DNA (deoxyribonucleic acid) molecular marker related to rice germination stage flooding-resistant seedling gene haplotype

Abstract

The invention relates to the technical field of functional molecular markers, in particular to a DNA (deoxyribonucleic acid) molecular marker related to rice germination stage flooding-resistant seedling gene haplotype. The haplotype of the waterflooding-resistant seedling-forming gene OsTPP7 in the bud stage of the rice consists of SNP282722617, SNP282723164, SNP282723639, SNP282723858 and SNP282727202, and the haplotype of the waterflooding-resistant seedling-forming gene OsTPP7 in the bud stage of the rice consists of SNP282722617 When a corresponding basic group of the five SNPs is ACGCA, the five SNPs are favorable haplotype (Hap7) of the OsTPP7 gene, and the flooding resistance in the bud stage is high. The molecular marker provided by the invention can be used for haplotype analysis of the OsTPP7 gene with the flooding-resistant seedling-forming ability in the bud stage of different rice materials, breeding materials with the flooding-resistant ability in the bud stage of the rice are screened through the molecular marker, and compared with traditional phenotype screening, time and labor are saved, efficiency is high, and cost is saved; the method can be applied to molecular breeding, and the breeding efficiency is improved.

Description

Technical Field

[0001] The invention relates to the technical field of functional molecular markers, and in particular to a DNA molecular marker associated with a haplotype of a rice bud-stage flooding-tolerant seedling gene. Background Art

[0002] In recent years, my country's rice production has developed in the direction of scale, intensiveness and mechanization, and light and simplified cultivation such as machine transplanting and direct seeding has become a development trend. Among them, direct seeding has the advantages of light weight, high efficiency, water saving, labor saving, and mechanized operation, and the area has gradually increased. However, compared with transplanting, the field surface is uneven, potholes are waterlogged, and the seeds are in a flooded state during direct seeding, which is very easy to cause rotten buds, rotten roots, and rotten seedlings, making direct seeding rice face the problem of "difficulty in full seedlings". In addition, there are many weeds during direct seeding, which leads to the use of a large amount of herbicides, which not only increases production costs, but also may pollute the environment and affect the normal growth of the next crop due to excessive use of herbicides. Early flooding is an effective means of controlling weeds, and it can also reduce dependence on herbicides, and can also effectively prevent bird and rodent damage. However, flooding will cause hypoxia stress on rice seeds and cause anaerobic reactions, leading to rotten seeds, rotten buds, low germination rate, and other problems, which in turn affects the yield of direct seeding rice. However, there are significant differences in the ability of different rice varieties to withstand flooding and establish seedlings. The key to the seedling success rate of direct-seeded rice lies in cultivating and planting varieties that are resistant to flooding during the bud and seedling stages.

[0003] Rice seedling tolerance to flooding during the germination period is a complex trait controlled by multiple genes. Currently, multiple related QTLs have been located and multiple hypoxia-tolerant germination genes have been cloned, such as QTLs such as qAG1, qAG2, qGS-6-1, qGS-9-1 and qGS1, and genes such as OsGGT, OsGF14h, OsUGT75A, OsCBL1, OsTPP7, OsJAZ5 and OsSAUR33. Among them, OsTPP7 is located at the QTL (qAG1) on the long arm of rice Chr9, which plays a crucial role in the metabolism of trehalose-6-phosphate (T6P), regulating the balance between T6P and sucrose, affecting the carbohydrate flux from source tissues to sinking tissues, and thus controlling starch synthesis through the activity of a-amylase. Therefore, the fine-tuning of carbohydrate distribution by OsTPP7 helps the transport of sugars to the embryo and coleoptile, leading to successful seed germination, contributing to effective embryo elongation, and thus affecting the vigorous growth of seedlings in the early stage. However, despite a large number of studies on the function and regulation mechanism of the OsTPP7 gene in recent years, there are few reports on analyzing the favorable haplotypes of the OsTPP7 gene that determine flooding resistance at the bud stage and developing molecular markers for breeding applications.

[0004] At present, the identification and application of functional haplotypes have attracted people's attention as a promising haplotype breeding method. Therefore, it is of great significance to analyze and find favorable haplotypes of the OsTPP7 gene for bud-stage flooding tolerance seedling formation, develop molecular markers and apply them to the breeding of rice varieties suitable for direct seeding. Summary of the invention

[0005] In view of the above-mentioned deficiencies in the prior art, the purpose of the present invention is to provide a DNA molecular marker associated with the superior haplotype of the rice bud-stage flooding-tolerant seedling gene OsTPP7. This molecular marker can be used to create new rice germplasms that are flood-tolerant during the bud stage and cultivate new varieties through MAS (molecular marker-assisted breeding) technology.

