAGTGGACGGAAGGAAGGAG-3', the plasmid with the correct inserted fragment was named the recombinant vector GmMBR2-sgRNA.

[0125] The structure of the recombinant vector GmMBR2-sgRNA is described as follows: A DNA molecule with the target sequence 5'-AGATTATTGTGTTTGGAGAG-3' is inserted into a linear cas9 / gRNA vector through homologous recombination, while keeping other sequences of the cas9 / gRNA vector unchanged, to obtain the recombinant expression vector.

[0126] The recombinant vector GmMBR2-sgRNA has the nucleotide sequence of SEQ ID No. 4, containing an sgRNA gene expression cassette with nucleotide sequences from positions 35 to 582 of SEQ ID No. 4. The sgRNA gene is shown as nucleotides from positions 480 to 499 of SEQ ID No. 4 in the sequence listing. Nucleotides 35-479 constitute the promoter for initiating sgRNA gene transcription, and nucleotides 576-582 constitute the terminator for terminating sgRNA gene transcription. Cas9-sgRNA also contains a Cas9 protein gene expression cassette with nucleotide sequences from positions 584 to 5568 of SEQ ID No. 4, enabling the expression of the Cas9 protein.

[0127] 4. Obtaining and phenotypic identifying GmMBR2 mutants

[0128] The recombinant vector GmMBR2-sgRNA was transformed into Agrobacterium tumefaciens EHA105 by electroporation. The plasmid was extracted and sequenced for verification. The recombinant strain that was correctly sequenced was named EHA / GmMBR2-sgRNA.

[0129] 5. Agrobacterium-mediated transformation

[0130] The culture medium preparation method used in this step is as follows:

[0131] YEP solid medium consists of a solvent and a solute; the solutes and their concentrations in YEP solid medium are as follows: NaCl 5 g / L, yeast extract 5 g / L, tryptone 10 g / L, and agar 15 g / L; the solvent is water. The pH of YEP solid medium is 7.0.

[0132] Germination medium (pH 5.8): 3.12 g / L B5 salt, 1 ml / L B5 organic, 20 g / L sucrose, 7.5 g / L agar, with the remainder being water.

[0133] Liquid culture medium (pH 5.4): 0.43 g / L MS salt, 1 ml / L B5 organic, 40 mg / L acetylsuccinone, 150 mg / L dithiothreitol, 100 mg / L L-cysteine, 30 g / L sucrose, 3.9 mg / L 2-morpholinoethanesulfonic acid, balance water.

[0134] Co-culture medium (pH 5.4): 0.43 g / L MS salt, 1 ml / L B5 organic, 40 mg / L acetylsuccinone, 150 mg / L dithiothreitol, 100 mg / L L-cysteine, 30 g / L sucrose, 7.5 g / L agar, 3.9 mg / L 2-morpholinoethanesulfonic acid, balance water.

[0135] Recovery medium (pH 5.4): 3.1 g / L B5 salt, 1 ml / L B5 organic, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 1 mg / L 6-BA, 0.98 g / L 2-morpholinoethanesulfonic acid, 7.5 g / L agar, 4 ml / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, balance water.

[0136] Screening medium (pH 5.4): 3.1 g / L B5 salt, 1 ml / L B5 organic, 0.98 g / L 2-morpholinoethanesulfonic acid, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 1 mg / L 6-BA, 6 mg / L glufosinate, 7.5 g / L agar, 4 ml / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, balance water.

[0137] Elongation medium (pH 5.6): 4.0 g / L MS salt, 1 ml / L B5 organic, 0.6 g / L 2-morpholinoethanesulfonic acid, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 0.1 mg / L IAA, 0.5 mg / L GA, 1 mg / L 6-BA, 6 mg / L glufosinate, 7.5 g / L agar, 4 ml / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, balance water.

[0138] Rooting medium (pH 5.7): 2.165 g / L MS salt, 1 ml / L B5 organic, 0.6 g / L 2-morpholinoethanesulfonic acid, 20 g / L sucrose, 7.5 g / L agar, 50 mg / L L-asparagine, 50 mg / L L-glutamine, with the remainder being water.

[0139] The EHA-GmMBR2-sgRNA constructed in step 4 was transformed into the soybean variety Jack (hereinafter referred to as wild-type soybean) using Agrobacterium-mediated transformation. The specific method is as follows:

[0140] A. Seed sterilization

[0141] 1) Take healthy, plump, uniform, and dry Jack soybean seeds that are free from pests, diseases, and spots, spread them evenly in a petri dish, and then place the petri dish in a desiccator.

