Buster transposon system and applications thereof
By optimizing the transposons and transposases of the Buster transposon system, the problem of low DNA transposon transfer efficiency has been solved, achieving efficient gene transfer that can be applied to gene therapy and transgenic animal production.
Patent Information
- Application Number
- CN202410752509.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-12
- Publication Date
- 2026-05-15
- Estimated Expiration
- 2044-06-12
AI Technical Summary
Current DNA transposon transfer efficiency is low and cannot meet the needs of gene transfer.
A Buster transposon system is provided, including AnBT, CrBT, HvBT, LcBT and LlBT transposons and their corresponding transposases. The transposon terminal inverted repeat sequences and target site repeat sequences are optimized, and the corresponding gene transfer vector system is constructed.
It improves gene transfer efficiency, enabling efficient gene transfer and its application in gene therapy and transgenic animal production.
Smart Images

Figure CN118879694B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a Buster transposon system and its applications. Background Technology
[0002] Transposons are freely moving and jumping DNA sequences that play a crucial role in genome evolution, speciation, and the formation of strains. Transposons can be divided into two main categories based on their transposition mechanism: Class I transposons, also known as retrotransposons, transpose via a "copy and paste" mechanism, where the RNA intermediate is reverse transcribed into cDNA and integrated into the genome as a single copy. Class II transposons, also known as DNA transposons, do not produce RNA intermediates and are typically transposed DNA-to-DNA, i.e., via a "cut and paste" mechanism, or in a helical state, via a "peel and paste" replication mechanism using DNA intermediates.
[0003] Buster, a recently defined member of the hAT family of transposons, is widely distributed in both vertebrates and invertebrates, and its horizontal transmission across phyla and classes in animals has been confirmed. Two naturally occurring active buster transposons, AeBuster and TcBuster, have been identified in Aedes aegypti and Tribolium castaneum, respectively. Furthermore, the Buster transposon SPINon (Space Invaders, SPIN), first identified and reconstructed by Pace et al., can transpose in yeast and human cells, demonstrating the high activity of both TcBuster and SPINon in mammalian cells. In recent years, TcBuster transposons have also shown potential as a non-viral gene transfer system in chimeric antigen receptor (CAR)-T cell therapy.
[0004] The use of transposons in human gene therapy mainly involves stages such as target gene cloning, gene transfer, target cell selection, and clinical trial observation. Among these, gene transfer is a key step in gene therapy, and the advantages of DNA transposon-mediated gene transfer in gene therapy are its high efficiency and safety. To date, transposons have become the most commonly used non-viral vectors in gene therapy. In addition, transposons can also be used to prepare mutants, conduct gene capture, and be applied to functional genomics research.
[0005] Although DNA transposons have been used as tools for gene transfer, they have drawbacks such as low transfer efficiency and cannot meet the needs of gene transfer. Therefore, based on the optimization of existing transposons, we should continue to explore efficient DNA transposons with autonomous activity. Summary of the Invention
[0006] Technical problem solved: In view of the above-mentioned technical problems, the present invention provides a Buster transposon system and its application, which can effectively solve the shortcomings of the existing DNA transposon transfer efficiency.
[0007] Technical Solution: In a first aspect, the present invention provides a Buster transposon system, comprising AnBT transposon, CrBT transposon, HvBT transposon, LcBT transposon, and LlBT transposon, and corresponding transposases. The nucleotide sequences of the AnBT transposon, CrBT transposon, HvBT transposon, LcBT transposon, and LlBT transposon are shown in SEQ ID No. 1 to 5, respectively. The transposase is wild-type or enhanced-type. The inverted terminal repeats (TIR) of the AnBT transposon are 16 bp / 16 bp in length, the target site repeat (TSD) is 8 bp / 8 bp in length, and the untranslated region (UTC) is... The CrBT transposon has terminal inverted repeats (TIR) of 476 bp and 375 bp, respectively; the CrBT transposon has terminal inverted repeats (TIR) of 15 bp and 15 bp, target site repeats (TSD) of 8 bp and 8 bp, and uncoding regions (UTR) of 1071 bp and 147 bp, respectively; the HvBT transposon has terminal inverted repeats (TIR) of 14 bp and 14 bp, target site repeats (TSD) of 8 bp and 8 bp, and uncoding regions (UTR) of 476 bp and 375 bp, respectively. The lengths of the terminal inverted repeats (TIR) of the LcBT transposon are 960bp and 188bp, respectively; the lengths of the terminal inverted repeats (TIR) of the LcBT transposon are 14bp and 14bp, the lengths of the target site repeats (TSD) are 8bp and 8bp, respectively, and the lengths of the uncoding region (UTR) are 109bp and 352bp, respectively; the lengths of the terminal inverted repeats (TIR) of the LlBT transposon are 16bp and 16bp, the lengths of the target site repeats (TSD) are 8bp and 8bp, respectively, and the lengths of the uncoding region (UTR) are 216bp and 740bp, respectively.
[0008] SEQ ID No. 1 (named pUC19-AnBT):
[0009]
[0010]
[0011] Among them, AnBT 5'TSD is displayed in uppercase italics, AnBT 5'TIR is displayed with an underline, AnBT 5'UTR is displayed in bold italics, AnBT 3'UTR is displayed with an underline italics, AnBT 3'TIR is displayed with a bold underline, and AnBT 3'TSD is displayed in lowercase italics.
[0012] SEQ ID No. 2 (named pUC19-CrBT):
[0013] Among them, CrBT 5'TSD is displayed in uppercase italics, CrBT 5'TIR is displayed underlined, CrBT 5'UTR is displayed in bold italics, CrBT 3'UTR is displayed underlined italics, CrBT 3'TIR is displayed in bold underlined, and CrBT 3'TSD is displayed in lowercase italics.
[0014] SEQ ID No. 3 (named pUC19-HvBT):
[0015]
[0016] Among them, HvBT 5'TSD is displayed in uppercase italics, HvBT 5'TIR is displayed with an underline, HvBT 5'UTR is displayed in bold italics, HvBT 3'UTR is displayed with an underline italics, HvBT 3'TIR is displayed with a bold underline, and CrBT 3'TSD is displayed in lowercase italics.