[0006] In order to achieve the above-mentioned object of the invention, the technical solution adopted by the present invention is:

[0007] Provided is a DNA molecular marker related to the haplotype of a rice bud-stage flooding-tolerant seedling gene, wherein the haplotype of the rice bud-stage flooding-tolerant seedling gene OsTPP7 consists of SNP282722617, SNP282723164, SNP282723639, SNP282723858 and SNP282727202, wherein the SNP282722617 detection molecular marker is tpp7-1-kasp, which is used to distinguish between T or A base at position 12250067; the SNP282723164 detection molecular marker is tpp 7-2-kasp, used to distinguish the C or T base at position 12250614; the SNP282723639 detection molecule is marked as tpp7-3-kasp, used to distinguish the G or A base at position 12251089; the SNP282723858 detection molecule is marked as tpp7-4-kasp, used to distinguish the C or A base at position 12251308; the SNP282727202 detection molecule is marked as tpp7-5-kasp, used to distinguish the A or G base at position 12254652; or the complementary bases of the above SNP sites;

[0008] The detection primer sequences of molecular markers tpp7-1-kasp to tpp7-1-kasp are:

[0009] 1)tpp7-1-kasp

[0010] tpp7-1FAM:GAAGGTGACCAAGTTCATGCTCCTCTATTAGCAGTAATTTTTTTTTA,

[0011] tpp7-1HEX:GAAGGTCGGAGTCAACGGATTCCTCTATTAGCAGTAATTTTTTTTTT,

[0012] tpp7-1R:ACCGTTGTTCCGTGAGC;

[0013] 2)tpp7-2-kasp

[0014] tpp7-2FAM:GAAGGTGACCAAGTTCATGCTAACATGACTTGAGAAGCATACTAAC,tpp7-2HEX:GAAGGTCGGAGTCAACGGATTAACATGACTTGAGAAGCATACTAAT,tpp7-2R:CTATGTCGTTGGCTTCCTACAGATT;

[0015] 3)tpp7-3-kasp

[0016] tpp7-3FAM:GAAGGTGACCAAGTTCATGCTTTACAACTAGTTAACGTATATTCAC,

[0017] tpp7-3HEX:GAAGGTCGGAGTCAACGGATTTTACAACTAGTTAACGTATATTCAT,

[0018] tpp7-3R:ATATATCACTCCACAAACATGCAAG;

[0019] 4)tpp7-4-kasp

[0020] tpp7-4FAM:GAAGGTGACCAAGTTCATGCTTTGTTCTTCGCAAAAAAAAATG,

[0021] tpp7-4HEX:GAAGGTCGGAGTCAACGGATTTTGTTCTTCGCAAAAAAAAATT,

[0022] tpp7-4R:TCAAAATCCACTCCCCCTC;

[0023] 5)tpp7-5-kasp

[0024] tpp7-5FAM:GAAGGTGACCAAGTTCATGCTCAAGTTGGTTAATCGATGCTCGTTT,

[0025] tpp7-5HEX:GAAGGTCGGAGTCAACGGATTCAAGTTGGTTAATCGATGCTCGTTC,

[0026] tpp7-5R:CGACTCATTTAAGTAGATTGCAG.

[0027] Furthermore, the KASP molecular marker primer combination includes 2 specific primers and 1 universal primer; one of the specific primers is connected to a fluorescent label FAM at the 5′ end, and the product carrying the FAM sequence after PCR amplification appears orange under fluorescent irradiation; the other specific primer is connected to a fluorescent label HEX at the 5′ end, and the product carrying the HEX sequence after PCR amplification appears blue under fluorescent irradiation.

