Water body pollution analysis method and application thereof in water pollution monitoring and evaluation

Abstract

The invention provides a water pollution analysis method and application thereof in water pollution monitoring and evaluation, and belongs to the technical field of microbiological detection. The method provided by the invention mainly relates to exploration of an enrichment method of viruses in the water body, detection of virus occurrence and analysis of correlation between physicochemical index information of the water body and the virus occurrence by taking adenovirus (HAdV), enterovirus (EV), CrasPhage (crAssPhage) and pepper mild mottle virus (PMMoV) as indication viruses. An urban sewage treatment system and a receiving river are used as research objects, a water pollutant evaluation method is constructed, and the correlation between corresponding water physical and chemical indexes and virus occurrence is shown. The invention further provides application of the water pollutant model in water quality monitoring, and an effective monitoring and management means is provided for water environment treatment.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial detection, and in particular relates to a water pollution analysis method and its application in water pollution monitoring and evaluation. Background Art

[0002] There are more than 1,400 known pathogenic microorganisms in the water environment, including bacteria, fungi, viruses, rickettsia, etc., which pose a potential threat to human health. Viruses are an important group of pathogenic microorganisms in the water environment, accounting for 44% of the total number of pathogenic microorganisms. As an important transmission medium, water plays a major role in viral infectious diseases.

[0003] Existing microbial water quality monitoring mainly relies on fecal indicator bacteria such as enterococci and coliforms. These methods are not sufficient to comprehensively assess the health risks of pathogens in water. Studies have found that there is no obvious correlation between the bacteriological level of the water environment and the virus concentration, and viruses can still be detected when the bacteriological hygiene standards of the water body are met. At the same time, viruses are more resistant to environmental changes, such as temperature and pH fluctuations, than bacteria, which makes viruses a reliable indicator of water quality under various environmental conditions. Direct detection of viruses can provide more information on virus contamination in water bodies and further ensure water safety. Compared with fecal indicator bacteria, viruses as water detection indicators have the advantages of high sensitivity, environmental stability and pathogenicity indication, and can effectively track specific pollution sources.

[0004] However, the water quality in natural water bodies is not uniform, the composition of pollutants is extremely complex, and the virus content is low, which brings great obstacles to the detection of viruses. Therefore, it is urgent to provide a detection method for the presence of viruses in water bodies to analyze the changing patterns of viruses in water bodies. Summary of the invention

[0005] In view of this, the present invention provides the following technical solutions:

[0006] A water pollution analysis method, by collecting virus content information in water, water physical and chemical index information, and hydrological information of water sample collection points, a box plot of virus occurrence law is drawn based on the collected information, and correlation analysis is performed;

[0007] Then, based on the correlation between the virus content and the physical and chemical indicators of the water body, the virus content in the water body is judged by the physical and chemical information parameters in the water body; or the physical and chemical information parameters in the water body are judged by the virus content in the water body.

[0008] Preferably, in the above method, the virus comprises one or more of adenovirus, enterovirus, Krass phage and pepper mild mottle virus.

[0009] Preferably, the virus content information in the water body is virus accumulation concentration information, which is obtained by using PCR technology for detection.

[0010] An optional primer and probe sequence for detecting enterovirus is as shown in SEQ ID NOs.1 to 3; a primer for detecting adenovirus is as shown in SEQ ID NOs.4 to 5; a primer for detecting Krass phage is as shown in SEQ ID NOs.6 to 7; a primer and probe for detecting pepper mild mottle virus is as shown in SEQ ID NOs.8 to 10.

[0011] Preferably, the viruses in the water need to be enriched before detection using PCR technology, and the enrichment method includes one or more of polyethylene glycol precipitation method, silica adsorption method, skim milk flocculation method and aluminum salt coagulation precipitation method.

[0012] Preferably, in the above method, the physical and chemical indicators of the water body include one or more of water temperature, pH, dissolved oxygen concentration, ammonia nitrogen concentration, total phosphorus concentration, total nitrogen concentration, nitrite concentration, nitrate concentration and soluble organic carbon concentration.

[0013] Preferably, in the above method, the hydrological information of the water sample collection point includes geographical location information and collection season information of the collection point.

[0014] Preferably, the water sample collection points include sample points of a sewage treatment plant and multiple urban sites; the urban sites include receiving river areas 400 to 600 m upstream and 1 to 5.2 km downstream of a sewage treatment plant discharge outlet.

[0015] Preferably, in the above method, the correlation analysis method is correlation heat map analysis.

[0016] Application of the above methods in water pollution monitoring and assessment.