[0017] SEQ ID No. 4 (named pUC19-LcBT):
[0018] Among them, LcBT 5'TSD is displayed in uppercase italics, LcBT 5'TIR is displayed with an underline, LcBT 5'UTR is displayed in bold italics, LcBT 3'UTR is displayed with an underline italics, LcBT 3'TIR is displayed with a bold underline, and LcBT3'TSD is displayed in lowercase italics.
[0019] SEQ ID No. 5 (named pUC19-LlBT):
[0020]
[0021] Among them, LlBT 5'TSD is displayed in uppercase italics, LlBT 5'TIR is displayed in underline, LlBT 5'UTR is displayed in bold italics, LlBT 3'UTR is displayed in underline italics, LlBT 3'TIR is displayed in bold underline, and LlBT 3'TSD is displayed in lowercase italics.
[0022] Preferably, the donor plasmids for the AnBT, CrBT, HvBT, LcBT, and LlBT transposons include flanking sequences relative to the AnBT, CrBT, HvBT, LcBT, and LlBT transposons, and multiple cloning insertion sites. These multiple cloning insertion sites (KpnI / SalI restriction sites) can be inserted into the target gene cassette to be transferred. The target gene can be inserted into the donor plasmid through any of the multiple cloning insertion sites. Insertion of the target gene into the donor plasmid means that the target gene is inserted between the Buster 5'TIR and 3'TIR. The target gene cassette can be a reporter gene expression cassette, other exogenous gene expression cassettes, or gene capture elements.
[0023] Preferably, the amino acid sequence of the wild-type transposase is shown in SEQ ID NO.6-10.
[0024] SEQ ID No. 6 (named AnBT protein):
[0025] MDKWVIKIPTNKSATPSQPSCSASNPTSSKTKKRKYDESYLQYGFTCSSHNNEEQPVCLICKEVLAAESMKPSKLQRHLNTKHATLSKKPIEYFERLLQTSNKEKNTLEKYVTLNDKYLLASYEVSYLIAKTKKPFTIGEQLLLPAAIRMSEIVHGKQYAAEISKIPLSNDTVSKRISDISNDQFQQLLMRLKDSSKFAIQLDESTDISKMAQLLLFVRYIYEGSIHEDILFCRPLEGHTRGKDIYKKVNEFFEKEGLNWKNCVGVCTDGAAAMTGQDLGFTAFVKAGNDHITFTHCMIHREALVVKKIAPELNTVFFDAVKIINFIKSRALNSRLFKNLCIDMDSDYTSLLLHAEVRWLSRGRSLKRLLTLKDEVLIFLTEQNSNLADYFHDNLWLLKLCYLADIFDKINDMNLSMQGVCVNMFMLKNKLEAFVKKILIWKNRVESGSLEMFPFTDEYIISNNISKKDTPITKIIVNHLKDMEVYMHRYFPNDIDTQQWICNPFSIEMKEINFLNLKAQEEFAELTSDTTLRLRFSQVPVHEFWIEIKSEYPLLSEMAMNKLLPFCTTYLCESAFSTLTYIKSKYRSTLINVENLLRSALTQIEPRFNYLCKNKQSHPSH。
[0026] SEQ ID No.7 (named CrBT protein):
[0027] 。SEQ ID No.8 (named HvBT protein): MAPKRKYDNNYIKFGFTSIESNGEIKPQCVICATVLANEALKPAKLTRHLETVHPDLSNRPLEFFQGKLEVLKKMKLGPSGSRFATSEKLLVASFEISKLIAQSKKPHTVGETLVKPCLIKAVEEVLGLEAKKKIQDIPLSNNTVKARIELMSSDIEEQLVSRIKKSPFFALQCDESTDISNCCQLLVFVRFLDDDNIIKEELLISRELDTTSKGIDVMNSISEFFEKHNLMWDKLAALCTDGAPAMLGSRSGLATLVKQKNPNVITTHCIIHRQALASKTLPGCLNDTLKMAIKIVNLIKSSALNTRLFKKLCTEMDSDHETLLFHTEVRWLSKGNMLGRLYELRAEVEIFLGDKKNNDLLKQFTNLACQMDLAYLVDIFTHLNKLNIQLQGSGNKNLENVANIFIFEDKLRAFICKLQLWLRKIEENNYSAFATLQSLVEDKKYDAFTANIQENIKTHLHMLIDEFNRYFPEYNEEANLDQKMIRNPFSTDASEVTEEIQEELIELQNDRNCKDAFESNSLESFWCKKALSYTKLREIALRYFIVFSTTYLCEQGFSALLVLKNKARNRLKVSDDLRVALSNNISPRIAELVKKMQAQKSH。
[0028] SEQ ID No.9 (named LcBT protein):
[0029] MDKWLKKINCPSRGTSPASTSQVVRYPHYSSPSTSSTFDRDASGSLASPLGGSLASQVGGQAESIATDSGEESDAPDAGKHAATAGRGTTSSKRRKYDENYIALGFTQINTGGFTRPQCVICAKVLSHNSMKPSLLRRHLETKHAHLRNKPREFFERELRGLSTSKTCIRETDTVNRSGLQASYMVSYRVAKSGKPHTIVEDLIVPAATDMVGTMLGEKAKKTIQTMPSSNNTVSRRIGDMAEDVLKQLLQRVRASEFYSLQLDESTDVAGLAHVLVYVRYIHEGTIKEDMLFCKTLEKGATGEDIFKMLDTFVTSNGLMWTQCVGICTDGARAMTGRHSGVVTRVQAVAPDATWIHCSIHREALAVKGMSASLKKVLDTTVKMVNFVKARPLNSRIFSALCSEMGSDHEALLLHTEVRWLSRGKVLTRFFELKDELKIFFFDHNFDLSEYLHDEEFLTRLSYLSDIFSRLNELNLALQGLSTTIFNVRDKIEAMIKKLNLWLNCMENNNTEVFPTLHDFLCANELRLTDNIKQEITAHLRELAAQLRRYFPESDSSDSWIRHPFTDVPASLSASEQESLIDITTDGSLKREFNQKSLSDFWIGLCTEHPVLAKRAVKTLMPFATTYMCESGFSALTGMKTKYRARLSVENDLRLRLSQIEPDIAGLCASSQAHPSH。
[0030] SEQ ID No.10 (named LlBT protein):
[0031] .