[0028] Further, the tpp7-1-kasp marker is detected at position 12250067, and the PCR product is subjected to fluorescence signal scanning. If the product shows orange after fluorescence irradiation, the genotype of the rice KASP marker tpp7-1-kasp to be tested is AA; if the product shows blue after fluorescence irradiation, the genotype of the rice KASP marker tpp7-1-kasp to be tested is TT; if the product shows superimposed colors after fluorescence irradiation, the genotype of the rice KASP marker tpp7-1-kasp to be tested is AT heterozygous;

[0029] The tpp7-2-kasp marker was detected at position 12250614, and the PCR product was scanned for fluorescence signals. If the product showed orange after fluorescence irradiation, the genotype of the rice KASP marker tpp7-2-kasp to be tested was CC; if the product showed blue after fluorescence irradiation, the genotype of the rice KASP marker tpp7-2-kasp to be tested was TT; if the product showed superimposed colors after fluorescence irradiation, the genotype of the rice KASP marker tpp7-2-kasp to be tested was CT heterozygous;

[0030] The tpp7-3-kasp marker was detected at position 12251089, and the PCR product was scanned for fluorescence signals. If the product showed orange after fluorescence irradiation, the genotype of the rice KASP marker tpp7-3-kasp to be tested was GG; if the product showed blue after fluorescence irradiation, the genotype of the rice KASP marker tpp7-3-kasp to be tested was AA; if the product showed superimposed colors after fluorescence irradiation, the genotype of the rice KASP marker tpp7-3-kasp to be tested was GA heterozygous;

[0031] The tpp7-4-kasp marker was detected at position 12251308, and the PCR product was scanned for fluorescence signals. If the product showed orange after fluorescence irradiation, the genotype of the rice KASP marker tpp7-4-kasp to be tested was CC; if the product showed blue after fluorescence irradiation, the genotype of the rice KASP marker tpp7-4-kasp to be tested was AA; if the product showed superimposed colors after fluorescence irradiation, the genotype of the rice KASP marker tpp7-4-kasp to be tested was CA heterozygous;

[0032] The tpp7-5-kasp marker was detected at position 12254652, and the PCR product was scanned for fluorescence signals. If the product showed orange after fluorescence irradiation, the genotype of the rice KASP marker tpp7-5-kasp to be tested was AA; if the product showed blue after fluorescence irradiation, the genotype of the rice KASP marker tpp7-5-kasp to be tested was GG; if the product showed superimposed colors after fluorescence irradiation, the genotype of the rice KASP marker tpp7-5-kasp to be tested was AG heterozygous.

[0033] Furthermore, when the bases detected by SNP282722617, SNP282723164, SNP282723639, SNP282723858, and SNP282727202 are TCGCA or the corresponding complementary bases, the haplotype is Hap1; when the bases detected by the above five SNPs are ATGCA or the corresponding complementary bases, the haplotype is Hap2; when the bases detected by the above five SNPs are TTGCA or the corresponding complementary bases, the haplotype is Hap ap3; when the detected bases of the above 5 SNPs are TCGAA or the corresponding complementary bases, the haplotype is Hap4; when the detected bases of the above 5 SNPs are TCGAA or the corresponding complementary bases, the haplotype is Hap5; when the detected bases of the above 5 SNPs are TCGCG or the corresponding complementary bases, the haplotype is Hap6; when the detected bases of the above 5 SNPs are ACGCA or the corresponding complementary bases, the haplotype is Hap7; among them, haplotype Hap7 has the strongest tolerance to flooding during the bud stage.

[0034] The beneficial effects of the present invention are:

[0035] The present invention provides a DNA molecular marker related to the haplotype of the rice bud-stage flooding-tolerant seedling gene. Using the KASP molecular marker corresponding to the five SNPs of the OsTPP7 gene developed by the present invention, a large number of germplasm resources and new breeding germplasms can be genotyped to determine the bud-stage flooding-tolerant materials carrying the excellent haplotype Hap7, which is more time-saving, labor-saving, efficient and cost-saving than traditional phenotypic screening; in addition, through hybridization, backcrossing and other technologies, MAS (molecular marker-assisted breeding) is used to track favorable SNPs, which can achieve directional improvement of breeding materials, improve the bud-stage flooding tolerance of backbone parent materials, and then cultivate new varieties of direct-seeded rice that are suitable for flooding-tolerant buds. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 The physical locations of the five SNPs of the OsTPP7 gene in the embodiment;

[0037] Figure 2 This is the linkage disequilibrium (LD) analysis of the five SNPs of the OsTPP7 gene in the 372 3K germplasms tested in the example;

[0038] Figure 3 The distribution of Hap1-Hap7 among different subspecies in the 372 3K germplasms tested in the example;

[0039] Figure 4 This is the difference analysis of the resistance to flooding during the budding period and the significance of the seedling formation of 372 3K germplasm Hap1-Hap7 materials tested in the example;

[0040] Figure 5 The distribution of Hap1-Hap7 among different subspecies in 2098 3K germplasms in the example;

[0041] Figure 6 The SNP typing results of the molecular markers tpp7-1-kasp to tpp7-5-kasp in the example;

