CNS (central nervous system) cell-specific miRNA (micro Ribonucleic Acid) expression vector, adeno-associated virus vector and application thereof

Abstract

The invention relates to the technical field of gene engineering, in particular to a central nervous system cell specific miRNA expression vector, an adeno-associated virus vector and application thereof, the miRNA expression vector comprises an Ef1alpha promoter sequence, an induction sequence, a Tre promoter, a fluorescence labeling sequence, a tRNA sequence, a miRNA sequence and an SV40poly (A) termination signal sequence; and the gene sequence of the specific miRNA overexpression is a tRNA-miRNA-tRNA combined sequence doped at the downstream of the fluorescence labeling sequence. Experiments show that the miRNA expression vector can be stably overexpressed in specific cells. The carrier has the advantages of tracking the carrier and performing targeted therapy, and can be applied to treatment of central system neuroinflammation diseases, such as neurodegenerative diseases, cerebral hemorrhage, stroke, cerebral trauma and the like.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a central nervous system cell-specific miRNA expression vector, an adeno-associated virus vector and uses thereof. Background Art

[0002] The main cells in the brain are neurons, astrocytes, oligodendrocytes and microglia. Neurons are the basic functional units of the nervous system, responsible for transmitting and processing information. They communicate with other neurons, muscle cells or glandular cells through electrical and chemical signals. The normal function of neurons is essential for the health and operation of the entire nervous system. In many neurodegenerative diseases (such as Parkinson's disease and Alzheimer's disease), neuronal damage and death are the main pathological features. Astrocytes are the most abundant glial cells in the central nervous system, accounting for 20% to 40% of all glial cells. In the central nervous system, they perform a wide range of homeostatic functions, such as participating in synapse formation, maintaining constant intracellular and extracellular ion concentrations, participating in the transmission of neurotransmitters, forming and maintaining the blood-brain barrier, and providing support for other resident cells of the central nervous system. Under pathological conditions, astrocytes can undergo morphological and molecular changes to adopt a so-called "reactive" state, which can change their function and change the balance between their neuro-supportive and neurotoxic properties. Oligodendrocytes are an important type of glial cell in the central nervous system (CNS). Their main function is to produce myelin sheath, a structure that wraps around the axons of neurons and acts as an insulator, which can significantly increase the conduction speed of nerve impulses. Microglia are resident immune cells in the central nervous system (CNS) with functions similar to macrophages in the peripheral immune system. They play a key role in maintaining the health of the nervous system, monitoring environmental changes, and responding to damage or infection.

[0003] Adeno-associated virus (AAV) is the simplest, non-enveloped single-stranded DNA virus discovered so far. It consists of a protein capsid and a 4.7kb single-stranded DNA genome with a capsid length of 20 to 25nm. There are inverted terminal repeats (ITRs) at both ends of the AAV genome. These sequences play an important role in the virus life cycle, including key processes such as viral replication and packaging. The target gene sequence is inserted into the AAV genome coding region while retaining the ITR sequences at both ends. Through such a construction, the expression of the target gene will be finely regulated by the biological mechanism of AAV, thereby achieving stable expression in the target cells.

[0004] At present, gene delivery vectors derived from natural or genetically engineered adeno-associated viruses (AAV) have become the focus of human gene therapy. Due to their low immunogenicity, stable gene expression levels and site-specific integration ability, they have good safety and are increasingly developing in the field of gene therapy. More and more clinical trials are using them for various treatments. In the central nervous system, AAV is currently the main vector used to deliver transgenes to the central nervous system in vivo. It has the ability of efficient transgene transduction, highly engineered cell targeting, low toxicity and the potential to overcome physical barriers (including the blood-brain barrier). In the current field of treatment of neurological diseases, we often use AAV with specific promoters to specifically infect a certain type of cell in order to achieve the purpose of treating the disease. For example, AAV with GFAP promoter is used to infect astrocytes, AAV with Synapsin promoter is used to infect neurons, AAV with CD68 promoter is used to infect microglia, and AAV with Olig2 promoter is used to infect oligodendrocytes.