[0142] 2) After completing step 1), place a 100ml beaker in the desiccator, pour 80ml of 12M sodium hypochlorite aqueous solution into the beaker, then slowly add 4ml of concentrated hydrochloric acid, and then quickly cover the desiccator, seal it with petroleum jelly, and place it for 16 hours for chlorine sterilization.

[0143] B. Preparation of infecting bacterial solution

[0144] 1) Incubate the EHA-GmMBR2-sgRNA bacterial culture obtained in step 4 above at 28℃, resuspend it in liquid culture medium, and obtain OD. 600nm =0.6% of the infecting bacterial solution.

[0145] 2) Place the seeds treated in step A into a clean bench. Under a microscope, peel off the seed coat, separate the two cotyledons along the long axis, and keep the cotyledon with the complete hypocotyl. Make scratches at the junction of the hypocotyl and cotyledon, usually 3-5 scratches per cotyledon. Then, immerse the seeds in a 28℃ incubator for 2 hours.

[0146] 3) Place the cotyledons with the inner (smooth) side up on a co-culture medium lined with sterile filter paper, and incubate in the dark at 22°C for 5 days.

[0147] 4) After 5 days of co-culture, the hypocotyl of the explants elongated to 2 cm. Part of the hypocotyl was cut off, leaving 0.5 cm. The treated explants were then placed in recovery medium and cultured at 28°C under 16 h light / 8 h dark conditions for 7 days.

[0148] 5) Remove the explants from the recovery medium, remove the new shoots, cut off part of the hypocotyl, leaving 0.5 cm of the hypocotyl, and then transfer the trimmed explants into the selection medium and culture them at 28℃ for 21 days under 16h light / 8h dark conditions.

[0149] 6) After 21 days of selection and induction, the explants produced a large number of adventitious buds. The cotyledons and brown leaves were removed, and the remaining parts were transferred to elongation medium for culture at 28°C under 16h light / 8h dark conditions.

[0150] 7) In the elongation medium, when the clustered buds produce 5-8cm young stems, cut them off from the base of the adventitious buds; dip the stem base in 1mg / LIBA solution for 1min, and then transfer it to the rooting medium for culture. Culture at 28℃ under 16h light / 8h dark conditions for one week. After a large number of roots are produced at the base of the stem, transplant them into pots. The resulting plants are T0 generation transformed soybeans.

[0151] 6. Molecular detection of edited plants

[0152] DNA was extracted from the leaves of T0 generation transformed soybean obtained in step 5 and used as a template for PCR molecular detection, with wild-type soybean as a control.

[0153] PCR primers were designed near the target site of the GmMBR2 gene for PCR amplification and sequencing. Specifically, primers GmMBR2-F (5'-CTATGCCATCACTCCATTATCA-3') and GmMBR2-R (5'-ATATGAATGAAATAGTTAAGT-3') amplified the GmMBR2 gene.

[0154] PCR reaction system: 12.5 μL 2×PhantaMax Buffer, 0.5 μL dNTP Mix (10 mM), 1 μL DNA (200 ng / μL), 1 μL F (10 pmol / μL), 1 μL R (10 pmol / μL), 0.5 μL Super-Fidelity DNA Polymerase, 8.5 μL ddH2O, total volume 25 μL. Amplification reaction system: 95℃ for 3 min; 95℃ for 30 sec, 58℃ for 30 sec, 72℃ for 1 min, 35 cycles; 72℃ for 5 min. PCR products were sent to the company for sequencing verification.

[0155] The plants exhibiting overlapping peaks near the target site were heterozygous edited plants, named T0 generation GmMBR2 gene-edited soybeans.

[0156] After sowing T0 generation GmMBR2 gene-edited soybeans, seeds of T1 generation GmMBR2 gene-edited soybeans were harvested and cultured to obtain T1 generation GmMBR2 gene-edited soybeans.

