Indel molecular marker for identifying drought resistance of upland cotton and application of Indel molecular marker

Abstract

The invention belongs to the technical field of molecular markers and germplasm resource identification, and particularly relates to an Indel molecular marker for identifying upland cotton drought resistance and application of the Indel molecular marker. The Indel molecular marker is located at the 737th basic group of a nucleotide sequence as shown in SEQ ID NO.1, the genotype of the Indel molecular marker is G in the germplasm of the drought-resistant cotton, and the genotype of the Indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA in the germplasm of the sensitive drought cotton. The Indel molecular marker provided by the invention is closely linked with the drought resistance phenotype of upland cotton, can be used for efficiently and accurately identifying or assisting in identifying the drought resistance of to-be-detected cotton and effectively distinguishing drought-resistant and sensitive drought-resistant cotton germplasm, and provides an effective means and way for molecular marker-assisted selection of drought-resistant cotton and cultivation of new cotton germplasm resources.

Description

Technical Field

[0001] The invention relates to the technical field of molecular markers and germplasm resource identification, and in particular to Indel molecular markers for identifying drought resistance of upland cotton and applications thereof. Background Art

[0002] Cotton is one of the world's major cash crops, grown on a large scale in more than 30 countries. However, extreme environmental conditions (such as drought) can affect the growth, yield and fiber quality of cotton. Cotton is particularly sensitive to water shortage during the seedling, flowering and boll development stages. Therefore, it is particularly important to breed drought-resistant cotton varieties and reduce the damage caused by drought stress to the cotton industry.

[0003] Traditional cotton breeding relies on phenotypic trait selection, and the impact of the natural environment on the phenotype greatly limits the efficiency of selecting superior varieties. Compared with conventional breeding techniques, molecular marker-assisted selection breeding is not restricted by time and geographical factors, and the selection process is rapid and accurate. It has become the preferred option for identifying drought-resistant varieties, and its role in cotton breeding is becoming increasingly prominent. The development of molecular markers that are closely linked to genes related to regulating cotton drought resistance is an important prerequisite for achieving efficient assisted selection breeding.

[0004] Insertion-deletion (InDel) refers to the insertion or deletion of nucleotide fragments of different sizes in the sequence of the same site in the genome between closely related species or different individuals of the same species, that is, one or more bases are inserted or deleted at a certain site on a sequence compared to another homologous sequence. It is essentially a length polymorphism marker. InDel polymorphic molecular markers have the characteristics of wide distribution, high density, large number, good polymorphism, and strong stability in the genome, and are suitable for multiple species. Moreover, by using InDel polymorphic molecular markers to design primers for PCR amplification, based on the difference in the size of the amplified products, a large number of samples can be quickly tested, their genotypes can be accurately determined, and then the sample phenotypes can be distinguished, which is very suitable for molecular marker-assisted selection breeding.

[0005] At present, molecular markers for important cotton traits are mainly focused on the screening of molecular markers for yield, fiber quality, disease resistance, etc., while molecular markers for abiotic stress resistance are less studied, and there are few molecular markers closely linked to drought resistance genes, which limits the molecular marker-assisted screening of new drought-resistant varieties. Therefore, finding key genes related to drought resistance and developing specific Indel molecular markers are of great scientific significance and application value for building an assisted selection breeding system and realizing rapid identification and genetic improvement of drought-resistant cotton varieties. Summary of the invention

[0006] In view of the problems existing in the prior art, the present invention provides an Indel molecular marker for identifying drought resistance of upland cotton. The Indel molecular marker is closely linked to the drought resistance phenotype of upland cotton and can be used to efficiently and accurately identify or assist in identifying the drought resistance of the cotton to be tested, effectively distinguish drought-resistant and drought-sensitive cotton germplasm, and provide effective means and methods for assisting the selection of cotton drought-resistant materials and cultivating new cotton germplasm resources through molecular markers. Therefore, the present invention provides detection primers and kits for detecting the Indel molecular markers, and the application of the aforementioned detection primers and kits in the identification of cotton drought resistance. The present invention is specifically implemented through the following technical solutions:

[0007] The first aspect of the present invention provides a detection primer, which is used to detect the Indel molecular marker of drought resistance of upland cotton. The Indel molecular marker is located at the 737th base of the nucleotide sequence shown in SEQ ID NO.1. In drought-resistant cotton germplasm, the genotype of the Indel molecular marker is G, and in drought-sensitive cotton germplasm, the genotype of the Indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA.

[0008] Furthermore, the detection primers include an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2 or SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.3 or SEQ ID NO.5.

[0009] Furthermore, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.3.

[0010] A second aspect of the present invention provides a kit, which comprises the detection primers as described above.

[0011] Furthermore, the kit also includes TaqDNA polymerase, dNTPmix and buffer.