[0005] MicroRNA (miRNA) is an endogenous small non-coding RNA, generally between 20-25 nucleotides in length, which regulates gene expression by base pairing with the 3' untranslated region of the target messenger RNA and is widely involved in a variety of key biological and cellular processes, such as apoptosis, differentiation, development, proliferation, metabolism and signal transduction pathways. Therefore, miRNA-based therapeutic approaches may be promising potential tools for treating various diseases.

[0006] In the central nervous system, the important physiological and pathological functions of microRNA are also gradually being discovered. A Nature study in 2017 confirmed that neural stem cells in the hypothalamus control the body's aging rhythm through microRNA in exosomes. Among them, the most representative microRNA is miR-124. The abundance of miR-124 accounts for 25-48% of the total microRNA in the brain, and it is the most highly expressed microRNA in the central nervous system. MiR-124 can promote neural regeneration and neural development, inhibit the differentiation of neural stem cells, and provide an alternative strategy for neural repair in diseases such as stroke, brain trauma, and neurodegenerative diseases.

[0007] In the prior art, various nervous system cell subtype promoters are often used to drive the expression of target gene mRNA with different cell specificity. However, there is currently no specific promoter that can be used to control the expression of miRNA in a specific cell type. Summary of the invention

[0008] In response to the above technical problems, the first aspect of the present invention is to provide a central nervous system-specific miRNA expression vector, which is transfected into cells and, under the induction of doxycycline (dox), drives the expression of fluorescent marker genes, thereby achieving specific expression of miRNA in transfected cells.

[0009] The second aspect of the present invention provides a use of a central nervous system cell-specific miRNA expression vector in improving miRNA overexpression. Under the induction of doxycycline, the Tre promoter drives the expression of a fluorescent marker gene, thereby driving the specific expression of miRNA.

[0010] The third aspect of the present invention provides an adeno-associated virus vector specific to central nervous system cells. After the adeno-associated virus is injected, a cell-specific promoter is used to drive fluorescent gene expression, thereby further achieving specific expression of miRNA in specific cells, which can be used to track specific cells and achieve the advantages of targeted cell therapy.

[0011] A fourth aspect of the present invention provides a use of a central nervous system cell-specific adeno-associated virus vector in improving the specific expression of miRNA.

[0012] The fifth aspect of the present invention provides a central nervous system cell-specific adeno-associated virus vector for use in the preparation of drugs for central nervous system neuroinflammation-related diseases, such as neural repair for cerebral hemorrhage, stroke, brain trauma, neurodegeneration and other diseases.

[0013] To achieve the above object, the technical solution of the present invention is:

[0014] The first aspect of the present invention provides a central nervous system cell-specific miRNA expression vector for constructing a specific overexpression miRNA vector, comprising: an Ef1α promoter sequence, an inducible sequence, a Tre promoter, a fluorescent marker gene sequence, a tRNA sequence, a miRNA sequence, a tRNA sequence, and an SV40 poly (A) termination signal sequence;

[0015] The Tre promoter sequence is shown in SEQ ID NO.1, the tRNA sequence is shown in SEQ ID NO.3, the SV40 poly(A) termination signal sequence is shown in SEQ ID NO.5, and the Ef1α promoter sequence is shown in SEQ ID NO.6;

[0016] The induction sequence is a doxycycline-induced activation sequence, specifically: 3G transactivator protein factor, the nucleotide sequence of which is shown in SEQ ID NO.7;

[0017] The specific miRNA overexpression gene sequence is a tRNA-miRNA-tRNA incorporated into the downstream of the doxycycline induction system, and the Tre promoter drives the expression of the fluorescent marker gene, thereby achieving miRNA expression.

[0018] In a preferred implementation manner of the first aspect, the miRNA is miR-124-3P, and the sequence is shown in SEQ ID NO.4.

[0019] In a preferred implementation manner of the first aspect, the fluorescent marker gene sequence is an EGFP fluorescent marker gene sequence driven by a Tre promoter, and the sequence is shown in SEQ ID NO.2.

[0020] The second aspect of the present invention provides the use of the central nervous system cell-specific miRNA expression vector described in the first aspect to increase miRNA overexpression in specific cells (including but not limited to astrocytes, oligodendrocytes, neurons, microglia, etc.), and the cell-specific promoter drives the expression of the fluorescent marker gene, thereby driving the specific expression of the miRNA.