[0157] PCR was used to detect the GmMBR2 gene-edited soybeans of generation T1. Sequencing results of the amplified products showed that, compared with the genomic DNA of the soybean variety Jack (wild type), the gene encoding the GmMBR2 protein in the two homologous chromosomes of the GmMBR2 homozygous mutant had the following mutation: the nucleotide "5'-GA-3'" was deleted at positions 825-826 of SEQ ID No. 3 (corresponding to positions 174-175 of SEQ ID No. 2 (coding sequence CDS)), thereby knocking out the gene encoding the GmMBR2 protein. The sequencing results of this mutation site and its surrounding nucleotides are shown in [Figure 1]. Figure 1 .

[0158] The T1 generation GmMBR2 gene-edited soybean mutant plants gmmbr2 with the above-mentioned GmMBR2 gene mutation type were further cultured and screened to obtain T2 generation gene-edited soybean homozygous mutants without transgenic elements, and phenotypic identification was performed.

[0159] Example 2: Phenotypic Identification of GmMBR2 Gene-Edited Soybean Mutants

[0160] Planted under natural light conditions in a greenhouse during the summer in Beijing, with the following planting conditions: plant spacing 10cm and row spacing 50cm.

[0161] Plant morphological traits (plant height, number of nodes, number of branches, number of pods per plant, and number of grains per plant) of the wild-type soybean variety Jack (referred to as the control plant) and the gmmbr2 homozygous mutant were statistically analyzed separately. At least 6 individual plant data were collected for each material.

[0162] The results showed (Table 1) that, in terms of yield per plant, the control plants had an average of 106.5 pods and 257.8 seeds per plant, while the gmmbr2 homozygous mutant plants had an average of 126.8 pods and 306.5 seeds per plant. The number of pods and seeds per plant in the gmmbr2 homozygous mutant was significantly increased compared to the wild type.

[0163] Regarding plant type, compared with the control plant height of 148.3 cm, the average height of the gmmbr2 homozygous mutant was 118.5 cm, which was significantly lower than that of the control. Regarding branching phenotype, the control plant had 1.5 branches, while the gmmbr2 homozygous mutant plant had 1.7 branches, with no significant difference between the mutant and control plants. Regarding the number of nodes, the control plant had 25.0 nodes, while the gmmbr2 homozygous mutant plant had an average of 26.5 nodes, with no significant change between the gmmbr2 homozygous mutant and control plants.

[0164] Table 1. Statistics on soybean plant type data

[0165]

[0166] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method for reducing plant height and increasing the number of pods and seeds per plant, characterized in that, This includes knocking out protein-coding genes to reduce plant height and increase the number of pods and seeds per plant; The amino acid sequence of the protein is shown in SEQ ID No. 1; the plant is soybean.

2. The method according to claim 1, characterized in that, The knockout of the protein-coding gene includes introducing a substance into the target plant that knocks out the gene encoding the protein, thereby reducing plant height and increasing the number of pods and seeds per plant; the gene encoding the protein of claim 1; the substance being any one of the following: C1) Knock out the nucleic acid molecule encoding the protein described in claim 1; C2) expresses the gene encoding the nucleic acid molecule described in C1); C3) contains an expression cassette containing the gene encoding described in C2); C4) A recombinant vector containing the encoding gene described in C2); C5) Recombinant microorganisms containing the encoding gene described in C2).

3. A method for cultivating plants with reduced plant height and increased number of pods and grains per plant, comprising knocking out the protein-coding gene described in claim 1 to obtain plants with reduced plant height and increased number of pods and grains per plant; wherein the plant is soybean.

4. The application of substances that knock out protein-coding genes in any of the following: U1) Application in reducing plant height and increasing the number of pods and seeds per plant; U2) Application in the preparation of products that reduce plant height and increase the number of pods and seeds per plant; U3) Application in cultivating plants with reduced plant height and increased number of pods and seeds per plant; U4) Application in the preparation of products from plants with reduced plant height and increased number of pods and seeds per plant; Application of U5 in plant breeding; The purpose of the breeding is to select plant varieties with reduced plant height and increased number of pods and seeds per plant. The amino acid sequence of the protein is shown in SEQ ID No. 1; The plant in question is soybean.

5. The application according to claim 4, characterized in that, The substance is any one of the following: C1) Knock out the nucleic acid molecule encoding the protein described in claim 1; C2) expresses the gene encoding the nucleic acid molecule described in C1); C3) contains an expression cassette containing the gene encoding described in C2); C4) A recombinant vector containing the encoding gene described in C2); C5) Recombinant microorganisms containing the encoding gene described in C2).

Images