[0012] The third aspect of the present invention provides the use of the detection primers or the kit described above in the identification of drought resistance of upland cotton.

[0013] A fourth aspect of the present invention provides a method for identifying drought resistance of upland cotton, comprising the following steps:

[0014] Using the detection primers or the kit as described above, PCR amplification is performed on the genomic DNA of the upland cotton to be tested to obtain a PCR amplification product; detecting the genotype of the Indel molecular marker in the PCR amplification product, and judging the drought resistance of the upland cotton to be tested according to the genotype; wherein the Indel molecular marker is located at the 737th base of the nucleotide sequence shown in SEQ ID NO.1, and has two genotypes of G and GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA;

[0015] Judging the drought resistance of the upland cotton to be tested according to the genotype includes: when the genotype of the Indel molecular marker is G, the upland cotton to be tested is drought-resistant cotton germplasm; when the genotype of the Indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA, the upland cotton to be tested is drought-sensitive cotton germplasm.

[0016] Furthermore, the detection primers include an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2 or SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.3 or SEQ ID NO.5.

[0017] Furthermore, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.5; detecting the genotype of the Indel molecular marker in the PCR amplification product includes: detecting the sequence information of the PCR amplification product by sequencing, and analyzing the genotype of the Indel molecular marker based on the sequence information.

[0018] Furthermore, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.3; detecting the genotype of the Indel molecular marker in the PCR amplification product includes: when the PCR amplification product cannot specifically amplify a band or the amplified band pattern does not contain a 177bp band pattern, the genotype of the Indel molecular marker is G; when the PCR amplification product can specifically amplify a band and contains a 177bp band pattern, the genotype of the Indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA.

[0019] The advantages and positive effects of the present invention are:

[0020] The present invention finds that an Indel mutation in the upstream regulatory region of the GhMJ1156 gene is closely linked to the drought resistance phenotype based on whole genome association analysis, and the CIDT values ​​of the drought resistance phenotype corresponding to different haplotypes (or genotypes) of the Indel mutation site are extremely significantly different, and the genotype has a significant correlation and high consistency with the drought resistance phenotype. The drought resistance molecular marker developed by the Indel mutation can efficiently and accurately identify or assist in identifying the drought resistance of the cotton to be tested, effectively distinguish drought-resistant and drought-sensitive cotton germplasms, and provide effective means and ways for molecular marker-assisted selection breeding of cotton drought-resistant materials and cultivating new cotton germplasm resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0022] Figure 1 The figure is the correlation between the variation sites at the GhMJ1156 locus and the drought resistance phenotype in Example 1 of the present invention; wherein, Figure a is a Manhattan plot and a linkage disequilibrium block plot between the variation sites at different physical locations and the drought resistance phenotype, and Figure b is the distribution position of the Indel variation at the GhMJ1156 locus;

[0023] Figure 2 This is a statistical graph of the comprehensive drought resistance index corresponding to different haplotypes of Indel mutations at the GhMJ1156 locus of the natural population of upland cotton in Example 1 of the present invention;

[0024] Figure 3 The genotype and sequencing peak diagram of the Indel variation at the GhMJ1156 locus of drought-resistant and drought-sensitive cotton germplasms in Example 2 of the present invention; wherein, Figure a is the drought-sensitive cotton germplasm Junmian 1, and Figure b is the drought-resistant cotton germplasm Wankangmian 9;

[0025] Figure 4 The results of amplifying the Indel variation at the GhMJ1156 locus using different primers in Example 2 of the present invention are shown in Figure a; Figure a is a sequencing peak diagram of the product amplified using the primers shown in SEQ ID NO.4-5, and Figure b is an electrophoresis diagram of the product amplified using the primers shown in SEQ ID NO.2-3;

[0026] Figure 5 This is the electrophoresis diagram of the product of amplifying the natural cotton population using the primers shown in SEQ ID NO.2-3 in Example 3 of the present invention; wherein, Figure a is a drought-sensitive cotton material, and Figure b is a drought-resistant cotton material. DETAILED DESCRIPTION

[0027] In order to make the purpose, technical scheme and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with the examples. The equipment and reagents used in each embodiment and test example can be obtained from commercial sources unless otherwise specified. The specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0028] Based on the information contained in this application, it is easy for those skilled in the art to make various changes to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the defined process, properties or components, because these embodiments and other descriptions are only for illustrating specific aspects of the present invention. In fact, various changes that the technicians in this field or related fields can obviously make to the embodiments of the present invention are all covered within the scope of the appended claims.

[0029] In order to better understand the present invention but not to limit the scope of the present invention, all the numbers used in this application to express the amount, percentage, and other numerical values ​​should be understood as modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to the different ideal properties attempted to be obtained. Each numerical parameter should at least be regarded as obtained based on the reported significant figures and by conventional rounding methods.