[0017] Beneficial effects:

[0018] The present invention provides a water pollution analysis method and its application in water pollution monitoring and evaluation. Taking urban sewage treatment systems and receiving rivers as research objects, water and sludge samples are collected, and a virus concentration method is established in combination with chemistry, molecular cell biology and bioinformatics related methods. Adenovirus (HAdV), enterovirus (EV), and crAss phage (crAssPhage) are used as indicator viruses to explore the spatiotemporal distribution characteristics of viruses in sewage treatment processes and the virus removal effect of sewage treatment processes, as well as the spatiotemporal distribution characteristics of viruses after entering receiving water bodies. Establishing a complete virus monitoring and early warning system can timely discover environmental pollution problems caused by viruses, and it is necessary to strengthen water quality management standards. The present invention proposes effective monitoring and management means for the governance of water environment, thereby safely managing the potential ecological risks of urban water and protecting the health of urban residents.

[0019] The present invention more specifically provides a method for effectively enriching viruses in water, and provides technical support for a series of studies on viruses in water, such as studying the distribution of virus populations in water and extracting viral nucleic acids.

[0020] The present invention constructs a heat map of the correlation between the physical and chemical indicators of water bodies and the presence of viruses. The changes in viruses in water bodies can be directly judged by the changes in the physical and chemical indicators of water bodies, or the changes in the physical and chemical indicators of water bodies can be judged by the changes in viruses in water bodies, providing data support for the formulation of a new generation of water quality standards in the future. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 : Comparison of HAdV enrichment methods in four seasons, A for spring, B for summer, C for autumn, and D for winter.

[0022] Figure 2 : Comparison of EV enrichment methods in four seasons, A for spring, B for summer, C for autumn, and D for winter.

[0023] Figure 3 : The concentration of HAdV in the inlet and outlet water of each process section of the sewage treatment plant, A is spring, B is summer, C is autumn, and D is winter.

[0024] Figure 4 : crAssPhage concentration of inlet and outlet water in each process section of the sewage treatment plant, A is spring, B is summer, C is autumn, and D is winter.

[0025] Figure 5 : Virus concentrations in four-season aeration tank sludge and residual sludge, A is HAdV and B is crAssPhage.

[0026] Figure 6 : EV concentration in the inlet and outlet water of each process section of the sewage treatment plant, A is spring, B is summer, C is autumn, and D is winter.

[0027] Figure 7 : PMMoV concentration in the inlet and outlet water of each process section of the sewage treatment plant, A is spring, B is summer, C is autumn, and D is winter.

[0028] Figure 8 : Virus concentrations in aeration tank sludge and excess sludge in four seasons, A is EV and B is PMMoV.

[0029] Fig. 9 : The concentration of HAdV in the receiving surface water of the sewage treatment plant, A is spring, B is summer, C is autumn, and D is winter.

[0030] Fig.10 : crAssPhage concentration in the receiving surface water of the sewage treatment plant, A is spring, B is summer, C is autumn, and D is winter.

[0031] Fig.11 : The concentration of EV in the receiving surface water of the sewage treatment plant, A is spring, B is summer, C is autumn, and D is winter.

[0032] Fig.12 : The concentration of PMMoV in the receiving surface water of the sewage treatment plant, A is spring, B is summer, C is autumn, and D is winter.

[0033] Fig.13 : Changing trends of concentrations of physical and chemical indicators in water bodies.

[0034] Fig.14 : Heat map of correlation between virus concentration and physical and chemical indicators. DETAILED DESCRIPTION

[0035] The present invention provides a method for analyzing water pollution, which collects virus content information in water, physical and chemical index information of water, and hydrological information of water sample collection points, draws a box plot of virus occurrence rules based on the collected information, and performs correlation analysis;

[0036] Then, according to the correlation between the virus content and the physical and chemical indicators of the water body, the virus content in the water body is judged by the physical and chemical information parameters in the water body; or the physical and chemical information parameters in the water body are judged by the virus content in the water body. In the above method, the virus includes one or more of adenovirus (HAdV), enterovirus (EV), crAss phage (crAssPhage) and pepper mild mottle virus (PMMoV).

[0037] In the above method, the virus content information in the water body is the virus occurrence concentration, which is detected by using PCR technology. Preferably, the above PCR technology adopts digital PCR technology.

[0038] Optionally, a set of PCR primers and probes, including:

[0039] Primers and probes for detecting enterovirus:

[0040] EntFb is shown in SEQ ID NO. 1: CCTCCGGCCCCTGAATG;

[0041] EntRb is shown in SEQ ID NO. 2: ACCGGATGGCCAATCCAA;

[0042] EntPb is shown in SEQ ID NO.3: FAM-CGGAACCGACTACTTTGGGTGTCCGT-TAMRA;

[0043] Primers for detection of adenovirus:

[0044] HADFb is shown in SEQ ID NO. 4: GCCACGGTGGGGTTTCTAAACTT;

[0045] HADRb is shown in SEQ ID NO. 5: GCCCCAGTGGTCTTACATGCACATC;