[0042] Figure 7 The results of the significance analysis of the differences in the resistance to flooding at the bud stage and seedling formation of 42 rice parents (conventional rice) and 3 hybrid rice Hap1-Hap7 in the example. DETAILED DESCRIPTION

[0043] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0044] Example

[0045] (1) Phenotypic identification of flooding resistance of test materials. 529 materials of the 3K rice population, 42 rice parents (conventional rice) and 3 hybrid rice were placed in a constant temperature oven at 45°C for 2 days to reduce the water content and break dormancy. 500 seeds of each material were selected, treated with 1.5% (v / v) sodium hypochlorite solution for 20 minutes and washed with ultrapure water. After soaking for 2 days, the seeds were germinated in a constant temperature oven at 32°C for about 1 day. When the sprouts were about 5 mm long, 200 seeds with consistent germination were selected from each material, placed in a 50 ml centrifuge tube filled with sterile water, covered with a lid, and placed in a dark anaerobic flooding stress environment at 28°C for 7 days, with the water changed every 2 days. After the treatment, the seeds of each material were spread flat on a 9 cm diameter culture dish lined with filter paper, with 30 seeds in each dish, and repeated 3 times for each material. Water was added to make 1 / 2 volume of the seeds submerge the culture dish, and placed in a room temperature environment at 28°C under normal light to allow the rice sprouts to resume normal growth for 10 days, investigate the number of surviving seedlings, and calculate the seedling rate.

[0046] (2) Extraction of OsTPP7 gene SNP information. Log in to the National Rice Data Center Gene Bank (RiceData) to search for OsTPP7 gene information, Gene ID is LOC_Os09g20390, and use Gene ID to search for OsTPP7 gene sequence information (Rice Genome Annotation The positive strand sequence of OsTPP7 gene CDS region was 12251875~12254087; the genomic SNP information of rice 3K data (3024 germplasms) was downloaded (snp-seek.irri.org / _download.zul), and the SNP information of OsTPP7 gene CDS region and 2kb upstream and 1kb downstream of 529 3K germplasm resources used in the experiment was extracted by Plink software, and filtered. The filtering conditions were to delete SNPs with deletion rate>0.2, delete individuals with deletion rate>0.2, and remove SNPs with low MAF frequency (<0.05). After filtering, 372 3K germplasms used in the experiment remained; in the OsTPP7 genome Five SNP sites were obtained in the CDS region and the 2 kb upstream and 1 kb downstream intervals, namely 2250067 (SNP282722617, T / A), 12250614 (SNP282723164, C / T), 12251089 (SNP282723639, G / A), 12251308 (SNP282723858, C / A), and 12254652 (SNP282727202, A / G). Among them, 12250067, 12250614, 12251089, and 12251308 are the physical positions of four SNPs upstream of the OsTPP7 gene, and 12254652 is the physical position of one SNP downstream of the OsTPP7 gene ( Figure 1 ). The above conditions were also used to filter 3024 3K germplasm materials and SNPs, and after filtering, 2098 3K germplasms remained.

[0047] (3) Analysis of linkage disequilibrium (LD) of OsTPP7 gene SNPs. Plink, Tassel5, and R language software were used to convert genomic and phenotypic data formats. Haploview software was used to perform linkage disequilibrium (LD) analysis on the OsTPP7 gene CDS region and the five SNPs 2 kb upstream and 1 kb downstream of the filtered 372 3K germplasms and draw an LDBLOCK diagram. The D' values ​​of different SNPs were between 0.793 and 1.000, indicating that the linkage was strong. The physical distance between the two SNPs was between 219 and 4585 bp, which was close ( Figure 2 ).