[0032] Preferably, the nucleotide sequences of the wild-type transposases are shown in SEQ ID Nos. 11-15. The Buster transposase eukaryotic expression plasmid (pCAG-Buster) comprises a CMV enhancer, a chicken β-actin promoter, a chimeric intron, a Buster transposase CDS sequence, and a rabbit beta-globin poly(A); the AnBT transposase has a length of 2750 nucleotides, the CrBT transposase has a length of 3021 nucleotides, the HvBT transposase has a length of 2988 nucleotides, the LcBT transposase has a length of 2522 nucleotides, and the LlBT transposase has a length of 2797 nucleotides. This vector can autonomously express transposases.
[0033] SEQ ID No. 11 (named pCAG-Anase):
[0034]
[0035]
[0036] In this sequence, the CMV enhancer sequence is shown in lowercase underline, the chicken β-actin promoter sequence in lowercase bold, the chimeric intron sequence in lowercase italics, the T7 promoter sequence in uppercase underline, the Kozak sequence in lowercase bold italics, the AnBT CDS sequence in uppercase bold, and the rabbit beta-globin polyA sequence in lowercase italics underline. The CMV enhancer, chicken β-actin promoter, chimeric intron, and rabbit beta-globin polyA sequences are not shown in SEQ ID No. 12-15.
[0037] SEQ ID No. 12 (named pCAG-Crase):
[0038] The T7promoter sequence is displayed in uppercase with an underline, the Kozak sequence in lowercase with bold italics, and the CrBT CDS sequence in uppercase with bold.
[0039] SEQ ID No. 13 (named pCAG-Hvase):
[0040] The T7promoter sequence is displayed in uppercase with an underline, the Kozak sequence in lowercase with bold italics, and the HvBT CDS sequence in uppercase with bold.
[0041] SEQ ID No. 14 (named pCAG-Lcase):
[0042]
[0043] The T7promoter sequence is displayed in uppercase with an underline, the Kozak sequence in lowercase with bold italics, and the LcBT CDS sequence in uppercase with bold.
[0044] SEQ ID No. 15 (named pCAG-Llase):
[0045]
[0046] Among them, the T7promoter sequence is displayed in uppercase with an underline, the Kozaksequence is displayed in lowercase with bold italics, and the LlBT CDS sequence is displayed in uppercase with bold.
[0047] In a second aspect, the present invention provides a gene transfer system, including the Buster transposon system described in the first aspect.
[0048] Thirdly, the present invention provides a pharmaceutical composition comprising the Buster transposon system described in the first aspect and a pharmaceutically acceptable carrier, excipient or solvent.
[0049] Fourthly, the present invention provides a reagent kit comprising the Buster transposon subsystem described in the first aspect.
[0050] Fifthly, the present invention provides the use of the Buster transposon system of the first aspect, the gene transfer system of the second aspect, the pharmaceutical composition of the third aspect, or the kit of the fourth aspect in any of the following:
[0051] (1) Application in the preparation of drugs or reagents that integrate the target gene expression cassette into the host cell genome;
[0052] (2) Application in the preparation of tools for integrating target gene expression cassettes into the host cell genome;
[0053] (3) Applications in the preparation of transgenic plants, transgenic animals, and transgenic cells;
[0054] (4) Application in the preparation of drugs or formulations for genome research, gene therapy, cell therapy or stem cell induction and post-induction differentiation;
[0055] (5) Applications in the preparation of tools for genome research, gene therapy, cell therapy or stem cell induction and post-differentiation;
[0056] (6) Applications in the preparation of reagent kits, engineered immune cells or pharmaceutical compositions.
[0057] Beneficial Effects: This invention utilizes bioinformatics to study Buster family transposons in the animal kingdom, discovering that the transposons AnBT, CrBT, HvBT, LcBT, and LlBT may possess high activity in Armadillidium nasatum, Carcinoscorpius rotundicauda, Hyles vespertilio, Larimichthyscrocea, and Lota lota, respectively. Through molecular reconstruction, key elements such as target site repeat sequences (TSDs) and terminal inverted repeat sequences (TIRs) of AnBT, CrBT, HvBT, LcBT, and LlBT transposons, as well as the corresponding transposase sequences, were obtained. A gene transfer vector system was constructed, and cell validation demonstrated that this AnBT, CrBT, HvBT, LcBT, and LlBT vector system can effectively mediate gene transfer, showing great application potential in transgenic animal preparation and gene therapy.
[0058] The gene transfer method based on the Buster transposon system provided by this invention has been verified at the cellular level to efficiently mediate gene transfer and can be applied to multiple biotechnology fields. The method given in this invention can effectively insert the target gene cassette into the host genome, improving gene transfer efficiency. The method of this invention can also be used to mediate human gene therapy, etc. Attached Figure Description
[0059] Figure 1 The pCAG-Anase plasmid map;
[0060] Figure 2 The pUC19-AnBT plasmid map;
[0061] Figure 3 The pUC19-AnBT-PGK-NEO-PolyA plasmid map;
[0062] Figure 4 The image shows the AnBT-PGK-Neo-3.1kb plasmid.
[0063] Figure 5 For Buster screening in HeLa cells for G418 resistance;
[0064] Figure 6 G418 resistance screening for AnBT vector capacity detection in HeLa cells;
[0065] Figure 7 G418 resistance screening for excessive inhibition of AnBT products in HeLa cells;
[0066] Figure 8This study compares the transposon activity of AnBT with that of hyPB and SB100X in HeLa cells. Detailed Implementation
[0067] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments:
[0068] The donor plasmid and the exogenous gene expression cassette PGK-Neo-pA used are both commercially available components.