[0046] Primers for detection of Krass bacteriophage:

[0047] crAssF is shown in SEQ ID NO. 6: GCTGAACAAACTGCTAATGCAGA;

[0048] crAssR is shown in SEQ ID NO. 7: TCAAGATGACCAATAAACAAGCCA;

[0049] Primers and probes for detecting pepper mild mottle virus:

[0050] PMMoVF is shown in SEQ ID NO. 8: GAGTGGTTTGACCTTAACGTTTGA;

[0051] PMMoVR is represented by SEQ ID NO. 9: TTGTCGGTTGCAATGCAAGT;

[0052] PMMoVP is shown as SEQ ID NO.10: FAM-CCTACCGAAGCAAATG-MGB-NFQ.

[0053] In the above method, the viruses in the water body need to be enriched before using PCR technology for detection. The enrichment method includes one or more of polyethylene glycol precipitation method, silica adsorption method, skim milk flocculation method and aluminum salt coagulation precipitation method.

[0054] Preferably, the enrichment method is a silica adsorption method and a skim milk coagulation method.

[0055] In the above method, the physical and chemical indicators of the water body include one or more of water temperature, pH, dissolved oxygen concentration, ammonia nitrogen concentration, total phosphorus concentration, total nitrogen concentration, nitrite concentration, nitrate concentration and soluble organic carbon concentration.

[0056] In the above method, the hydrological information of the water sample collection point includes the geographical location information and collection season information of the collection point.

[0057] Preferably, the water sample collection points include sample points of a sewage treatment plant and multiple urban sites; the urban sites include receiving river areas 400 to 600 m upstream and 1 to 5.2 km downstream of a sewage treatment plant discharge outlet.

[0058] Preferably, each sample point of the sewage treatment plant includes one or more of a water inlet, primary effluent, secondary effluent, tertiary effluent, aeration tank sludge and residual sludge.

[0059] In the above method, the correlation analysis method is correlation heat map analysis.

[0060] Application of the above methods in water pollution monitoring and assessment.

[0061] A water pollutant monitoring indicator, the TOC and nitrate concentrations of water samples increase, and the virus concentration decreases. More specifically, TOC and nitrate concentrations are negatively correlated with virus presence.

[0062] In the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.

[0063] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0064] In the experiments of the embodiments to be listed below: * p<0.1, ** p<0.05, *** p<0.01.

[0065] Example 1

[0066] Water sample collection

[0067] Selection of sampling sites:

[0068] The primary inlet (W1), primary effluent (W2), secondary effluent (W3) and tertiary effluent (W4) of Changchun Southeast Wastewater Treatment Plant were selected as water samples for collection. At the same time, sludge collection points were set up in the aeration tank sludge (N1) and the dewatered sludge after the dewatering workshop (N2).

[0069] The Yitong River was selected as the surface water collection source, and the river was divided into the upstream and downstream of the river, and divided into four areas, namely S1, S2, S3, and S4 sampling points (43°47′18.37″-43°50′13.32″, 125°19′47.58″-125°21′2.36″). Points S1 and S2 are the upstream and drainage points of the sewage treatment plant, respectively; Point S3 is located 3.2 km downstream of the sewage treatment plant outlet, located in Changchun Industrial Track Park, near Changchun World Sculpture Park, and surrounded by many residential areas; Point S4 is located about 5.2 km downstream of the sewage treatment plant outlet, located in the wetland park, and surrounded by many residential areas, and water quality indicators are measured in time at the collection site. At each location, water samples were collected from 0.1m below the water surface, and 8 parallel water samples were collected at each sampling point. At each location, a total volume of 5L of surface water was collected into a fully rinsed sterile container. After collection, the samples were immediately transported to the laboratory, stored in the dark at 4°C, and enriched and tested within 1 to 3 days. The longitude and latitude information of each sampling point is shown in Table 1.

[0070] Table 1 Latitude and longitude information of each sampling point

[0071]

[0072] Note: * is the distance between adjacent sampling points.

[0073] Sampling time:

[0074] February 2023 - January of the following year: spring (17.6-19.2℃), summer (22.3-24.1℃), autumn (20.5-23.3℃), and winter (11.6-13℃).