[0048] (4) Haplotype analysis of the OsTPP7 gene. The geneHapR package of the R language was used to perform haplotype analysis on the five SNPs of the OsTPP7 gene in the 372 filtered 3K germplasms. The results showed that the 372 accessions were divided into 7 haplotypes, Hap1 accounted for 49.73%, of which indica accounted for 68.11% and japonica accounted for 29.73%, which was the main haplotype of OsTPP7 gene; Hap2 accounted for 16.40%, the main type was japonica, accounting for 68.85%, Aro accounted for 16.39%, Aus accounted for 9.84%; Hap3 accounted for 13.17%, the main rice types were japonica and Aus, accounting for more than 40% respectively; Hap4 to Hap7 accounted for 8.33%, 5.65%, 4.57% and 2.15% respectively, of which Hap4 was all indica, Hap7 was all japonica, Hap5 and Hap6 were mainly indica (Table 1, Figure 3 ). The seedling rate under waterlogging stress at the bud stage was Hap7 (48.00%) > Hap5 (23.16%) > Hap4 (22.30%) > Hap3 (21.57%) > Hap1 (21.40%) > Hap2 (16.80%) > Hap6 (12.34%); the significant difference analysis of the 7 haplotypes showed that there was no significant difference in the ability of haplotypes Hap1 to Hap6 to tolerate waterlogging at the bud stage, while the ability of Hap7 to tolerate waterlogging at the bud stage was significantly higher than that of Hap1 to Hap6, indicating that Hap7 is a favorable haplotype of the OsTPP7 gene, which can be used for molecular breeding applications such as the creation of new rice germplasm that tolerates waterlogging at the bud stage or the selection of new varieties ( Figure 4 ).

[0049] Table 1 Seven haplotypes of OsTPP7 gene

[0050]

[0051]

[0052] (5) Haplotype distribution of OsTPP7 gene. Haplotype analysis was performed on 7 SNPs of OsTPP7 gene in 2098 filtered 3K germplasms. The results showed that the haplotype proportions were Hap1 (46.81%) > Hap2 (17.30%) > Hap3 (10.25%) > Hap4 (9.06%) > Hap6 (8.48%) > Hap5 (6.39%) > Hap7 (1.72%); Hap1 was the main haplotype of the OsTPP7 gene, and the dominant haplotype Hap7 accounted for the least, and the main rice type was Temperate Japonica (Tej); the main rice types of Hap1 were Indica III and Tej, followed by Indica I and Indadx, and all rice types were distributed; the main rice types of Hap2 were Trj, the main rice types of Hap3 were Trj and Aus, the main rice types of Hap4 were Indica III, and the main rice types of Hap5 and Hap6 were IndicaIII and Indadx ( Figure 5 ). Hap1 is mainly distributed in North America, Europe and some areas of Asia. Hap2 is mainly distributed in North America, Europe, Asia and parts of Africa, among which the distribution is more concentrated in East Asia and Southeast Asia. Hap3 is mainly distributed in Western Europe, South Asia and East Asia. Hap4 is mainly distributed in Asia, Europe, Africa and parts of the Americas; it is particularly concentrated in East Asia and Southeast Asia, such as the eastern coastal areas of China and the Indian subcontinent; it is also widely distributed in western Europe and Central European countries; and in Africa, it is mainly concentrated in the northern Mediterranean coast and parts of sub-Saharan Africa. Hap5 is mainly distributed in Europe, western and central North America, most of Asia except the east, northern and southern Africa and parts of South America. Hap6 is mainly distributed in Asia, Europe, Africa and other regions, among which it is more concentrated in the eastern coastal areas of Asia. Hap7 is distributed in East Asia, Southeast Asia and parts of South Asia.

[0053] (6) Development of KASP molecular markers. KASP detection markers for five SNPs of the OsTPP7 gene were developed using Primer5 software (Table 2). The five KASP molecular marker primer combinations included two specific primers and one universal primer; one of the specific primers had a fluorescent label FAM connected to its 5′ end, and the product carrying the FAM sequence after PCR amplification would appear orange under fluorescent irradiation; the other specific primer had a fluorescent label HEX connected to its 5′ end, and the product carrying the HEX sequence after PCR amplification would appear blue under fluorescent irradiation. Among them, the detection molecular marker of SNP282722617 is tpp7-1-kasp, which is used to distinguish the T or A base at position 12250067. After PCR amplification, it will show orange (FAM) for AA type and blue (HEX) for TT type after fluorescence irradiation; the detection molecular marker of SNP282723164 is tpp7-2-kasp, which is used to distinguish the C or T base at position 12250614. After PCR amplification, it will show orange (FAM) for CC type and blue (HEX) for TT type after fluorescence irradiation; the detection molecular marker of SNP282723639 is tpp7-3-kasp, which is used to distinguish the C or T base at position 12251089 The SNP282723858 detection molecule marker is tpp7-4-kasp, which is used to distinguish the C or A base at position 12251308. After PCR amplification, it shows orange (FAM) for CC type and blue (HEX) for AA type. The SNP282727202 detection molecule marker is tpp7-5-kasp, which is used to distinguish the A or G base at position 12254652. After PCR amplification, it shows orange (FAM) for AA type and blue (HEX) for GG type. The five KASP molecular markers were used to perform genotyping on the five SNP loci of the test materials. The detection results of positions 2250067 (SNP282722617), 12250614 (SNP282723164), 12251089 (SNP282723639), 12251308 (SNP282723858), and 12254652 (SNP282727202) were haplotype Hap1 when TCGCA was detected, haplotype Hap2 when ATGCA was detected, haplotype Hap3 when TTGCA was detected, haplotype Hap4 when TCGAA was detected, haplotype Hap5 when TCGAA was detected, haplotype Hap6 when TCGCG was detected, and haplotype Hap7 when ACGCA was detected. Among them, Hap7 is a material with strong resistance to flooding at the bud stage.