[0030] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, specific embodiments of the present invention are described in detail below with reference to the accompanying drawings.

[0031] The present invention conducts a study on drought resistance candidate genes in 517 natural populations of cotton germplasms, takes Comprehensive index of drought tolerance (CIDT) as phenotypic data for evaluating drought resistance, and combines the above-mentioned germplasm resource resequencing data to perform genome-wide association analysis (GWAS), and screens out the GhMJ1156 gene of upland cotton. The gene is located in the drought quantitative trait locus (QTL) interval identified in the 517 natural populations of cotton. At the same time, it is found that an Indel mutation in the upstream regulatory region of the GhMJ1156 gene (located 922 bp upstream of the gene start codon) is closely linked to the drought resistance phenotype, and the CIDT values ​​corresponding to different haplotypes (or genotypes) of the site are extremely significantly different (p=0.0083), wherein the CITD value of cotton germplasm carrying haplotype G is significantly higher than that of cotton germplasm carrying haplotype GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA (47 bp).

[0032] The Indel mutation in the upstream regulatory region of the GhMJ1156 gene described above is located at the 113705237bp position of chromosome A06 of the upland cotton TM-1 reference genome "Ghirsutum_genome_HAU_v1.0" (based on the position of haplotype "G"). Compared with the reference genome, a genotype variation of G->GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA occurs, more specifically located at the 737th base of the GhMJ1156 locus (sequence see SEQ ID NO.1). In drought-resistant cotton germplasm, the genotype of the Indel molecular marker is G, and in drought-sensitive cotton germplasm, the genotype of the Indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA.

[0033] Further use of known drought-resistant materials and natural populations of upland cotton to verify the authenticity and reliability of molecular markers, etc., shows that the genotype of the Indel variant has a significant correlation and high consistency with the drought-resistant phenotype. Therefore, the Indel variant on the upstream regulatory region of the GhMJ1156 gene of the present invention can be independently developed as a drought-resistant molecular marker. By detecting the sequence information of the Indel molecular marker, the resistance or tolerance of upland cotton germplasm resources to arid environments can be efficiently and accurately predicted based on its genotype, which lays a theoretical foundation and scientific basis for cotton drought-resistant molecular marker-assisted breeding, and also provides effective means and approaches for accurate breeding of cotton drought-resistant materials and efficient improvement of target traits; and molecular marker genotype detection is not limited by environmental factors and breeding time, which is conducive to greatly improving selection efficiency and promoting breeding speed, and has far-reaching and significant significance for improving cotton drought resistance and promoting sustainable development of the industry.

[0034] An embodiment of the present invention provides a detection primer, which is used to detect the Indel molecular marker of drought resistance of upland cotton. The Indel molecular marker is located at the 737th base of the nucleotide sequence shown in SEQ ID NO.1. In drought-resistant cotton germplasm, the genotype of the Indel molecular marker is G, and in drought-sensitive cotton germplasm, the genotype of the Indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA.

[0035] The present invention utilizes detection primers to amplify a sequence containing a drought-resistant Indel molecular marker upstream of the GhMJ1156 gene, and then obtains the genotype of the molecular marker by analyzing the sequence information of the amplified product, so that the drought resistance of the cotton to be tested can be efficiently and accurately identified or assisted in identifying, and drought-resistant cotton germplasm and drought-sensitive cotton germplasm can be effectively distinguished, thus providing an effective means and approach for molecular marker-assisted selection breeding of cotton drought-resistant materials and cultivating new cotton germplasm resources.

[0036] Optionally, the detection primer includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2 or SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3 or SEQ ID NO.5. Specifically as follows:

[0037] F1: GGGGATATCAAAATTTTAATCCGTA (see SEQ ID NO. 2);

[0038] R1: CAAAGACAAGGAGCCAAAGAA (see SEQ ID NO. 3);

[0039] F2: GGCATTTGTTTCTTGAAAACC (see SEQ ID NO.4);

[0040] R2: CAAAGACAAGGAGCCAAAG (see SEQ ID NO. 5).

[0041] Preferably, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.3; or, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.5.

[0042] More preferably, the nucleotide sequence of the upstream primer is shown in SEQ ID NO. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 3. In the present invention, a partial sequence of the Indel molecular marker is designed in the upstream primer. When the sequence "GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA" is deleted, the binding ability of the upstream primer to the target sequence in the genome is weakened, thereby causing a significant reduction in amplification efficiency or failure to perform specific amplification. Therefore, after obtaining the PCR amplification product, electrophoresis detection is performed. When the PCR amplification product can specifically amplify a band and contains a 177bp band type, it can be judged that the cotton germplasm to be tested is drought-sensitive cotton germplasm; when the PCR amplification product cannot specifically amplify a band or the amplified band type does not contain a 177bp band type, the cotton germplasm to be tested is drought-resistant cotton germplasm.