[0069] I. Construction of Buster transposase expression vector
[0070] 1. AnBT transposase-assisted plasmid vector synthesis
[0071] The consistent CDS sequence of the constructed transposase was codon-optimized using the idtdna website. The CDS sequence was synthesized by Genewiz. A T7 promoter (TAATACGACTCACTATAGGG) and a Kozak box (GCCACC) were added before the expression cassette. The transposase was then ligated into the pCAG vector containing the CAG promoter, named pCAG-Anase. The plasmid map is shown below. Figure 1 As shown in SEQ ID No. 11, the pCAG-Anase transposase vector sequence includes CMV Enhancer 5-384, chicken β-actin promoter 386-662, chimeric intron 663-1679, T7 promoter 1734-1753, Kozak sequence 1760-1765, AnBT CDS 1766-3631, rabbit beta-globin poly(A) 3640-4176, ori 4945-5533, and Ampicillin Resistance gene 5704-6564. pCAG-Anase is shown as a representative vector, displaying all its sequences. The remaining helper plasmids only show the DNA sequences of T7, KOZAK, and the transposase, inserted at the same location as pCAG-Anase.
[0072] 2. CrBT transposase-assisted plasmid vector synthesis
[0073] The codon optimization of the CDS sequence of the constructed transposase was performed using the idtdna website. The CDS sequence was synthesized by Genewiz. The T7 promoter (TAATACGACTCACTATAGGG) and the Kozak box (GCCACC) were added before the expression cassette. Then, it was ligated into the pCAG vector containing the CAG promoter and named pCAG-CrasepCAG-Crase. The CAG-Crase includes CMVenhancer 5-384, chicken β-actin promoter 386-662, chimeric intron 663-1679, T7 promoter 1734-1753, Kozak sequence 1760-1765, CrBT CDS 1766-3559, rabbit beta-globin poly(A) 3568-4104, ori 4873-5461, and Ampicillin Resistance gene 5632-6492.
[0074] 3. HvBT transposase-assisted plasmid vector synthesis
[0075] The codon optimization of the CDS sequence of the constructed transposase was performed using the idtdna website. The CDS sequence was synthesized by Genewiz. The T7 promoter (TAATACGACTCACTATAGGG) and the Kozak box (GCCACC) were added before the expression cassette. Then, it was ligated into the pCAG vector containing the CAG promoter and named pCAG-Hvase. pCAG-Hvase includes CMVenhancer 5-384, chickenβ-actin promoter 386-662, chimeric intron 663-1679, T7 promoter 1734-1753, Kozak sequence 1760-1765, HvBT CDS 1766-3577, rabbitbeta-globin poly(A) 3586-4122, ori 4891-5479, and Ampicillin Resistance gene 5650-6510.
[0076] 4. LcBT transposase-assisted plasmid vector synthesis
[0077] The codon optimization of the CDS sequence of the constructed transposase was performed using the idtdna website. The CDS sequence was synthesized by Genewiz. The T7 promoter (TAATACGACTCACTATAGGG) and the Kozak box (GCCACC) were added before the expression cassette. Then, it was ligated into the pCAG vector containing the CAG promoter and named pCAG-Lcase. pCAG-Lcase includes CMVenhancer 5-384, chickenβ-actin promoter 386-662, chimeric intron 663-1679, T7 promoter 1734-1753, Kozak sequence 1760-1765, LcBT CDS 1766-3799, rabbitbeta-globin poly(A) 3808-4344, ori 5113-5701, and Ampicillin Resistance gene 5872-6732.
[0078] 5. LlBT transposase-assisted plasmid vector synthesis
[0079] The codon optimization of the CDS sequence of the constructed transposase was performed using the idtdna website. The CDS sequence was synthesized by Genewiz. The T7 promoter (TAATACGACTCACTATAGGG) and the Kozak box (GCCACC) were added before the expression cassette. Then, it was ligated into the pCAG vector containing the CAG promoter and named pCAG-Llase. pCAG-Llase includes CMVenhancer 5-384, chickenβ-actin promoter 386-662, chimeric intron 663-1679, T7 promoter 1734-1753, Kozak sequence 1760-1765, LlBT CDS 1766-3574, rabbitbeta-globin poly(A) 3583-4119, ori 4888-5476, and Ampicillin Resistance gene 5647-6507.
[0080] II. Construction of Transposon Expression Vectors
[0081] 1. Construction of AnBT donor plasmid vector
[0082] 1.1 Synthesis of the end regions on both sides of AnBT
[0083] Insertion age and other parameters of the AnBT transposon in the Buster family were analyzed in their respective species, and molecular reconstruction was performed based on phylogenetic comparison studies. The terminal inverted repeat (TIR) lengths of the AnBT transposon were 16 bp / 16 bp, the target site repeat (TSD) lengths were 8 bp / 8 bp, and the untranslated region (UTR) lengths were 476 bp / 375 bp. Restriction endonuclease sites (KpnI / SalI) were added to the middle of this sequence. The TIR sequence was synthesized by Genewiz and cloned into the pUC19 frame. The sequence is shown in SEQ ID No. 1, and the plasmid map is shown below. Figure 2 As shown, pUC19-AnBT includes AnBT 5'TSD 416-423, 5'TIR 424-439, 5'UTR 440-915, 3'UTR 928-1302, 3'TIR 1303-1318, 3'TSD1319-1326, and Ampicillin Resistance gene 2522-3382. Bases 916-927 are KpnI and SalI restriction sites for insertion into the target gene.
[0084] 1.2 Construction of transposon pUC19-AnBT-PGK-NEO-PolyA
[0085] The PGK-NEO-bGHpA-TA cloning vector (used in our laboratory but commercially available vectors can also be digested) was digested with restriction endonucleases KpnI and SalI. The 1659 bp PGK-NEO-bGHpA expression cassette (which serves as the target gene cassette) was recovered via gel digestion. The pUC19-AnBT vector was digested with KpnI and SalI, and the 3582 bp vector frame was recovered. The expression cassette was ligated into the vector, transformed into Top10 competent cells, and single colonies were cultured in LB broth containing Amp. Plasmids were extracted, identified by electrophoresis and restriction enzyme digestion, and those of the correct size were sent for sequencing by Genewiz. The plasmid map is shown below. Figure 3 As shown, this demonstrates the successful construction of the transposon vector pUC19-AnBT-PGK-NEO-PolyA.