[0054] Table 2 Five SNP molecular markers of OsTPP7 gene

[0055]

[0056] (7) Verification of the haplotype KASP molecular marker of the OsTPP7 gene. The DNA of the test materials was extracted by the CTAB method, and molecular marker verification was performed using three germplasms (3K materials) from Hap1 to Hap7 of the OsTPP7 gene haplotype analysis. PARMS 2X Master Mix was provided by Wuhan Jingpeptide Biotechnology Co., Ltd. PARMS2X Master Mix contains two fluorescent universal primers FAM and HEX. The FAM fluorescent sequence is GAAGGTGACCAAGTTCATGCT, and the HEX fluorescent sequence is GAAGGTCGGAGTCAACGGATT; the molecular marker tpp7-1-kasp to tpp7-5-kasp primers were synthesized by Beijing Qingke Xinye Biotechnology Co., Ltd. The PCR amplification system was 10 μL, and the system composition was PARMS2X Master Mix 5 μL, 10 μmol·L -1 0.15 μL of tpp7-FAM and tpp7-HEX primers, 0.4 μL of tpp7-R primer, 1 μL of DNA (concentration 10-100 ng), and 3.3 μL of ddH2O were used; amplification and fluorescence capture were performed using a BioRad CFX Maestro quantitative PCR instrument; the reaction procedure was 94°C pre-denaturation for 15 min; 94°C denaturation for 20 s, 65°C (-0.8°C per cycle) for 1 min, 10 cycles; 94°C denaturation for 20 s, 57°C annealing for 1 min, 30 cycles; 37°C fluorescence capture for 1 min. The KASP analysis results showed that the genotyping results of the molecular markers tpp7-1-kasp to tpp7-5-kasp were completely consistent with the SNP information of the test material (snp-seek.irri.org / _download.zul) ( Figure 6 , Table 3), indicating that the molecular markers tpp7-1-kasp to tpp7-5-kasp can be used for the molecular detection of 5 SNPs of the OsTPP7 gene.

[0057] Table 3 KASP typing results of 21 3K germplasm resources

[0058]

[0059] (8) Haplotype analysis of the OsTPP7 gene in 42 rice parents (conventional rice) and 3 hybrid rice. The molecular markers tpp7-1-kasp to tpp7-5-kasp were used to perform KASP typing on the five SNP loci of the 42 rice parents (conventional rice) and three hybrid rice. The 40 materials, including Minghui 63, Luohong 5A, and Huazhan, were clearly typed at the five SNP loci by KASP markers, and their haplotypes could be determined. The other five materials showed different heterozygous sites at the detected SNP loci or the genotype could not be determined, and their haplotypes could not be further determined (Table 4). Among them, 15 materials including Minghui 63, Fuxiangzhan and Luohong 5A were Hap1, and the average anaerobic germination seedling rates were between 0.00% and 26.67%; R900 and Yuanliangyou 592 were Hap2, and the average anaerobic germination seedling rates were 0.00% and 1.11%, respectively; Zhongzao 48, Yexiang 919 and R9311 were Hap4, and the average anaerobic germination seedling rates were 41.03% and 0.01%, respectively. .00% and 51.04%; 12 materials such as Taihui 808, Nongxiang 39, Yueteyouzhan, etc. were Hap5, and the average anaerobic germination seedling rate was between 0.00% and 71.43%; 8 japonica rice materials such as Ningxiangjing 9, Songxiangjing 1018, Jijing 88, etc. were Hap7, and the average anaerobic germination seedling rate was between 53.33% and 96.67%; while Hap3 and Hap6 were not detected. The significant difference analysis of the five haplotypes detected showed that the haplotype Hap7 had a significantly higher ability to tolerate flooding during the bud stage than the haplotypes Hap1, Hap2, Hap4 and Hap5, with an average seedling rate of 80.97% ( Figure 7 The above research results indicate that Hap7 is a favorable haplotype of the OsTPP7 gene, which can be used for molecular breeding such as molecular screening of rice seedling materials resistant to flooding at the bud stage, creation of new germplasm or breeding of new varieties.