[0021] In a preferred embodiment of the second aspect, the miRNA specific expression is specific expression in vivo or in vitro.

[0022] The third aspect of the present invention provides a central nervous system cell-specific miRNA overexpression adeno-associated virus vector, comprising an astrocyte-specific promoter, a fluorescent marker sequence, and a tRNA-miRNA-tRNA sequence, wherein the tRNA-miRNA-tRNA sequence includes a tRNA sequence and a miRNA sequence, wherein the tRNA sequence is shown in SEQ ID NO.3, and the fluorescent marker gene sequence is an EGFP fluorescent marker gene sequence driven by the astrocyte-specific promoter GFAP, and the sequence is shown in SEQ ID NO.2.

[0023] Furthermore, the miRNA is miR-124-3P, and the sequence is shown in SEQ ID NO.4.

[0024] The fourth aspect of the present invention provides use of the central nervous system cell-specific miRNA overexpressing adeno-associated virus vector described in the third aspect in preparing a transgenic experimental animal model.

[0025] In a preferred embodiment of the fourth aspect, the cell-specific miRNA expression vector is miRNA expression in astrocytes;

[0026] The miRNA expression in astrocytes was used to prepare an experimental animal treatment model for cerebral hemorrhage.

[0027] The fifth aspect of the present invention provides the use of the central nervous system cell-specific miRNA overexpression adeno-associated virus vector described in the third aspect in the preparation of drugs for central nervous system neuroinflammatory related diseases, such as in the treatment of neurodegenerative diseases, cerebral hemorrhage, stroke, brain trauma and the like.

[0028] Due to the adoption of the above technical solution, the present invention has the following advantages and positive effects compared with the prior art:

[0029] The cell-specific miRNA overexpression vector provided by the present invention inserts a fluorescent marker gene and tRNA-miRNA-tRNA downstream of the doxycycline induction system, and terminates transcription through SV40 poly(A). The vector provided by the present invention is transfected into cells, and under the induction of dox, the promoter drives the expression of the fluorescent marker gene, thereby specifically expressing the miRNA in the cell. Since the doxycycline induction system can be replaced by a cell type-specific promoter system, the present invention has the advantages of tracking the vector and performing targeted therapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 A simplified diagram of miRNA overexpression in the inducible miRNA expression vector of Example 1 of the present invention;

[0031] Figure 2 A schematic diagram of the miRNA expression vector of the doxycycline-inducible system of Example 1 of the present invention;

[0032] Figure 3 This is a fluorescence identification diagram of cells transfected with the miRNA expression vector of the doxycycline-inducible system of Example 1 of the present invention;

[0033] Figure 4 Graphs showing miRNA expression levels after PCR amplification of cells transfected with the miRNA expression vector of the doxycycline-inducible system of Example 1 of the present invention, wherein (a) is the expression level of miR-124-3p, (b) is the expression level of EGFP, and (c) is a graph showing the correlation between the expressions of miR-124-3p and EGFP;

[0034] Figure 5 The EGFP-positive cell tracking condition of the immunofluorescence test of the cerebral hemorrhage test animal model constructed in Example 2 of the present invention, wherein (a) is a fluorescent photo, and (b) is the percentage count of the EGFP-positive cell area;

[0035] Figure 6 The activation of neurotoxic astrocytes in the animal model of cerebral hemorrhage test in the experimental group and the control group of Example 2 of the present invention, wherein (a) is an antibody fluorescence photo, (b) is a comparison of the C3 antibody coverage area, and (c) is a comparison of the C3 antibody expression;

[0036] Figure 7 These are immunofluorescence images of brain slices of the animal models of the cerebral hemorrhage test in the experimental group and the control group of Example 2 of the present invention, wherein (a) is a fluorescence image; and (b) is a dead cell counting image under a fluorescence microscope. DETAILED DESCRIPTION

[0037] The following is a further detailed description of a cell-specific miRNA expression vector, an adeno-associated virus vector and its use proposed by the present invention in conjunction with the accompanying drawings and specific embodiments. The advantages and features of the present invention will become more apparent from the following description.