[0086] 2. Construction of CrBT donor plasmid vector
[0087] Synthesis of the end regions on both sides of 2.1CrBT
[0088] Insertion age and other parameters of the CrBT transposon in the Buster family were analyzed in their respective species, and molecular reconstruction was performed based on phylogenetic comparison studies. The CrBT transposon terminal inverted repeat (TIR) sequences were 15 bp / 15 bp in length, the target site repeat (TSD) sequences were 8 bp / 8 bp in length, and the untranslated region (UTR) sequences were 1071 bp / 157 bp in length. Restriction endonuclease sites (KpnI / SalI) were added to the middle of this sequence. The TIR sequence was synthesized by Genewiz and cloned into the pUC19 frame. The sequence is shown in SEQ ID No. 2. pUC19-CrBT includes CrBT 5'TSD 416-423, 5'TIR 424-438, 5'UTR 439-1509, 3'UTR 1522-1668, 3'TIR 1669-1683, 3'TSD 1684-1691, and Ampicillin Resistance gene 2887-3734. Bases 1510-1521 are KpnI and SalI restriction sites for insertion into the target gene.
[0089] 2.2 Construction of the transposon vector pUC19-CrBT-PGK-NEO-PolyA
[0090] The PGK-NEO-bGHpA-TA cloning vector was digested with restriction endonucleases KpnI and SalI, and the 1659 bp PGK-NEO-bGHpA expression cassette (which served as the target gene cassette) was recovered by gel digestion. The pUC19-CrBT vector was digested with KpnI and SalI, and the 3974 bp vector frame was recovered. The expression cassette was ligated to the vector, transformed into Top10 competent cells, and single colonies were cultured in LB broth containing Amp. Plasmids were extracted, identified by electrophoresis and restriction enzyme digestion, and those of the correct size were selected and sent to Genewiz for sequencing, indicating the successful construction of the transposon vector pUC19-CrBT-PGK-NEO-PolyA.
[0091] 3. Construction of HvBT donor plasmid vector
[0092] 3.1 Synthesis of the end regions on both sides of HvBT
[0093] Insertion age and other parameters of the HvBT transposon in the Buster family were analyzed in their respective species, and molecular reconstruction was performed based on phylogenetic comparison studies. The terminal inverted repeat (TIR) lengths of the HvBT transposon were 14bp / 14bp, the target site repeat (TSD) lengths were 8bp / 8bp, and the untranslated region (UTR) lengths were 960bp / 258bp. Restriction endonuclease sites (KpnI / SalI) were added to the middle of this sequence. The TIR sequence was synthesized by Genewiz and cloned into the pUC19 frame. The sequence is shown in SEQ ID No. 3. pUC19-HvBT includes HvBT 5'TSD 416-423, 5'TIR 424-437, 5'UTR 439-1397, 3'UTR 1410-1597, 3'TIR 1598-1611, 3'TSD 1612-1619, and Ampicillin Resistance gene 2815-3675. Bases 1398-1409 are KpnI and SalI restriction sites for insertion into the target gene.
[0094] 3.2 Construction of the transposon vector pUC19-HvBT-PGK-NEO-PolyA
[0095] The PGK-NEO-bGHpA-TA cloning vector was digested with restriction endonucleases KpnI and SalI, and the 1659 bp PGK-NEO-bGHpA expression cassette (which served as the target gene cassette) was recovered by gel digestion. The pUC19-HvBT vector was digested with KpnI and SalI, and the 3875 bp vector frame was recovered. The expression cassette was ligated to the vector, transformed into Top10 competent cells, and single colonies were cultured in LB broth containing Amp. Plasmids were extracted, identified by electrophoresis and restriction enzyme digestion, and those of the correct size were selected and sent to Genewiz for sequencing, confirming the successful construction of the transposon vector pUC19-HvBT-PGK-NEO-PolyA.
[0096] 4. Construction of LcBT donor plasmid vector
[0097] 4.1 Synthesis of the end regions on both sides of LcBT
[0098] Insertion age and other parameters of the LcBT transposon in the Buster family were analyzed in their corresponding species, and molecular reconstruction was performed based on phylogenetic comparison studies. The terminal inverted repeat (TIR) lengths of the LcBT transposon were 14 bp / 14 bp, the target site repeat (TSD) lengths were 8 bp / 8 bp, and the untranslated region (UTR) lengths were 119 bp / 352 bp. Restriction endonuclease sites (KpnI / SalI) were added to the middle of this sequence. The TIR sequence was synthesized by Genewiz and cloned into the pUC19 frame. The sequence is shown in SEQ ID No. 4. pUC19-LcBT includes LcBT 5'TSD 416-423, 5'TIR 424-437, 5'UTR 438-546, 3'UTR 559-910, 3'TIR 911-924, 3'TSD 925-932, and Ampicillin Resistancegene 2128-2988. Bases 547-558 are KpnI and SalI restriction sites, used for inserting the target gene.
[0099] 4.2 Construction of the transposon vector pUC19-LcBT-PGK-NEO-PolyA
[0100] The PGK-NEO-bGHpA-TA cloning vector was digested with restriction endonucleases KpnI and SalI, and the 1659 bp PGK-NEO-bGHpA expression cassette (which served as the target gene cassette) was recovered by gel digestion. The pUC19-LcBT vector was digested with KpnI and SalI, and the 3188 bp vector frame was recovered. The expression cassette was ligated to the vector, transformed into Top10 competent cells, and single colonies were cultured in LB broth containing Amp. Plasmids were extracted, identified by electrophoresis and restriction enzyme digestion, and those of the correct size were selected and sent to Genewiz for sequencing, confirming the successful construction of the transposon vector pUC19-LcBT-PGK-NEO-PolyA.