[0060] Table 4 Haplotypes of OsTPP7 gene in 52 rice parents (conventional rice) and 3 hybrid rice

[0061]

[0062]

[0063] In summary, the present invention has studied the haplotype of the rice bud-stage flooding-tolerant gene OsTPP7 and found that the SNP mutations at positions 12250067, 12250614, 12251089, 12251308 in the upstream regulatory region of the OsTPP7 gene on rice Chr9, and at position 12254652 in the downstream regulatory region constitute 7 haplotypes, among which Hap7 (ACGCA) is an excellent haplotype of the OsTPP7 gene, which can significantly improve the rice bud-stage flooding-tolerant seedling-forming ability. The present invention has developed 5 KASP molecular markers to perform genotyping and haplotype analysis on 5 SNPs of the OsTPP7 gene, which can effectively detect and distinguish the excellent and non-excellent haplotypes of the OsTPP7 gene for the rice bud-stage flooding-tolerant seedling-forming ability, and by testing existing rice varieties, it is proved that the excellent haplotype material screened by the molecular marker has a significantly higher ability to tolerate flooding in the bud-stage than the non-excellent haplotype. Therefore, the molecular markers provided by the present invention can be used for the detection of excellent haplotypes of the OsTPP7 gene for rice seedling-forming ability resistant to flooding at the bud stage and molecular breeding, thereby improving breeding efficiency.

[0064] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the present invention can be implemented in other specific forms without departing from the spirit or essential features of the present invention. Therefore, the embodiments should be considered exemplary and non-restrictive in all respects, and the scope of the present invention is defined by the appended claims rather than the above description, and it is intended that all changes falling within the meaning and scope of the equivalent elements of the claims be included in the present invention.

[0065] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A DNA molecular marker associated with the haplotype of a rice bud-stage flooding-tolerant seedling gene, characterized in that: The haplotype of the rice bud-stage flooding tolerance gene OsTPP7 is composed of SNP282722617, SNP282723164, SNP282723639, SNP282723858 and SNP282727202. The molecular marker for SNP282722617 is tpp7-1-kasp, which is used to distinguish between T or A base at position 12250067; the molecular marker for SNP282723164 is tpp7-2-kasp, which is used to distinguish between T or A base at position 12250067. The 250614 C or T base; the SNP282723639 detection molecule marker is tpp7-3-kasp, which is used to distinguish the 12251089 G or A base; the SNP282723858 detection molecule marker is tpp7-4-kasp, which is used to distinguish the 12251308 C or A base; the SNP282727202 detection molecule marker is tpp7-5-kasp, which is used to distinguish the 12254652 A or G base; or the complementary bases of the above SNP sites; The detection primer sequences of molecular markers tpp7-1-kasp to tpp7-1-kasp are: 1)tpp7-1-kasp tpp7-1FAM:GAAGGTGACCAAGTTCATGCTCCTCTATTAGCAGTAATTTTTTTTTA, tpp7-1HEX:GAAGGTCGGAGTCAACGGATTCCTCTATTAGCAGTAATTTTTTTTTT, tpp7-1R:ACCGTTGTTCCGTGAGC; 2)tpp7-2-kasp tpp7-2FAM:GAAGGTGACCAAGTTCATGCTAACATGACTTGAGAAGCATACTAAC, tpp7-2HEX:GAAGGTCGGAGTCAACGGATTAACATGACTTGAGAAGCATACTAAT, tpp7-2R:CTATGTCGTTGGCTTCCTACAGATT; 3)tpp7-3-kasp tpp7-3FAM:GAAGGTGACCAAGTTCATGCTTTACAACTAGTTAACGTATATTCAC, tpp7-3HEX:GAAGGTCGGAGTCAACGGATTTTACAACTAGTTAACGTATATTCAT, tpp7-3R: ATATATCACTCCACAAACATGCAAG; 4)tpp7-4-kasp tpp7-4FAM:GAAGGTGACCAAGTTCATGCTTTGTTCTTCGCAAAAAAAAATG, tpp7-4HEX:GAAGGTCGGAGTCAACGGATTTTGTTCTTCGCAAAAAAAAATT, tpp7-4R:TCAAAATCCACTCCCCTC; 5)tpp7-5-kasp tpp7-5FAM:GAAGGTGACCAAGTTCATGCTCAAGTTGGTTAATCGATGCTCGTTT, tpp7-5HEX:GAAGGTCGGAGTCAACGGATTCAAGTTGGTTAATCGATGCTCGTTC, tpp7-5R:CGACTCATTTAAGTAGATTGCAG.