[0038] Example 1

[0039] Overexpression verification of miRNA expression vector, taking miR-124-3p of doxycycline-inducible system as an example

[0040] 1. A doxycycline-driven miRNA expression vector (hereinafter referred to as target plasmid), comprising: Tre promoter, fluorescent marker sequence, tRNA sequence, miRNA sequence, tRNA sequence, SV40 poly (A) termination signal sequence, Ef1α promoter sequence, 3G sequence;

[0041] The Tre promoter sequence is shown in SEQ ID NO.1, the tRNA sequence is shown in SEQ ID NO.3, the SV40 poly(A) termination signal sequence is shown in SEQ ID NO.5, and the Ef1α promoter sequence is shown in SEQ ID NO.6; The 3G sequence is shown in SEQ ID NO.7;

[0042] The fluorescent marker sequence is the EGFP fluorescent marker gene driven by the Tre promoter, and the sequence is shown in SEQ ID NO.2; the miRNA sequence is the miR-124-3p sequence, and the specific sequence is shown in SEQ ID NO.4;

[0043] like Figure 1-2 As shown, the doxycycline-driven miRNA expression vector incorporates tRNA-miRNA-tRNA and SV40 poly(A) transcription termination signal downstream of the EGFP sequence. Doxycycline drives EGFP expression, thereby achieving miR-124-3p expression.

[0044] 2. Transfect the above target plasmid into tool cells (293T)

[0045] 293T cells were cultured at 1.5 × 10 5The cell density of cells / well was placed in a 24-well plate. 500ul of cell culture medium was added to each well. Under a light microscope, the 293T cells were identified to have grown to a suitable density, and transfected using EZ trans cell transfection reagent. 50μg of the target plasmid and 100μl of transfection reagent were added to each 15cm culture dish. The specific steps are as follows:

[0046] Prepare two 50ml centrifuge tubes: tube A and tube B (blank control), add Opti MEM transfection buffer to each tube, the volume of Opti MEM transfection buffer is n (n = number of 293T cell plates) × 1ml. Then, add n × 50μg of target plasmid to tube A and mix by pipetting, wherein Opti MEM transfection buffer is serum-free culture medium.

[0047] Add n×100μl of EZ trans cell transfection reagent to tube B and mix well by pipetting. After the two tubes are allowed to stand for 3min-5min, add the liquid in tube B to tube A and mix well by pipetting. After another 10min-15min, add the mixture to the complete medium of 293T cells at a volume of 2ml / plate of cells for transfection. After 48h of transfection, add 300ul of fresh complete medium to each well and continue to incubate the cells for 24-48h.

[0048] 3. Fluorescence identification of transfected cells to evaluate whether EGFP is expressed

[0049] Remove the cell supernatant and wash three times with PBS. Add 4% paraformaldehyde (PFA) and fix for 10 minutes. Remove PFA and wash three times with PBS. Soak in 0.3% TritonX-100 (prepared in PBS solution) for 30 minutes, and wash three times with PBS, each time for 3 minutes. Dilute the EGFP antibody with immunofluorescence primary antibody diluent, add it to the cell culture slide, and incubate at 4°C overnight. Remove the primary antibody the next day, wash three times with PBS, each time for 10 minutes. Use diluted Alexa Fluor 488-labeled donkey anti-mouse IgG (H+L) fluorescent secondary antibody, add it to the cell culture slide, and place it on a shaker at room temperature for 2 hours. Afterwards, remove the secondary antibody and wash three times with PBS, each time for 10 minutes. Add anti-fluorescence quencher (containing DAPI), cover with a coverslip, and seal the slide with nail polish. The results are as follows. Figure 3 As shown, in the absence of doxycycline (dox), EGFP expression was essentially absent, while addition of dox significantly upregulated EGFP expression, indicating that under the induction of dox, the Tre promoter drives EGFP expression.