[0101] 5. Construction of LlBT donor plasmid vector
[0102] 5.1 Synthesis of the end regions on both sides of LlBT
[0103] Insertion age and other parameters of the LlBT transposon in the Buster family were analyzed in their corresponding species, and molecular reconstruction was performed based on phylogenetic comparison studies. The LlBT transposon terminal inverted repeat (TIR) sequences were 16 bp / 16 bp in length, the target site repeat (TSD) sequences were 8 bp / 8 bp in length, and the non-coding regions were 216 bp / 740 bp in length. Restriction endonuclease sites (KpnI / SalI) were added to the middle of this sequence. The TIR sequence was synthesized by Genewiz and cloned into the pUC19 frame. The sequence is shown in SEQ ID No. 5. pUC19-LlBT includes LlBT 5'TSD 416-423, 5'TIR 424-439, 5'UTR 440-655, 3'UTR 668-1407, 3'TIR 1408-1423, 3'TSD 1424-1431, and Ampicillin Resistancegene 2627-3487. Bases 656-667 are KpnI and SalI restriction sites, used for inserting the target gene.
[0104] 5.2 Construction of the transposon vector pUC19-LlBT-PGK-NEO-PolyA
[0105] The PGK-NEO-bGHpA-TA cloning vector was digested with restriction endonucleases KpnI and SalI, and the 1659 bp PGK-NEO-bGHpA expression cassette (which served as the target gene cassette) was recovered by gel digestion. The pUC19-LlBT vector was digested with KpnI and SalI, and the 3687 bp vector frame was recovered. The expression cassette was ligated to the vector, transformed into Top10 competent cells, and single colonies were cultured in LB broth containing Amp. Plasmids were extracted, identified by electrophoresis and restriction enzyme digestion, and those of the correct size were selected and sent to Genewiz for sequencing, confirming the successful construction of the transposon vector pUC19-LlBT-PGK-NEO-PolyA.
[0106] 6. Construction of AnBT Capacity Carrier
[0107] To evaluate the vector capacity of AnBT transposons, a series of AnBT donor plasmids containing fragments of different sizes were constructed. To eliminate the influence of transposon length on transposition activity, sequences were inserted both inside and outside the TIR to ensure all transposons had the same vector length. The internal TIR sequences λ1, λ2, and λ3 were inserted using SalI and SacII restriction sites, while the external TIR sequences λS1, λS2, and λS4 were inserted using NdeI and NotI restriction sites. After electrophoresis and sequencing, the correct vectors were named AnBT-PGK-Neo-1.6kb, AnBT-PGK-Neo-3.1kb, AnBT-PGK-Neo-5.1kb, and AnBT-PGK-Neo-8.5kb, respectively. These inserted fragments were all obtained by PCR amplification from λ phage genomic DNA. The sequence of the inserted fragment in the AnBT-PGK-Neo-1.6kb plasmid is shown in SEQ ID No. 16; the sequence of the inserted fragment in the AnBT-PGK-Neo-3.1kb plasmid is shown in SEQ ID No. 17, and the plasmid map is shown in... Figure 4 As shown; the sequences of the inserted fragments in the AnBT-PGK-Neo-5.1kb and AnBT-PGK-Neo-8.5kb plasmids are shown in SEQ ID No. 17-19, respectively.
[0108] AnBT-PGK-Neo-3.1kb serves as a representative vector, containing the λS1 and λ1 sequences. SEQ ID No. 17 shows the complete sequence of this vector. The remaining plasmids only show the λS and λ sequences, with the insertion position being the same as AnBT-PGK-Neo-3.1kb. Specifically, AnBT-PGK-Neo-1.6kb includes the λS4 sequence, AnBT-PGK-Neo-5.1kb includes the λS2 and λ2 sequences, and AnBT-PGK-Neo-8.5kb includes the λ3 sequence. The specific sequences are shown below:
[0109] SEQ ID No. 16 (named AnBT-PGK-Neo-1.6kb):
[0110]
[0111]
[0112]
[0113]
[0114] λS4 is shown in bold. SEQ ID No. 17 (named AnBT-PGK-Neo-3.1kb):
[0115]
[0116]
[0117]
[0118]
[0119] Among them, PGK promoter is shown in lowercase bold, Neo resistance gene is shown in lowercase italics, bGH polyA is shown in lowercase underline, AnBT 5'TSD is shown in uppercase italics, AnBT 5'TIR is shown in uppercase underline, AnBT 5'UTR is shown in uppercase bold italics, AnBT 3'UTR is shown in uppercase underline italics, AnBT 3'TIR is shown in uppercase bold underline, AnBT3'TSD is shown in lowercase italics, λ1 is shown in uppercase bold, and λS1 is shown in uppercase bold underline italics.
[0120] SEQ ID No. 18 (named AnBT-PGK-Neo-5.1kb):
[0121]
[0122]
[0123] λS2 is displayed in uppercase bold, and λ2 is displayed in uppercase bold underline italics.
[0124] SEQ ID No. 19 (named AnBT-PGK-Neo-8.5kb):
[0125]
[0126]
[0127]
[0128] λ3 is shown in uppercase, bold, underlined, and italic.
[0129] Example 1: Efficient gene transfer in human HeLa cells
[0130] 1. Resuscitation and culture of cryopreserved cells
[0131] Transposon vectors and transposase vector plasmids were extracted using the OMEGA endotoxin-free plasmid extraction kit (purchased from OMEGA), and the final product concentration was adjusted to 500 ng / μL for cell transfection.
[0132] Remove the cryovial containing human cervical cancer cells (HeLa) (cells preserved in our laboratory) from liquid nitrogen and immediately place it in a 37°C water bath and shake it. Transfer the cell suspension to a sterile centrifuge tube, add 5 mL of culture medium, and gently mix. Centrifuge the cell suspension at 1000 rpm for 5 min and discard the supernatant. Add 1 mL of complete culture medium to the centrifuge tube containing the cell pellet, gently mix, transfer the cell suspension to a cell culture flask, and add an appropriate amount of complete culture medium for incubation.