[0043] The sequence corresponding to the 177bp band pattern of the present invention is preferably as shown in SEQ ID NO.6, specifically:

[0044] GGGGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGAGATATCAAA ATTTGAACCCAAATAATTTTTGGTGTAGAACTTTAACCATTGCTTCAAATAAAATGTTGACA ATAACATGTAATTATTAAGAAGCTTAAATGTTCAATTTTCTTTGGCTCCTTGTCTTTG.

[0045] Yet another embodiment of the present invention provides a kit, which includes the detection primers as described above.

[0046] The advantages of the kit over the prior art are the same as the advantages of the detection primers over the prior art as described above, and will not be repeated here.

[0047] Optionally, the kit further comprises a PCR amplification reagent. The present invention has no particular limitation on the source of the PCR amplification reagent, and any conventional commercial product in the art may be used.

[0048] In a typical embodiment, the PCR amplification reagents include Taq DNA polymerase, dNTP mix and buffer.

[0049] The present invention has no special limitation on the total amount of PCR amplification reagents and primers in the kit, and can be set according to the conventional requirements of the kit. Generally speaking, the concentration of the upstream primer and the downstream primer in the kit is preferably 10-20mM, more preferably 10mM, which is usually the mother solution concentration. The buffer reagent is preferably 10×Buffer.

[0050] Another embodiment of the present invention provides a use of the above-mentioned detection primers for detecting the Indel molecular marker for drought resistance of upland cotton or the above-mentioned kit in the identification of drought resistance of upland cotton.

[0051] Based on the same inventive concept as above, an embodiment of the present invention further provides a method for identifying drought resistance of upland cotton, comprising the following steps:

[0052] Using the detection primers or the kit described above to perform PCR amplification on the genomic DNA of the upland cotton to be tested, to obtain a PCR amplification product;

[0053] Detecting the genotype of the Indel molecular marker in the PCR amplification product, and judging the drought resistance of the tested upland cotton according to the genotype; wherein the Indel molecular marker is located at the 737th base of the nucleotide sequence shown in SEQ ID NO.1, and has two genotypes of G and GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA;

[0054] Judging the drought resistance of the upland cotton to be tested according to the genotype includes: when the genotype of the Indel molecular marker is G, the upland cotton to be tested is drought-resistant cotton germplasm; when the genotype of the Indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA, the upland cotton to be tested is drought-sensitive cotton germplasm.

[0055] Optionally, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2 or SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.3 or SEQ ID NO.5.

[0056] Preferably, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.5; detecting the genotype of the Indel molecular marker in the PCR amplification product comprises: detecting the sequence information of the PCR amplification product by sequencing, and analyzing the genotype of the Indel molecular marker according to the sequence information. .

[0057] Preferably, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3. At this time, detecting the genotype of the Indel molecular marker in the PCR amplification product includes: when the PCR amplification product cannot specifically amplify a band or the amplified band does not contain a 177bp band, the genotype of the Indel molecular marker is G, and when the PCR amplification product can specifically amplify a band and contains a 177bp band, the genotype of the Indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA. Based on this method, only two steps, PCR amplification and electrophoresis band detection, are required to achieve efficient differentiation of drought-resistant cotton germplasm and drought-sensitive cotton germplasm at the genotype level, which has the advantages of low cost, convenience, efficiency, and strong specificity.

[0058] The present invention does not specifically limit the method for extracting genomic DNA from the cotton germplasm to be tested, and any commonly used genomic DNA extraction method or genomic DNA extraction kit in the art may be used, such as the CTAB extraction method used in the embodiment of the present invention.

[0059] Optionally, the PCR amplification reaction system is 20 μL, including: 2.0 μL of 10× buffer, 0.4 μL of dNTP mix, 0.2 μL of Taq DNA polymerase, 1 μL of genomic DNA, 0.2 μL of upstream primer, 0.2 μL of downstream primer and 16 μL of sterile water; wherein, in the reaction system, the concentrations of the upstream primer and the downstream primer are 1-2 mM, and the concentration of the genomic DNA is 3.75-5 ng / μL.

[0060] Optionally, the reaction procedure of the PCR amplification includes: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 52-53°C for 30 s, extension at 70-72°C for 30 s, and 30 cycles; extension at 72°C for 5 min; preferably, the annealing temperature is 53°C.

[0061] The present invention is further described below in conjunction with specific examples. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as the conditions described in the Molecular Cloning Laboratory Guide (Fourth Edition) published by Cold Spring Harbor Laboratory, or usually under the conditions recommended by the manufacturer.