[0075] Example 2

[0076] Physical and chemical properties testing

[0077] A portable multi-parameter water quality meter was used to measure water temperature (T) and pH on site; a dissolved oxygen meter was used to measure dissolved oxygen concentration (DO); basic water quality indicators were tested immediately after the water samples were brought back to the laboratory, and a water quality test kit (H2OTEST, 0.25-30 mg / L, 50 times) was used for pretreatment according to the instructions. Then, a DR3900 visible light spectrophotometer was used to insert the test tube into the instrument for reading, and ammonia nitrogen (NH4 + -N), total phosphorus (TP), total nitrogen (TN), nitrite (NO2- -N) and nitrate (NO3 - -N); the water sample was acidified to pH 4.0 with 1 mol / L HCl solution and then the soluble organic carbon (DOC) was determined using a TOC analyzer. The results of the physical and chemical properties of the samples in Example 1 are shown in Tables 2 to 5:

[0078] Table 2 Physical and chemical parameters of each sampling point in spring

[0079]

[0080]

[0081] Table 3 Physical and chemical parameters of each sampling point in summer

[0082]

[0083] Table 4 Physical and chemical parameters of each sampling point in autumn

[0084]

[0085] Table 5 Physical and chemical parameters of each sampling point in winter

[0086]

[0087] Example 3

[0088] 1. Enrichment method:

[0089] (1) Polyethylene glycol precipitation method (PEG)

[0090] Add 7g polyethylene glycol (PEG 8000 is used) and 2.25g sodium chloride to 4 100mL centrifuge tubes containing 100mL of sewage sample supernatant, and mix thoroughly until the reagent is completely dissolved. The dissolution process takes about 15min. Then centrifuge at 4℃ and 12000g for 100min. After stopping, pour and discard the supernatant in the centrifuge tube. Repeat the operation of blowing and suction precipitation and instantaneous centrifugation. The final suspension is the concentrated solution of the water sample with a volume of about 0.6mL. Transfer the concentrated solution to a 1.5mL centrifuge tube and store it at 0℃~4℃, and then perform subsequent nucleic acid extraction and digital droplet PCR (ddPCR) detection.

[0091] (2) Silica adsorption method (SiO2)

[0092] Silica particles are used to enrich viruses. The isoelectric point of viruses is mostly between pH 4.5-5.5, and their specific surface area is large. The pH of the water sample is adjusted to about 3.5, so that the surface of the virus particles is positively charged, while the surface of the silica solid particles is negatively charged. Through electrostatic adsorption, the virus particles will be adsorbed on the surface of the solid particles, and then the surface electrical properties will be changed by the eluent with a high pH value (9.0-10.5), thereby desorbing the virus.

[0093] Take 100mL of raw sewage sample and centrifuge it at 8000g for 1min, collect the supernatant and add 0.4mL of sterilized SiO2 suspension and 50μL of 96% acetic acid, oscillate at room temperature for 10min, centrifuge it at 6800g for 2min, and discard the supernatant; fully infiltrate and mix the precipitate with 1mL of beef extract-glycine buffer (pH~9.0, containing 0.05mol / L glycine and 3% beef extract), and incubate it in a 60℃ water bath for 10min; after the precipitate infiltration solution is centrifuged at 10000g for 3min, collect the supernatant and store it at -80℃.

[0094] (3) Skim milk flocculation (SMF)

[0095] Take 75 mL of the sample, add 100 mL of 0.25 mol / L glycine buffer, shake in an ice bath for 30 min, then adjust the pH to 3.5 with 6 mol / L HCl, add 1% skim milk solution, stir at room temperature for 3 h, then remove the supernatant by centrifugation, and finally dissolve in 1 mL of phosphate buffer with a pH of 7.5, and store at -80 °C for subsequent testing.

[0096] (4) Aluminum salt coagulation precipitation method

[0097] Transfer 75mL of sewage sample or supernatant after pre-centrifugation to a 100mL conical flask, add 0.5mL of 0.3mol / L aluminum chloride solution, adjust the water sample pH to 6.0 with 1mol / L sodium hydroxide solution, place in a constant temperature shaking incubator, and mix at room temperature for 15min at a speed of 150r / min. Transfer the water sample to a 100mL centrifuge tube, centrifuge at 4℃ and 1900g for 5min, pour out the supernatant in the centrifuge tube, add 0.20g of disodium ethylenediaminetetraacetic acid dihydrate to the remaining colloid, and transfer to a 10mL centrifuge tube. Place the 10mL centrifuge tube in a water bath and bathe at 70℃ for 5min. The liquid in the centrifuge tube after the water bath is the concentrate of the water sample.

[0098] 2. Sample testing

[0099] The water samples collected in Example 1 were enriched using the above four enrichment methods, and the viruses in the water samples were quantitatively analyzed using the droplet digital PCR method. The primer and probe sequences are shown in Table 6.

[0100] Table 6 Primer and probe sequences of four viruses

[0101]

[0102] (1) HADV detection

[0103] In the experiment, the premix system of the reaction mixture was 20 μL, including 10 μL of ddPCR Supermix (Bio-Rad, CA, USA), 0.2 μL of forward and backward primers (concentration of 900 nM), 4.6 μL of sterile enzyme-free water, and 5 μL of DNA sample. 5 μL of RNA was taken from each sample, or molecular grade sterile enzyme-free water was used as a no-template control (NTC), and transferred to a disposable eight-channel droplet generator cassette (Bio-Rad, CA, USA) by a multichannel pipette. Next, 70 μL of droplet generation oil (Bio-Rad, CA, USA) was added to each oil well, and then the prepared cassette was installed in the QX 200 droplet generator (Bio-Rad, CA, USA).