[0133] 2. Cell transfection and screening
[0134] 2.1 Buster cell transfection and screening
[0135] Human cervical cancer cells (HeLa) were divided into 12 groups, each group was transfected separately. Group 1: pUC19-AnBT-PGK-NEO-PolyA and pCAG-Anase; Group 2: pUC19-AnBT-PGK-NEO-PolyA and pCAG; Group 3: pUC19-CrBT-PGK-NEO-PolyA and pCAG-Crase; Group 4: pUC19-CrBT-PGK-NEO-PolyA and pCAG; Group 5: pUC19-HvBT-PGK-NEO-PolyA and pCAG-Hvase; Group 6: pUC19-HvBT-PGK-NEO-P Group 7: pUC19-LcBT-PGK-NEO-PolyA and pCAG-Lcase; Group 8: pUC19-LcBT-PGK-NEO-PolyA and pCAG; Group 9: pUC19-LlBT-PGK-NEO-PolyA and pCAG-LlBT; Group 10: pUC19-Llase-PGK-NEO-PolyA and pCAG; Group 11: pUC19-PB-PGK-NEO-PolyA and pCAG-PBase; Group 12: pUC19-PB-PGK-NEO-PolyA and pCAG, with three repetitions in each group.
[0136] 12-16 hours before transfection, plate the specimens at a ratio of 3×10 5HeLa cells were seeded per well in 6-well plates and cultured in complete medium (10% fetal bovine serum + 1% penicillin-streptomycin solution) to achieve approximately 80% confluence before transfection. Donor and helper plasmids were diluted 500 ng: 500 ng in 100 μL of Opti-MEM (GIBCO) medium and gently mixed. 3 μL of FUGENE transfection reagent (Promega) was added to 100 μL of serum-free, antibiotic-free Opti-MEM medium and gently mixed, then incubated at room temperature for 10 min. After 10 min, 100 μL of the mixture was added to the prepared wells, the 6-well plate was gently shaken, and the plate was incubated at 37°C with 5% CO2. After 48 h of complete culture, 0.5% of the cells were seeded into 6 cm culture dishes and cultured with 600 μg / mL G418 selection medium for 14 days. The clones were stained with Giemsa stain (purchased from GIBCO) and the number of positive clones was counted.
[0137] 3. Identification of positive clones of transfected cells
[0138] 3.1 Identification of positive clones of AnBT transfected cells
[0139] Groups 1 and 11 were the experimental groups, and groups 2 and 12 were the control groups. After screening with G418 resistant culture medium for 14 days, Gimsa staining was performed to count the samples.
[0140] The results showed that the number of positive cell clones in the AnBT transposon experimental group was 315, the number of positive cell clones in the PB transposon experimental group was 664, and the number of positive cell clones in the corresponding control group was 0. The activity of AnBT was approximately 47.5% of that of PB. Figure 5 As shown in the figure. The results indicate that the AnBT transposon system can efficiently mediate the transfection and integration of neomycin resistance genes in HeLa cells, thus confirming that the AnBT transposon system can efficiently mediate the transfer of exogenous genes using resistance genes.
[0141] 3.2 Identification of positive clones of CrBT transfected cells
[0142] Groups 3 and 11 were experimental groups, and groups 4 and 12 were control groups. After screening with G418 resistant culture medium for 14 days, Gimsa staining was used to count the samples.
[0143] The results showed that the number of positive cell clones in the CrBT transposon experimental group was 51, the number of positive cell clones in the PB transposon experimental group was 664, and the number of positive cell clones in the corresponding control group was 0. The activity of AnBT was approximately 7.6% of that of PB. Figure 5As shown in the figure. The results indicate that the CrBT transposon system can inefficiently mediate the transfection and integration of neomycin resistance genes in HeLa cells.
[0144] 3.3 Identification of positive clones of HvBT transfected cells
[0145] Groups 5 and 11 were experimental groups, and groups 6 and 12 were control groups. After screening with G418 resistant culture medium for 14 days, Gimsa staining was performed to count the samples.
[0146] The results showed that the number of positive cell clones in the HvBT transposon experimental group was 292, the number of positive cell clones in the PB transposon experimental group was 664, and the number of positive cell clones in the corresponding control groups was 0. The activity of HvBT was approximately 44.0% of that of PB. Figure 5 As shown in the figure. The results indicate that the HvBT transposon system can efficiently mediate the transfection and integration of neomycin resistance genes in HeLa cells, thus confirming that the HvBT transposon system can efficiently mediate the transfer of exogenous genes using resistance genes.
[0147] 3.4 Identification of positive clones of LcBT transfected cells
[0148] Groups 7 and 11 were experimental groups, and groups 8 and 12 were control groups. After screening with culture medium containing G418 resistance for 14 days, Gimsa staining was used to count the samples.
[0149] The results showed that the number of positive cell clones in the LcBT transposon experimental group was 80, the number of positive cell clones in the PB transposon experimental group was 664, and the number of positive cell clones in the corresponding control groups was 0. The activity of LcBT was approximately 12.0% of that of PB. Figure 5 As shown in the figure. The results indicate that the LcBT transposon system can inefficiently mediate the transfection and integration of neomycin resistance genes in HeLa cells.
[0150] 3.5 Identification of positive clones of L1BT transfected cells
[0151] Groups 9 and 11 were experimental groups, and groups 10 and 12 were control groups. After screening with culture medium containing G418 resistance for 14 days, Gimsa staining was used to count the samples.
[0152] The results showed that the number of positive cell clones in the LIBT transposon experimental group was 262, the number of positive cell clones in the PB transposon experimental group was 664, and the number of positive cell clones in the corresponding control groups was 0. The activity of LIBT was approximately 39.5% of that of PB. Figure 5 As shown in the figure. The results indicate that the LlBT transposon system can efficiently mediate the transfection and integration of neomycin resistance genes in HeLa cells, thus confirming that the LlBT transposon system can efficiently mediate the transfer of exogenous genes using resistance genes.