[0062] The cotton germplasm resources used in the following embodiments were selected from 517 natural populations of upland cotton including Xinjiang bred varieties. The aforementioned 517 natural population materials of upland cotton mainly come from different ecological cotton areas in my country, and a small part is foreign upland cotton varieties. They were planted at the experimental base of the Cotton Research Institute of Xinjiang Academy of Agricultural Sciences in Shihezi, northern Xinjiang in 2016 and 2017, and water irrigation restriction experiments were carried out. Eight traits including agronomic traits, fiber quality, and yield indicators were investigated throughout the growth period. The heritability of each trait was evaluated using experimental data from two years and two points, the impact of reducing water irrigation by 50% on cotton production was analyzed, and the correlation network between the traits was depicted through correlation analysis. 517 studies on natural populations of upland cotton have been published in the literature [1] "Li B, Tian Q, Wang X, Han B, Liu L, Kong X, Si A, Wang J, Lin Z, Zhang X, Yu Y, Yang X. Phenotypic plasticity and genetic variation of cotton yield and its related traits under water-limited conditions. Crop J, 2020, 8(6): 966-976" and the literature [2] "Li Baoqi, Analyzing the genetic basis of cotton response to drought based on field phenotypes and phenotypic platform image indicators, 2020".

[0063] Table 1 shows the information of upland cotton germplasm resources used in the present invention. The public can obtain relevant germplasm resources materials from the applicant, which can only be used to repeat the experiments of the present invention and cannot be used for other purposes.

[0064] Table 1 Information on the upland cotton germplasm resources used in the present invention

[0065]

[0066]

[0067] Example 1 Candidate gene association analysis based on natural variation of GhMJ1156 gene

[0068] The natural variation map of upland cotton was constructed using the publicly published resequencing data of 517 upland cotton materials (the original resequencing data were released in the SRA database of NCBI, with the project number PRJNA556955). The drought resistance phenotype of the 517 materials was evaluated by the comprehensive drought resistance index, and the whole genome association analysis was performed in combination with the resequencing data. The drought quantitative trait loci (QTL) segments associated with the comprehensive drought resistance index were identified, and the differentially expressed genes in the QTL segments were screened. The related genes were further functionally annotated, and the candidate gene GhMJ1156 (the gene number in the CottonFGD database is Ghir_A06G016360) was obtained. GhMJ1156 encodes a cell division cycle protein, and it was found that multiple variations in the GhMJ1156 locus (including the upstream sequence of the start codon of the GhMJ1156 gene) were significantly correlated with the comprehensive drought resistance index. Among them, the insertion / deletion of 47bp bases located in the upstream regulatory region of the candidate gene GhMJ1156 (922bp away from the start codon ATG) was significantly correlated with drought resistance-related phenotypes. At the same time, the 47bp Indel molecular marker was verified, and it was found that the drought-sensitive material did have the 47bp base insertion, while the drought-resistant material did not have this variation.

[0069] The calculation method of comprehensive index of drought tolerance (CIDT) is as follows:

[0070] CIDT=DRC(LP+LW+YPH+MV+FSBN+EFSBN) / (GP+SW+FL+FS+FE+PH+FFSH+FFSBN+EBN+PBN), where DRC is the ratio of drought treatment phenotypic value to control phenotypic value. There are 16 traits, each of which corresponds to a DRC value. Among them, the population average values ​​of lint percentage (LP), lint index (LW), seed cotton yield per hectare (YPH), micronaire value (MV), number of fruit branches (FSBN), and number of empty fruit branches (EFSBN) increased significantly under water restriction conditions (p<0.001), while the population average values ​​of growth period (GP), seed index (SW), fiber length (FL), fiber strength (FS), fiber elongation (FE), plant height (PH), fruit branch first node height (FFSH), fruit branch first node number (FFSBN), number of effective bolls per plant (EBN), and number of peripheral bolls (PBN) decreased significantly under water restriction conditions (p<0.001).

[0071] The specific analysis steps of this embodiment are as follows:

[0072] (1) The variation information between 113702474 bp and 113705928 bp of chromosome A06 in the natural variation map, i.e., the variation information of the GhMJ1156 locus (including the 2000 bp before the start codon of the GhMJ1156 gene), was obtained and summarized in Table 2. There are 27 variations in the GhMJ1156 locus, of which 23 variations are in the upstream regulatory region, including 11 Indel variations and 12 SNP variations; 3 SNP variations and 1 Indel variation are in the 5'UTR region of the gene.

[0073] Table 2 Variation sites at the GhMJ1156 locus in upland cotton

[0074]

[0075]

[0076] Note: The meanings of the categories in the table are as follows: Type: variant type; Pos: physical position in the genome; Ref: reference genotype; Alt: variant genotype; DisttoATG: physical distance from the start codon, negative values ​​indicate upstream of the start codon.

[0077] Reference genome: The Ghirsutum TM-1 genome was used as the reference genome. Its version is 'Ghirsutum_genome_HAU_v1.0', which can be obtained from the CottonFGD database at http: / / cotton.hzau.edu.cn / EN / Download.htm.