[0104] After droplet generation, the suspension of each droplet was transferred to a 96-well polypropylene plate (Bio-Rad, CA, USA) by a multichannel pipette and sealed with foil, followed by amplification in a calibrated Bio-Rad thermal cycler (Bio-Rad, CA, USA). PCR cycling conditions included amplification at 95°C for 10 min, 45 cycles of 95°C for 30 s, 50°C for 30 s, and 72°C for 45 s, and a final denaturation step at 72°C for 10 min. After thermal cycling, the plate was transferred to a QX 200 droplet reader (Bio-Rad, CA, USA).

[0105] (2) EV detection

[0106] The reaction mixture was premixed in 20 μL, including 5 μL of One-Step RT-ddPCR Supermix (Bio-Rad, CA, USA), 2 μL of RT enzyme, 1 μL of 300 mM dithiothioate (DTT) solution (Bio-Rad, CA, USA), 1 μL of each forward and backward primer (concentration of 900 nM), 1 μL of probe (concentration of 250 nM), 5 μL of molecular-grade RNase-free water, and 4 μL of RNA sample. RNA was denatured at 95°C for 5 min before adding the master mix. PCR cycling conditions included reverse transcription at 60°C for 30 min, initial denaturation at 95°C for 5 min, followed by 45 cycles, each cycle consisting of 30 s of denaturation at 94°C and 60 s of annealing-extension at 60°C, and a final denaturation step at 98°C for 10 min. After thermal cycling, the plates were also transferred to a QX 200 droplet reader (Bio-Rad, CA, USA).

[0107] (3) crAssPhage detection

[0108] The premixed system of the reaction mixture in the experiment was 20 μL, including 10 μL of ddPCR Supermix (Bio-Rad, CA, USA), 0.2 μL of each forward and backward primer (concentration of 900 nM), 4.6 μL of sterile enzyme-free water, and 5 μL of DNA sample. The thermal cycle curve of ddPCR detection was pre-denaturation at 95°C for 10 min, followed by 45 cycles of 95°C for 15 s and 60°C for 1 min.

[0109] 4) PMMOV detection

[0110] The reaction mixture premix system in the experiment was 20 μL, including 5 μL One-Step RT-ddPCR Supermix (Bio-Rad, CA, USA), 2 μL RT enzyme, 1 μL 300 mM dithiothioate (DTT) solution (Bio-Rad, CA, USA), 1 μL each of forward and backward primers (concentration of 900 nM), 1 μL probe (concentration of 250 nM), 5 μL molecular grade RNase water, and 4 μL RNA sample. The ddPCR cycle conditions were 45 cycles of 95 °C for 30 s, 95 °C for 5 s, and 60 °C for 60 s.

[0111] 3. Data Analysis

[0112] QuantSoft digital ddPCR software (Bio-Rad, USA) was used for initial data analysis and quality control. TMFluorescence amplitude thresholds were applied in the Analysis Pro software 1.0.596 to distinguish positive droplets containing amplification products from negative droplets for analysis (Bio-Rad, CA, USA). Virus concentrations were expressed as copies / μL nucleic acid extract.

[0113] 4. Experimental results

[0114] We selected DNA and RNA virus representatives: human adenovirus (HAdV) and enterovirus (EV) as research objects to explore the effect of virus enrichment. Figure 1 and Figure 2 As shown: Human adenovirus (HAdV) and enterovirus (EV) were taken as research objects. In the detection of HAdV using ddPCR technology, the virus concentrations enriched by SiO2 were 35 copies / μL in spring, 25.4 copies / μL in summer, 14.2 copies / μL in autumn, and 35.7 copies / μL in winter; the virus concentrations enriched by SMF were 51.2 copies / μL in spring, 24.8 copies / μL in summer, 23.1 copies / μL in autumn, and 44.8 copies / μL in winter. In the detection of EV, the virus concentrations enriched by SiO2 were 22.57 copies / μL in spring, 38.62 copies / μL in summer, 23.4 copies / μL in autumn, and 17.3 copies / μL in winter; the virus concentrations enriched by SMF were 21.6 copies / μL in spring, 35.7 copies / μL in summer, 21.87 copies / μL in autumn, and 18.4 copies / μL in winter.

[0115] The data show that the virus concentration effect obtained by silica adsorption (SiO2) and skim milk coagulation (SMF) is significantly better than that of aluminum salt coagulation precipitation and polyethylene glycol precipitation (PEG). For silica adsorption (SiO2) and skim milk coagulation (SMF), when there are many suspended particles and other impurities in the water sample, these two methods can promote the co-precipitation of viruses and impurities through centrifugation, thereby effectively enriching viruses from water samples. Especially in the concentration process of raw sewage, obvious gray-white precipitates can be observed.