2. The DNA molecular marker associated with the haplotype of the rice bud-stage flooding tolerance seedling gene according to claim 1, characterized in that: The KASP molecular marker primer combination includes 2 specific primers and 1 universal primer; one of the specific primers is connected to a fluorescent label FAM at the 5′ end, and the product carrying the FAM sequence after PCR amplification will appear orange under fluorescent irradiation; the other specific primer is connected to a fluorescent label HEX at the 5′ end, and the product carrying the HEX sequence after PCR amplification will appear blue under fluorescent irradiation.

3. The DNA molecular marker associated with the haplotype of the rice bud-stage flooding tolerance seedling gene according to claim 2, characterized in that: The tpp7-1-kasp marker is detected at position 12250067, and the PCR product is scanned for fluorescence signals. If the product shows orange after fluorescence irradiation, the genotype of the rice KASP marker tpp7-1-kasp to be tested is AA; if the product shows blue after fluorescence irradiation, the genotype of the rice KASP marker tpp7-1-kasp to be tested is TT; if the product shows superimposed colors after fluorescence irradiation, the genotype of the rice KASP marker tpp7-1-kasp to be tested is AT heterozygous; The tpp7-2-kasp marker was detected at position 12250614, and the PCR product was scanned for fluorescence signals. If the product showed orange after fluorescence irradiation, the genotype of the rice KASP marker tpp7-2-kasp to be tested was CC; if the product showed blue after fluorescence irradiation, the genotype of the rice KASP marker tpp7-2-kasp to be tested was TT; if the product showed superimposed colors after fluorescence irradiation, the genotype of the rice KASP marker tpp7-2-kasp to be tested was CT heterozygous; The tpp7-3-kasp marker was detected at position 12251089, and the PCR product was scanned for fluorescence signals. If the product showed orange after fluorescence irradiation, the genotype of the rice KASP marker tpp7-3-kasp to be tested was GG; if the product showed blue after fluorescence irradiation, the genotype of the rice KASP marker tpp7-3-kasp to be tested was AA; if the product showed superimposed colors after fluorescence irradiation, the genotype of the rice KASP marker tpp7-3-kasp to be tested was GA heterozygous; The tpp7-4-kasp marker was detected at position 12251308, and the PCR product was scanned for fluorescence signals. If the product showed orange after fluorescence irradiation, the genotype of the rice KASP marker tpp7-4-kasp to be tested was CC; if the product showed blue after fluorescence irradiation, the genotype of the rice KASP marker tpp7-4-kasp to be tested was AA; if the product showed superimposed colors after fluorescence irradiation, the genotype of the rice KASP marker tpp7-4-kasp to be tested was CA heterozygous; The tpp7-5-kasp marker was detected at position 12254652, and the PCR product was scanned for fluorescence signals. If the product showed orange after fluorescence irradiation, the genotype of the rice KASP marker tpp7-5-kasp to be tested was AA; if the product showed blue after fluorescence irradiation, the genotype of the rice KASP marker tpp7-5-kasp to be tested was GG; if the product showed superimposed colors after fluorescence irradiation, the genotype of the rice KASP marker tpp7-5-kasp to be tested was AG heterozygous.

4. The DNA molecular marker associated with the haplotype of the rice bud-stage flooding tolerance seedling gene according to claim 3, characterized in that: When the bases detected by SNP282722617, SNP282723164, SNP282723639, SNP282723858, and SNP282727202 are TCGCA or the corresponding complementary bases, the haplotype is Hap1; when the bases detected by the above five SNPs are ATGCA or the corresponding complementary bases, the haplotype is Hap2; when the bases detected by the above five SNPs are TTGCA or the corresponding complementary bases, the haplotype is Hap 3; when the detected bases of the above 5 SNPs are TCGAA or the corresponding complementary bases, the haplotype is Hap4; when the detected bases of the above 5 SNPs are TCGAA or the corresponding complementary bases, the haplotype is Hap5; when the detected bases of the above 5 SNPs are TCGCG or the corresponding complementary bases, the haplotype is Hap6; when the detected bases of the above 5 SNPs are ACGCA or the corresponding complementary bases, the haplotype is Hap7; among them, haplotype Hap7 has the strongest tolerance to flooding during the bud stage.

Images