[0153] Example 2: Vector carrying capacity of AnBT in human HeLa cells
[0154] 1. Cell transfection and screening
[0155] Donor plasmids AnBT-PGK-Neo-1.6kb, AnBT-PGK-Neo-3.1kb, AnBT-PGK-Neo-5.1kb, and AnBT-PGK-Neo-8.5kb were co-transfected into HeLa cells with helper plasmid pCAG-Anase. The transfection and selection methods were the same as in Example 1.
[0156] 2. Identification of positive cell clones
[0157] After screening with G418-resistant culture medium for 14 days, Gimsa staining was used for counting. Results showed that the number of clones decreased by approximately 90% with increasing insert size. On average, in the BT system, for every 1kb increase in insert size, the number of clones decreased by approximately 13%. Figure 6 B). When the insert size of AnBT increased from 1.6 kb to 3.1 kb (a 25% reduction) or 5.1 kb (a 32% reduction), its vector capacity decreased slightly. However, when the insert size increased from 5.1 kb to 8.5 kb, the transposable activity of AnBT decreased significantly (see B). Figure 6 B). Although activity decreased after insertion, the AnBT transposon maintained integration activity in samples carrying exogenous genes ranging from 1.6 kb to 8.5 kb. Figure 6 B).
[0158] Example 3: Product Overproduction Inhibition (OPI) of AnBT Transposons
[0159] 1. Cell transfection and selection
[0160] The AnBT transposon system was divided into high-dose and low-dose groups to detect the presence of over-inhibition (OPI) of AnBT. In the high-dose group, the AnBT transposon vector was administered at a dose of 500 ng, co-transfected with the corresponding transposase into HeLa cells. Five transposase gradients were set: 0 ng, 50 ng, 500 ng, 1000 ng, and 1500 ng. To eliminate the influence of total transfection volume on the experiment, the total transfection dose of DNA in each group was controlled at 2 μg using the empty vector PCAG. The seeding dose for the high-dose group was 0.5% at 24-48 h post-transfection.
[0161] The transposon vector for low-dose transfection was controlled at 10 ng and co-transfected HeLa cells with the corresponding transposase. Six transposase gradients were set: 0 ng, 5 ng, 50 ng, 250 ng, 500 ng, and 1000 ng. To eliminate the influence of total transfection amount on the experiment, the total DNA transfection dose for each group was controlled at 10¹⁰ ng using the empty vector PCAG. The seeding dose for the low-dose group was 5% 24-48 h post-transfection.
[0162] The transfection and screening methods are the same as in Example 1.
[0163] 2. Identification of positive cell clones
[0164] After screening with G418-resistant culture medium for 14 days, Giemsa staining and counting were performed. Results showed that under high transposon dosage (500 ng), AnBT exhibited the highest integration activity at 50 ng of transposase (i.e., transposase:transposon = 1:10), reaching its peak. With gradually increasing AnBT transposase dosage, AnBT integration activity decreased, but at a transposase dosage of 1500 ng, integration activity was still present. Figure 7 A).
[0165] Under low-dose transposon conditions (10 ng), AnBT's integration activity peaked at 50 ng of transposase (i.e., transposase:transposon = 5:1), and then decreased significantly with increasing transposase dosage. Similar to high-dose transposon conditions, AnBT maintained a certain level of integration activity even in the presence of 1000 ng of transposase. Figure 7 B).
[0166] Example 4: Comparison of transposable activity of AnBT with hyPB and SB100X
[0167] 1. Cell transfection and screening
[0168] To evaluate the relative transposition efficiencies of SB100X, hyPB, and AnBT, the transposition activities of AnBT, hyPB, and SB100X at the peak values in the OPI analysis were compared based on the OPI analysis of AnBT and previous OPI analyses of hyPB and SB100X. Transfection was performed using 50 ng of transposase helper plasmid and 500 ng of transposon donor plasmid, following the same transfection and screening methods as in Example 1.
[0169] 2. Identification of positive cell clones
[0170] After screening with G418-resistant culture medium for 14 days, Giemsa staining and counting were performed. After reaching peak activity, the transposition efficiencies of the hyPB, SB100X, and AnBT transposition systems were 100%, 92%, and 63%, respectively (e.g., ...). Figure 8 (As shown). Among the transposons evaluated in HeLa cells, hyPB had the highest efficiency, followed by SB100X, and AnBT had the lowest efficiency. However, compared to the condition of 500 ng transposon / 500 ng transposase, the activity ratio of AnBT to hyPB was improved to some extent.
[0171] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A Buster transposer subsystem, characterized in that: The invention includes AnBT transposon, CrBT transposon, HvBT transposon, LcBT transposon and LlBT transposon and the corresponding transposases. The nucleotide sequences of AnBT transposon, CrBT transposon, HvBT transposon, LcBT transposon and LlBT transposon are shown in SEQ ID No. 1 to 5, respectively. The transposases are wild type or enhanced type.
2. A Buster transposer subsystem according to claim 1, characterized in that: The amino acid sequences of wild-type transposases are shown in SEQ ID NO.6~10.
3. A Buster transposer subsystem according to claim 1, characterized in that: The nucleotide sequences of the wild-type transposases are shown in SEQ ID No. 11-15, respectively.
4. A gene transfer system, characterized in that: Includes the Buster transpose subsystem as described in claim 1.
5. A pharmaceutical composition, characterized in that: Includes the Buster transposon system as described in claim 1 and pharmaceutically acceptable carriers, excipients, or solvents.
6. A reagent kit, characterized in that: Includes the Buster transpose subsystem as described in claim 1.
7. The use of the Buster transposon system according to any one of claims 1-3, the gene transfer system according to claim 4, the pharmaceutical composition according to claim 5, or the kit according to claim 6 in any one of the following: (1) Application in the preparation of tools for integrating target gene expression cassettes into the host cell genome; (2) Applications in the preparation of transgenic plants and transgenic animals; (3) Applications in the preparation of tools for gene therapy, cell therapy, or stem cell induction and post-induction differentiation; (4) Applications in the preparation of reagent kits, engineered immune cells or pharmaceutical compositions.