[0116] For secondary and tertiary treated water and surface water samples, the suspended particulate matter content is low and the organic matter content is high, which makes the precipitation effect of PEG method and aluminum salt coagulation precipitation method not as good as that of raw sewage. In addition, the EDTA added in the aluminum salt coagulation precipitation method may inhibit the subsequent nucleic acid extraction and polymerase chain reaction (PCR) detection. In view of physical limitations such as the volume of centrifuge containers, silica adsorption method (SiO2) and skim milk coagulation method (SMF) are more suitable for treating small-volume and high-suspended particulate matter sewage samples. Therefore, in subsequent experiments, silica adsorption method (SiO2) and skim milk coagulation method (SMF) were used as the preferred virus enrichment methods to shorten the processing time while improving the efficiency and stability of virus enrichment.

[0117] Example 4

[0118] The samples in Example 1 were enriched for viruses using the SiO2 adsorption and SMF methods in Example 3, and the presence of viruses in the samples was detected using the PCR primer probes in Example 3. The experimental results are shown below:

[0119] 1. The spatiotemporal distribution characteristics of DNA viruses in each process section of a sewage treatment plant Figures 3 to 5 As shown:

[0120] DNA viruses, including adenovirus (HAdV) and crAssPhage, were detected in all treatment stages of the Southeast Wastewater Treatment Plant. It is noteworthy that the detection of viruses showed location specificity. The detection rates of HAdV and crAssPhage were high at the water inlet (W1) and the primary effluent (W2) of the sewage treatment process, while the virus concentration showed a clear attenuation trend in the secondary effluent (W3) and the tertiary effluent (W4) after deep disinfection treatment, indicating that the sewage treatment plant's process successfully reduced the concentration of the virus. At the same time, HAdV and crAssPhage were also detected in the aeration tank sludge (N1) and the dewatered sludge samples after the dewatering workshop (N2), and the average virus concentration of the sludge samples was higher than the average concentration in the sewage treatment plant water samples. Overall, except for the situation in summer when the concentration of HAdV at the secondary effluent (W3) was slightly higher than that at the inlet (W1) and the primary effluent (W2), the concentrations of HAdV and crAssPhage in various treatment links of the sewage treatment plant generally showed a downward trend in other seasons.

[0121] In a study that comprehensively analyzed and compared the virus concentrations in sewage treatment plants during the four seasons, the results showed that the detection frequencies of HAdV and crAssPhage increased significantly during winter, especially in aeration tank sludge (N1) and dewatered sludge (N2) samples, where the virus concentrations were observed to reach a peak. In addition, the study found that both DNA viruses in water samples and sludge samples had certain seasonal regularities: the concentrations were highest in winter, followed by autumn and spring, and lowest in summer. From the end of November to mid-December 2023, the concentrations of the two viruses were observed in the inlet (W1) samples to be higher than those in the water bodies of structures in other seasons. The concentrations of crAssPhage in the sewage treatment plant influent (W1) and primary effluent samples (W2) were significantly higher than those of HAdV during the same season. However, no significant differences were observed between the concentrations of the two viruses in the secondary effluent (W3) and tertiary effluent (W4) samples.

[0122] 2. The spatiotemporal distribution characteristics of RNA viruses in each process section of the sewage treatment plant Figures 6 to 8 As shown:

[0123] RNA viruses, including enterovirus (EV) and pepper mild mottle virus (PMMoV), were also detected at different treatment stages at the Southeast WWTP. Overall, sludge samples had a higher rate of virus detection than water samples. We also noticed that EV concentrations were higher in WWTP water samples, and a seasonal pattern could be observed in any WWTP water sample, with the highest concentrations during winter and the lowest concentrations during summer.

[0124] In the samples of the influent (W1) of the sewage treatment plant, the detection rate and concentration of the two viruses were high. PMMoV was the virus with the highest content, followed by EV. There was no significant difference in the concentration of PMMoV in the samples of the secondary outlet (W3) and the tertiary outlet (W4). From June to August 2023, EV and PMMoV were detected more frequently and in higher concentrations at the sewage treatment plant. In contrast, the concentrations of EV and PMMoV detected in the aeration tank sludge and excess sludge samples were higher than those in the sewage treatment plant effluent samples, while in the secondary effluent (W3) and the tertiary effluent (W4) after deep disinfection treatment, the virus concentration gradually decreased with the continuous treatment of each structure. Similar to the previous DNA virus detection results, PMMoV is also an RNA virus with a high occurrence rate. In particular, the detection frequency of EV reached its peak in summer, while the concentration of EV was the lowest in spring. Although the concentration of PMMoV was high in summer, PMMoV was not detected at some sample points in autumn and winter.