[0050] 4. Real-time quantitative PCR detection of transfected cells

[0051] ① RNA extraction uses the Welling Bio RNA Extraction Kit. Remove the culture medium, wash once with PBS, add 500μl lysis solution, blow down the attached 293T cells, and transfer them to a 1.5ml EP tube. Shake for 15s and let stand at room temperature for 5min. Add 160μl chloroform to the tube, shake for 15s, and let stand at room temperature for 3min. Centrifuge at 13000rpm and 4℃ for 10min. At this time, the liquid in the EP tube can be seen to be divided into 3 layers, and the upper layer is RNA. Transfer the upper layer of liquid to a new EP tube, add 1 / 2 volume of anhydrous ethanol, shake for 15s, and transfer the liquid to the centrifuge column in the kit. Centrifuge at 13000rpm and 4℃ for 45s, and discard the liquid in the lower tube. Add 0.5ml protein removal solution RE, centrifuge at 13000rpm and 4℃ for 45s, and discard the liquid in the lower tube. Add 0.5 ml of RW rinse solution, centrifuge at 13000 rpm, 4℃ for 45 seconds, discard the liquid in the lower tube, rinse again with RW, and discard the liquid in the lower tube. Centrifuge at 13000 rpm, 4℃ for 3 minutes, discard the lower tube, and put on a new EP tube to collect RNA. Add 30 μl of RNase-free water, let stand for 2 minutes, and centrifuge at 13000 rpm, 4℃ for 3 minutes to obtain RNA. Use DeNovix to quantify RNA.

[0052] ② RNA reverse transcription was performed using 1000 ng of RNA. Reverse transcription was performed using the Vazyme reverse transcription kit. In brief, DNA was first removed using a 4x DNA wiper, and then reverse transcribed using a 5x reverse transcriptase to obtain a final system of 20 μl cDNA. The qPCR kit used was HiScript III RT SuperMix for qPCR (+gDNA wiper), R323-01, Vazyme, Vazyme.

[0053] ③qPCR: qPCR primer sequences are as follows

[0054] EGFP-QF GGACGACGGCAACTACAAGA SEQ ID NO.8 EGFP-QR CTCGATGTTGTGGCGGATCT SEQ ID NO.9 miR-124-3p-F GCGTAAGGCACGCGGTG SEQ ID NO.10 miR-124-3p-R AGTGCAGGGTCCGAGGTATT SEQ ID NO.11 mGapdh-QF CATGGCCTTCCGTGTTCCTA SEQ ID NO.12 mGapdh-QR GCGGCACGTCAGATCCA SEQ ID NO.13

[0055] The results are as follows Figure 4 As shown, the expression level of miR-124-3p was significantly increased compared with the group without dox addition. In addition, the correlation analysis results suggested that the correlation analysis between miR-124-3p and EGFP mRNA levels revealed a surprisingly strong correlation between the two, with a p value of less than 0.0001 and an R2 value of 0.9427.

[0056] This example illustrates that the inducible miRNA expression vector can specifically express miRNA in vitro.

[0057] Example 2

[0058] Construction of central nervous system cell-specific AVV-miR-124-3p and its application in experimental animal models of cerebral hemorrhage

[0059] 1. Construction of adeno-associated virus vector specifically expressing miR-124-3p in astrocytes

[0060] The GFAP promoter (astrocyte-specific promoter) was used to drive EGFP expression, tRNA-miRNA-tRNA was incorporated downstream of EGFP, and the above-mentioned double tRNA sandwich short sequence was used to release miR-124-3p expression to construct an adeno-associated viral vector specifically expressing miR-124-3p in astrocytes. The vector structure was commissioned to be synthesized by Heyuan Biotechnology (Shanghai) Co., Ltd.: AAV-PHP.eB-sGFAP-EGFP-tRNA-miR-124-3p-tRNA and AAV-PHP.eB-sGFAP-EGFP adeno-associated viral vector (control group)

[0061] 2. Construction of mouse model for cerebral hemorrhage experiment and injection of AAV vector

[0062] The intracerebral hemorrhage model was established by type IV collagenase injection, and the specific implementation process was as follows:

[0063] Preparation of type IV collagenase working solution: The concentration of type IV collagenase powder is ≥125CDU / mg. Use deionized water to prepare it into a stock solution with a final concentration of 3.75U / μl. The working solution used for mouse ICH modeling is 0.0375U / μl.