[0078] (2) The cotton materials were grouped according to different genotypes based on the variation information. For example, the SNP variation located at the 113702474bp position of chromosome A06 of the reference genome had two haplotypes, C and G, and its allele genotypes were CC, GG and CG. The comprehensive drought resistance index was used as the drought resistance phenotypic value for association analysis. The grouped t-test of drought resistance-related phenotypic values ​​was calculated. The p-value reflected the correlation between the variation and the phenotype after the t-test, and a significant threshold of less than 0.05 was used.

[0079] Figure 1 The correlation between the variation in different physical locations and the phenotypic values ​​of the integrated index of drought tolerance (CIDT) is shown; Figure 1As shown in Figure a, from top to bottom are the Manhattan plot and linkage disequilibrium block (LDBlock) between variant sites at different physical locations and drought resistance phenotypes; in the Manhattan plot, the horizontal axis is the physical position of the variant site on the reference genome, the vertical axis is -log(p), and p is the t test result; in the LDblock plot, the upper bar shows the relative physical position of the variant site in the reference genome, and the red square below indicates the LD value of different variant sites. The darker the square, the higher the LD value. Usually, a group of highly linked gene variants form a linkage disequilibrium block, and the variants in these blocks are usually inherited together. The results showed that 23 variants were significantly correlated with drought resistance-related phenotypic values, including an Indel variant. Figure 1 Figure b shows the distribution of the aforementioned Indel variants at the GhMJ1156 locus, located at 113705237bp on chromosome A06 of the reference genome of upland cotton TM-1. Compared with the reference genome, there is a G->G GATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA The underlined part is the insertion sequence.

[0080] (3) Since the regulatory region plays an important role in gene expression changes, linkage disequilibrium analysis also shows that there is a significant correlation between the Indel variation in the regulatory region of the GhMJ1156 gene and the drought resistance phenotype, the present invention selects the Indel variation to develop functional molecular markers. 517 natural cotton populations were grouped according to the two haplotypes of G and GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA, and the comprehensive drought resistance index corresponding to plants of different haplotypes was counted and used as the phenotypic value for group t-test; since the heterozygotes of these two haplotypes accounted for a very small proportion in natural samples, the heterozygous genotype was not included in the analysis.

[0081] Figure 2 The phenotypic data statistics of 517 cotton natural populations grouped according to different haplotypes of Indel mutation at position 113705237bp of chromosome A06 are shown, wherein the abscissa represents haplotype and the ordinate represents comprehensive drought resistance index CITD. It can be seen from the figure that different haplotypes of the Indel mutation are highly correlated with the drought resistance phenotype of cotton (p=0.0083), and the CITD values ​​of different haplotypes are extremely significantly different. The CITD value of cotton germplasm carrying haplotype G is significantly higher than that of cotton germplasm carrying haplotype GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA (47bp), indicating that the insertion of the 47bp base will weaken the tolerance of cotton to drought environment.

[0082] In summary, this embodiment develops a drought-resistant molecular marker for the Indel variation "G->GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA" in the upstream regulatory region of the GhMJ1156 gene of upland cotton. The Indel molecular marker is located at the 113705237bp position of chromosome A06 of the reference genome of upland cotton TM-1 "Ghirsutum_genome_HAU_v1.0" based on the position of the haplotype "G". The genotype in the drought-resistant cotton germplasm is G, and the genotype in the drought-sensitive cotton germplasm is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA.

[0083] Specifically, the nucleotide sequence containing the Indel variation is shown in SEQ ID NO.1, which is an excerpt from the regulatory sequence 1500bp upstream of the GhMJ1156 gene, and the haplotype "G" is located at the 737th base (shown in bold shade), and the nucleotide sequence of the haplotype "GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA" is obtained by replacing the 737th base "G" with "GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA".

[0084] Table 3 CDS sequence of GhMJ1156 gene in upland cotton and its upstream Indel molecular marker information

[0085]

[0086]

[0087] Example 2 Development of Molecular Marker Detection Primers Based on Indel Mutation in the Downstream Regulatory Region of Upland Cotton GhMJ1156 Gene

[0088] 1. Molecular marker authenticity verification

[0089] According to the material information and corresponding genotype information in the variation map of Example 1, one portion of each drought-resistant extreme material with genotypes of G and GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA at the 113705237bp position was selected. In this embodiment, natural populations Wankangmian9 and Junmian1 were used for molecular marker amplification. Wankangmian9 is a typical drought-resistant variety with a genotype of haplotype G, and Junmian1 is a drought-sensitive germplasm with a genotype of haplotype GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA. The main steps are as follows:

[0090] Primer design: According to the upstream regulatory sequence and marker position of GhMJ1156 in SEQ ID NO.1, PCR primers were designed. The nucleotide sequences (5'-3') of the upstream primer and the downstream primer are as follows:

[0091] F2: GGCATTTGTTTCTTGAAAACC (see SEQ ID NO.4);

[0092] R2: CAAAGACAAGGAGCCAAAG (see SEQ ID NO. 5).