[0125] 3. Temporal and spatial distribution characteristics of DNA viruses in surface water Figures 9-10 As shown:

[0126] Two DNA viruses, adenovirus (HAdV) and crAssPhage, were found in all the water samples tested. The results of the four seasons showed that the concentration of crAssPhage in surface water rivers was higher than that of HAdV, and this occurrence pattern was highly similar to the previous study of crAssPhage as a water indicator.

[0127] A comprehensive analysis and comparison of the virus concentrations in surface water rivers during the four seasons found that the concentrations of the two DNA viruses have a clear seasonal distribution. The HAdV virus concentration reaches a peak in winter (HAdV is 10.62 copies / L), followed by autumn, and reaches a minimum in summer (HADV is 8.17 copies / L); while the crAssPhage virus concentration reaches a peak in autumn (crAssPhage is 4.65 copies / L), followed by winter, and is the lowest in summer (crAssPhage is 2.03 copies / L). This research result can infer that the virus concentration is negatively correlated with the ambient temperature, that is, the higher the temperature, the lower the virus occurrence rate.

[0128] By comparing the four sample points in the river, the geographical location specificity of the two viruses can be observed. By comparing the concentrations of points S1 and S2 in surface water, the study found that the virus concentration upstream of the sewage treatment plant was lower than that of point S2. This is because point S2 is close to the discharge location after deep treatment of the sewage treatment plant. At the same time, the concentrations of points S3 and S4 were higher than those of points S1 and S2. The reason may be that the S3 and S4 sample points are located in densely populated areas, surrounded by parks and residential areas. However, not all viruses in urban rivers reflect the epidemiology of human viral infections. The concentration of HAdV in rivers is not related to clinical prevalence, which may be due to its strong resistance to the environment, allowing it to persist in water for a long time.

[0129] 4. Temporal and spatial distribution characteristics of RNA viruses in surface water Figures 11-12 As shown:

[0130] RNA viruses, enterovirus (EV), were detected in samples from four locations in the Yitong River. In general, the seasonal distribution of EV was observed in samples from surface rivers, with higher concentrations in winter and the lowest in summer. Similarly, RNA viruses, including enterovirus (EV) and pepper mild mottle virus (PMMoV), were also detected in samples from four locations in the Yitong River. Overall, the detection concentration of PMMoV was higher than that of EV in all four seasons. In addition, seasonal distribution patterns of two RNA viruses were also observed in surface river samples.

[0131] The study compared data from four seasons and found that the detection rate and concentration of the two viruses in the surface river S3 and S4 samples were very high. EV had the highest virus content, followed by PMMoV. However, in the samples at S2, there was no significant difference in the concentration of the two RNA viruses. The reason is that the samples at S2 were located at the outlet of the sewage treatment plant, and after deep treatment with ultraviolet rays and ozone, the virus concentration was significantly reduced.

[0132] In contrast, the concentrations of EV and PMMoV detected at the upstream S1 point were lower than those at the sewage plant inlet sample (W1), while the concentrations of these two RNA viruses showed a gradual upward trend with the downstream of the river, reaching peaks at points S3 and S4. Especially in summer, the occurrence of EV and PMMoV was most active. The average concentrations of EV and PMMOV reached 45.31 copies / μL and 1143.61 copies / μL, respectively, with the lowest concentrations of the two viruses in spring. Compared with the appearance of DNA viruses in the river, the appearance of RNA viruses at points S3 and S4 was more obvious.

[0133] Example 5

[0134] The physicochemical information measured in Example 2 and the water virus occurrence information measured in Example 4 were subjected to correlation analysis, and a correlation heat map between viruses and environmental variables was constructed using ChiPlot software. The results are shown in Figure 2. Figures 13-14 shown.

[0135] From the perspective of overall spatial distribution, there is no significant difference in water quality indicators in the four seasons. Comparing the line graphs of physical and chemical values ​​in the four seasons, it can be seen that the TOC and nitrate concentrations in autumn are higher than those in winter. According to the previous data on changes in virus concentrations in winter, it was observed that TOC affects the presence of viruses. The TOC and nitrate concentrations increase, and the virus concentration decreases. Environmental conditions such as sampling location, climate change, and treatment methods, as well as water quality parameters (mainly ammonia nitrogen, nitrate, TOC concentration, etc.) will affect the presence of viral communities in water. These factors may also have a mutagenic effect on the metabolic potential of the virus host.