[0064] AAV vector injection for intracerebral hemorrhage in mice: 6-week-old male mice were selected for the experiment. The mice were anesthetized by intraperitoneal injection of sodium pentobarbital (45 mg / kg), and then fixed with a brain stereotaxic instrument; the skull was exposed through a midline incision, and the tissue was cleaned and dried with dry cotton; referring to the mouse brain stereotaxic atlas, three AAV vector injection sites were marked in the right brain of the mouse with Bregma as the origin: (x: +2.0mm, y: +0.5mm, z: -2.9mm.), and the skull at the injection site was drilled with a cranial drill, and the AAV vector (titer 6-9×10 11 vg / ml) was injected into the brain parenchyma at an injection speed of 0.1μL / min, and 1μL was injected at each site; the needle was left in place for 10 minutes after the injection and then removed. The ICH model was established 3 weeks after the AAV vector was injected into mice, and AAV was divided into an AAV-miR-124-3p positive virus group and an AAV-EGFP control virus group.

[0065] Mouse intracerebral hemorrhage model: The mouse was anesthetized with 0.3% pentobarbital, fixed on a brain stereotaxic instrument, and the anterior and posterior bregmas of the mouse were exposed. The glass electrode was inserted into the tip of a programmable nanoliter microinjector. 1 μl (0.0375U) of type IV collagenase working solution was inhaled using a microinjection pump. Leveling the mouse brain plane: Align the tip of the glass electrode with the anterior bregma point, and set x, y, and z as 0. The striatum position was selected as the ICH modeling site, with coordinates of: x: +2.0mm, y: +0.9mm, z: -2.9mm. After the glass electrode entered the specified depth, the injection program was started, and 1 μl of type IV collagenase working solution was injected into the mouse striatum within 8 minutes. After the injection program was completed, the needle was retained for 5 minutes. Finally, the glass electrode was slowly lifted above the skull plane within 2 minutes. Subsequently, the drill hole was sealed with bone wax and the mouse head skin was sutured. After the operation, the mouse was placed in a resuscitation box at a constant temperature (37°C) for resuscitation. After the mice recovered, they were transferred to a clean mouse room and observed daily.

[0066] 3. Immunofluorescence staining of mouse brain sections:

[0067] After the modeling of cerebral hemorrhage, the mice were anesthetized on the third day and perfused for sampling. The specific method was to fix the mice on the perfusion table, expose the mouse heart with scissors, insert the scalp needle connected to the perfusion pump into the left ventricle of the mouse, cut the right auricle of the mouse heart with scissors, perfuse with normal saline first, and then perfuse with 4% PFA. Muscle spasms of the mouse can be observed. After perfusion for 3 minutes, the perfusion was stopped. The mouse brain was taken out. Placed in 4% PFA for 24 hours. The 30% sucrose was replaced on the second day. After the mouse brain was precipitated, the sucrose on the surface was drained, transferred to the OCT embedding box for embedding, and placed in a frozen slicer for sectioning (30μm / slice). The brain slices of the target area were transferred to a 24-well plate according to the number of 8 slices per well. The brain slices were washed with PBS for 3 times, each time for 10 minutes. The corresponding antibodies were diluted with immunofluorescence primary antibody diluent and added to the 24-well plate at 4°C overnight. The primary antibody was removed on the second day and washed with PBS for 3 times, each time for 10 minutes. Use diluted species-specific fluorescent secondary antibodies, add to 24-well plates, and place on a shaker at room temperature for 2 hours. Afterwards, remove the secondary antibody and wash 3 times with PBS, 10 minutes each time. Use a toothpick to transfer the brain slices in the 24-well plate to a slide, add DAPI solution, incubate at 37°C in the dark for 20 minutes, and wash 3 times with PBS, 10 minutes each time.

[0068] The results are as follows Figure 5 As shown, various antibodies including GFAP, NeuN and Iba1 were used to track EGFP-positive cells, showing that more than 90% of EGFP-positive cells were astrocytes. In addition, we compared the number of neurotoxic astrocytes around the hematoma between the two groups of mice. Figure 6As shown, it was found that overexpression of miR-124-3p significantly inhibited the neurotoxic activation of astrocytes.