[0093] Genomic DNA extraction: The genomic DNA of Wankangmian9 and Junmian1 materials was extracted by CTAB method. Specifically, 100 mg of fresh cotton leaves were added to 200 μL of extraction buffer, ground, added to 800 μL of CTAB lysis solution, lysed in a 65°C water bath for 30 minutes, added 800 μL of chloroform to the lysed sample, and the sample was turned over and mixed for 5 minutes to remove impurities such as pigments. After centrifugation at 12000 rpm for 10 minutes, the supernatant was transferred and mixed with an equal volume of -20°C pre-cooled isopropanol, placed at -20°C for precipitation for 2 hours, centrifuged at 12000 rpm for 1 minute, and the supernatant was discarded. The precipitate was rinsed with 1 mL of 75% ethanol, rinsed twice, 10 minutes each time, centrifuged and discarded the supernatant, the precipitate was placed at room temperature to dry naturally, and the DNA was dissolved with ddH2O. The extraction buffer composition is: 0.35M glucose, 0.1M Tris-HCl, 5mmol / L Na2EDTA, 2% (W / V) PVPK-30 and 0.1% (W / V) DIECA, pH 7.5, 0.2% β-mercaptoethanol is added before use. The CTAB lysis buffer composition is: 0.1M Tris-HCl, 1.4M NaCl, 0.02M Na2EDTA, 2% CTAB, 2% (W / V) PVPK-30 and 0.1% (W / V) DIECA, pH 8.0.

[0094] PCR amplification: 75-100ng genomic DNA is taken as a template for PCR amplification. The reaction system of PCR amplification is 20μL, including: 1μL genomic DNA, 2.0μL 10× buffer, 0.2μL upstream primer, 0.2μL downstream primer, 0.4μL dNTP mix, 0.2μL TaqDNA polymerase and 16μL sterile water; wherein, in the reaction system, the concentration of upstream primer and downstream primer is 1-2mM, and the concentration of genomic DNA is 3.75-5ng / μL. Optionally, the reaction procedure of the PCR amplification includes: 95℃ pre-denaturation for 5min; 95℃ denaturation for 30s, 53℃ annealing for 30s, 72℃ extension for 30s, 30 cycles; 72℃ extension for 5min.

[0095] Result detection: After PCR amplification using the upstream primers and downstream primers shown in SEQ ID NO.4 and SEQ ID NO.5, the PCR amplification product was sent to the company for Sanger sequencing to confirm the authenticity of the marked Indel in the sequence.

[0096] The results are as follows Figure 3 As shown, Figures a and b are the genotype information and sequencing peak diagrams of Junmian 1 and Wankangmian 9 respectively. Figure 3 It can be seen that the genotype of Wankangmian 9 at the physical position of 113705237bp is G (drought-resistant genotype); the genotype of Junmian 1 at the physical position of 113705237bp is (drought-sensitive genotype), which confirms the existence of Indel variation and can be used as a drought-resistance molecular marker to distinguish drought-resistant and drought-sensitive cotton germplasm.

[0097] 2. Design of PCR primer sequences

[0098] After confirming the authenticity of the marker, the marker primer sequence was designed. The upstream primer contained the Indel mutation at the physical position of 113705237bp ( GGATATCAAAATTTTAATCCGTA The underlined portion of the sequence is shown in Figure 1. The downstream primer is located downstream of the mutation site, and the target sequence amplification size is 177bp. The detection principle is that the cotton material containing the Indel molecular marker can amplify the target sequence, while the cotton material without the Indel molecular marker has no specific binding with the upstream primer, and its genome basically does not amplify or cannot amplify the band of the target size. Therefore, the presence or absence of the PCR amplification product and its band size can be used to conveniently determine whether the Indel molecular marker is contained, and then identify the cotton germplasm genotype. The nucleotide sequence (5'-3') of the marker primer is as follows:

[0099] F1: GG GGATATCAAAATTTTAATCCGTA (see SEQ ID NO.2);

[0100] R1: CAAAGACAAGGAGCCAAAGAA (see SEQ ID NO. 3);

[0101] Five copies of each of the two genotype cotton materials were selected for molecular marker amplification, and the PCR amplification system and amplification procedure were the same as above. The drought-sensitive materials were Chuanmian 30, Xinluzao 9, Xinluzao 32, Sumian 4 and Zhongmiansuo14, and the drought-resistant materials were Jihan 3, Emian 1, Xuzhou 142, Shanmian 401 and Xiaomian 1. PCR amplification and sequencing were performed using the upstream primers and downstream primers shown in SEQ ID NO.4 and SEQ ID NO.5 at the same time, confirming that the PCR molecular marker primer amplification results were consistent with the sequencing results.