[0136] Studies have shown the impact of physical and chemical factors on virus presence. TOC and nitrate concentrations are negatively correlated with virus presence. Viruses are generally composed of internal genetic material and an outer protein shell, including DNA viruses and RNA viruses. Viruses reproduce by constantly replicating themselves. Viruses need to parasitize in the living cells of other organisms to successfully replicate, because viruses themselves have no metabolic system or enzyme system. After leaving the host, viruses generally have no life activity and lose their ability to replicate. Therefore, physical and chemical factors in the environment have a certain connection with the metabolism of microorganisms, thereby affecting the presence of viruses.

[0137] According to the above content, it can be seen that the present invention takes the Yitong River Basin as an example. Aiming at the characteristic that the Yitong River is a typical river that uses the effluent from the urban sewage treatment plant as the replenishment water source, and the replenishment water source accounts for 90% of the total water volume of the river, different locations are selected as water sample collection points, and water samples are collected in different seasons to explore the changing patterns of different pollutants in the water samples, and construct corresponding mathematical models to provide data support for river water quality monitoring.

[0138] The method provided by the present invention finds that in terms of enrichment effect and stability, SiO2 adsorption and SMF methods are not only time-consuming, but also can enrich viruses more effectively. Subsequent experimental results have demonstrated the impact of seasonal changes on virus presence. In the treatment processes of various structures in the sewage treatment plant, the concentrations of HAdV, EV and crAssPhage continued to decline, indicating that the process of the sewage treatment plant reduced the concentration of the virus. The virus shows a trend of attenuation as the basin changes. By comparing the concentrations of points S1 and S2 in surface water, the study found that the virus concentration upstream of the sewage treatment plant is lower than that of point S2, because point S2 is close to the discharge position after deep treatment of the sewage treatment plant. At the same time, the concentrations of points S3 and S4 are higher than those of points S1 and S2, because S3 and S4 are located in densely populated areas, surrounded by parks and residential areas, indicating that there is a correlation between the scope of human activities and virus presence. In addition, studies have shown that viruses are seasonal: concentrations decrease in summer and increase in winter. The study showed the influence of physical and chemical factors on virus presence, such as the significant correlation between ammonia nitrogen, nitrate, and TOC concentrations and virus presence, and the negative correlation between TOC and nitrate concentrations and virus presence. Viruses can indicate the pollution level of water bodies in different seasons, demonstrating their potential as an alternative to traditional fecal indicator bacteria methods for monitoring pollution in aquatic ecosystems.

[0139] Furthermore, the effects of different physical and chemical parameters on the amount of viruses in water bodies demonstrated by the invention provide a new reference for the establishment of new water quality standards in the future.

[0140] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for analyzing water pollution, characterized in that: By collecting information on virus content in water bodies, physical and chemical indicators of water bodies, and hydrological information of water sample collection points, a box plot of virus occurrence patterns is drawn based on the collected information, and correlation analysis is performed; Then, based on the correlation between the virus content and the physical and chemical indicators of the water body, the virus content in the water body is judged by the physical and chemical information parameters in the water body; or the physical and chemical information parameters in the water body are judged by the virus content in the water body.

2. The method according to claim 1, characterized in that The virus includes one or more of adenovirus, enterovirus, Krass bacteriophage and pepper mild mottle virus.

3. The method according to claim 2, characterized in that The virus content information in the water body is the virus accumulation concentration information, which is obtained by using PCR technology for detection.

4. The method according to claim 3, characterized in that The primers and probe sequences for detecting enterovirus are shown in SEQ ID NOs. 1 to 3; the primers for detecting adenovirus are shown in SEQ ID NOs. 4 to 5; the primers for detecting Krass phage are shown in SEQ ID NOs. 6 to 7; the primers and probes for detecting pepper mild mottle virus are shown in SEQ ID NOs. 8 to 10.

5. The method according to claim 3, characterized in that Before using PCR technology for detection, the viruses in the water body need to be enriched, and the enrichment method includes one or more of polyethylene glycol precipitation method, silica adsorption method, skim milk flocculation method and aluminum salt coagulation precipitation method.

6. The method according to claim 1, characterized in that The physical and chemical indicators of the water body include one or more of water temperature, pH, dissolved oxygen concentration, ammonia nitrogen concentration, total phosphorus concentration, total nitrogen concentration, nitrite concentration, nitrate concentration and soluble organic carbon concentration.

7. The method according to claim 1, characterized in that The hydrological information of the water sample collection point includes geographical location information and collection season information of the collection point.

8. The method according to claim 1, characterized in that The hydrological information of the water sample collection point includes the geographical location information and collection season information of the collection point; the water sample collection points include the sample points of the sewage treatment plant and multiple urban sites; the urban sites include the receiving river areas 400 to 600 meters upstream and 1 to 5.2 kilometers downstream of the sewage treatment plant discharge outlet.

9. The method according to claim 1, characterized in that The method of the correlation analysis is correlation heat map analysis.

10. Use of any one of the methods described in claims 1 to 9 in water pollution monitoring and evaluation.

Images