[0069] 4. Apoptosis staining of mouse brain sections

[0070] After the cerebral hemorrhage model was established, the samples were collected on the third day, and the mouse brain slices were washed and stained with primary and secondary antibodies. The operation was the same as immunofluorescence staining. After staining with the secondary antibody, TUNEL detection solution was prepared. In each well of the 24-well plate, the following were added: 10 μl of TdT enzyme, 90 μl of fluorescent labeling solution, 100 μl of TUNEL detection solution, and 100 μl of TdT enzyme diluent. Incubate at 37°C in the dark for 1 hour, then wash twice with PBS, 10 minutes each time. Finally, seal the slices.

[0071] like Figure 7 As shown, the results showed that the number of apoptotic cells at the hematoma edge of ICH mice was significantly reduced after AAV-miR-124-3p injection.

[0072] This example illustrates that the constructed AAV-miR-124-3p vector can be used to prepare drugs for treating cerebral hemorrhage.

[0073] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Even if various changes are made to the present invention, including but not limited to various cell-specific promoters and various miRNA overexpression vectors, if these changes fall within the scope of the claims of the present invention and their equivalent technologies, they still fall within the protection scope of the present invention.

Claims

1. A central nervous system cell-specific miRNA expression vector for constructing a vector for overexpressing miRNA, characterized in that: include: Ef1α promoter sequence, inducible sequence, Tre promoter, fluorescent marker sequence, tRNA sequence, miRNA sequence, SV40 poly(A) termination signal sequence; The Ef1α promoter sequence is shown in SEQ ID NO.6, and the inducible sequence is a doxycycline inducible activation sequence, specifically: 3G transactivator protein factor, the nucleotide sequence of which is shown in SEQ ID NO.7; The Tre promoter sequence is shown in SEQ ID NO.1, the tRNA sequence is shown in SEQ ID NO.3, and the SV40 poly (A) termination signal sequence is shown in SEQ ID NO.5; The gene sequence for overexpression of the specific miRNA is a tRNA-miRNA-tRNA combination sequence incorporated downstream of the fluorescent marker sequence.

2. The central nervous system cell-specific miRNA expression vector according to claim 1, characterized in that: The miRNA is miR-124-3P, and the sequence is shown in SEQ ID NO.

4.

3. The central nervous system cell-specific miRNA expression vector according to claim 1, characterized in that: The fluorescent marker gene sequence is a doxycycline-driven EGFP fluorescent marker gene sequence, and the sequence is shown in SEQ ID NO.

2.

4. Use of the central nervous system cell-specific miRNA expression vector according to any one of claims 1 to 3 in improving miRNA overexpression, characterized in that: Under doxycycline induction, the Tre promoter drives the expression of fluorescent marker genes, which in turn drives the specific expression of miRNA.

5. The use according to claim 4, characterized in that The miRNA specific expression is specific expression in vitro.

6. A central nervous system cell-specific miRNA overexpression adeno-associated virus vector, characterized in that: include: A cell-specific promoter, a fluorescent marker sequence, and a tRNA-miRNA-tRNA sequence. The fluorescent marker gene sequence is a doxycycline-driven EGFP fluorescent marker gene sequence, and the sequence is shown in SEQ ID NO.2; The tRNA-miRNA-tRNA sequence includes a tRNA sequence and a miRNA sequence, and the tRNA sequence is shown as SEQ ID NO.

3.

7. The central nervous system cell-specific miRNA overexpression adeno-associated virus vector according to claim 6, characterized in that: The miRNA sequence is miR-124-3P, and the sequence is shown in SEQ ID NO.

4.

8. Use of the central nervous system cell-specific miRNA overexpressing adeno-associated virus vector as claimed in claim 6 or 7 in preparing a transgenic experimental animal model.

9. The use according to claim 8, characterized in that The central nervous system cell-specific miRNA expression vector is miRNA expression in astrocytes; The miRNA expression in astrocytes was used to prepare and validate the animal model for the treatment of cerebral hemorrhage.

10. Use of the central nervous system cell-specific miRNA overexpressing adeno-associated virus vector as claimed in claim 6 in the preparation of drugs for central nervous system neuroinflammation-related diseases.

Images