[0102] The results are as follows Figure 4 As shown, Figure a is the sequencing result of the product amplified by PCR using SEQ ID NO.4 and SEQ ID NO.5, and Figure b is the electrophoresis result of the product amplified by PCR using SEQ ID NO.2 and SEQ ID NO.3. The results of Figure a and Figure b are consistent, indicating that the PCR molecular marker primers of the embodiment of the present invention are applicable, and the presence or absence of the PCR amplification product can be used to determine whether the Indel molecular marker is contained, thereby identifying or assisting in identifying the drought resistance of cotton.

[0103] The judgment rules for identifying drought resistance of cotton germplasm using molecular marker primers are as follows: when the target product of 177bp band type can be specifically amplified, the cotton to be tested is drought-sensitive cotton germplasm; when the band cannot be specifically amplified or the amplified band type does not contain 177bp band type, the cotton to be tested is drought-resistant cotton germplasm.

[0104] The sequence (5'-3') corresponding to the 177 bp band product amplified by the PCR primer pair composed of the upstream primer-2 and the downstream primer in this example is as follows:

[0105] GGGGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGAGATATCAAA ATTTGAACCCAAATAATTTTTGGTGTAGAACTTTAACCATTGCTTCAAATAAATGTTGACA ATAACATGTAATTATTAAGAAGCTTAAATGTTCAATTTTCTTTGGCTCCTTGTCTTTG (see SEQ ID NO. 6), the shaded portion is an Indel variation of 47 bp.

[0106] Example 3 Molecular marker validation at the natural population level

[0107] In this example, the molecular marker primers confirmed in Example 2 were used to select 44 drought-resistant materials and 44 drought-sensitive materials according to the CITD phenotypic data of the natural population, and genomic DNA was extracted. SEQ ID NO. 2 and SEQ ID NO. 3 were used as upstream and downstream primers for PCR amplification, and the PCR amplification system and amplification procedure were the same as in Example 2.

[0108] The electrophoresis of PCR amplification products is shown in Figure 5 , where Figure a is drought-sensitive material, Figure b is drought-resistant material, and the * mark in the figure indicates that the amplification is not obvious or non-specific. The results showed that 39 materials in the drought-sensitive materials could amplify bands, and 5 materials did not amplify obvious specific bands; 39 materials in the drought-resistant materials did not amplify obvious specific bands, and 5 materials amplified the target bands. The chi-square test found that the amplification efficiency between drought-resistant materials and drought-sensitive materials was significantly different, with a p value of 4.20E-13, confirming that the genotype of Indel variation in natural populations is significantly correlated with the drought resistance phenotypic traits of cotton.

[0109] In summary, the Indel variation provided by the present invention and the molecular marker primers developed based on the Indel variation can be used to detect cotton drought resistance, and can distinguish cotton drought-resistant and sensitive germplasm based on the electrophoretic band distribution of the amplified product, with high accuracy, and high consistency between the genotype and the phenotype, providing a convenient method for high-throughput screening of drought-resistant cotton varieties.

[0110] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A detection primer, characterized in that The detection primer is used to detect the Indel molecular marker of drought resistance of upland cotton. The Indel molecular marker is located at the 737th base of the nucleotide sequence shown in SEQ ID NO.

1. In drought-resistant cotton germplasm, the genotype of the Indel molecular marker is G, and in drought-sensitive cotton germplasm, the genotype of the Indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA.

2. The detection primer according to claim 1, characterized in that The detection primers include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown as SEQ ID NO.2 or SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.3 or SEQ ID NO.

5.

3. The detection primer according to claim 2, characterized in that The nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.

3.

4. A kit, characterized in that: The kit comprises the detection primer according to any one of claims 1 to 3.

5. The kit according to claim 4, characterized in that The kit also includes Taq DNA polymerase, dNTPmix and buffer.

6. Use of the detection primer according to any one of claims 1 to 3 or the kit according to any one of claims 4 to 5 in identifying drought resistance of upland cotton.

7. A method for identifying drought resistance of upland cotton, characterized in that: The following steps are involved: Using the detection primers described in any one of claims 1 to 3 or the kit described in any one of claims 4 to 5 to perform PCR amplification on the genomic DNA of the upland cotton to be tested, to obtain a PCR amplification product; Detecting the genotype of the Indel molecular marker in the PCR amplification product, and judging the drought resistance of the tested upland cotton according to the genotype; wherein the Indel molecular marker is located at the 737th base of the nucleotide sequence shown in SEQ ID NO.1, and has two genotypes of G and GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA; Judging the drought resistance of the upland cotton to be tested according to the genotype includes: when the genotype of the Indel molecular marker is G, the upland cotton to be tested is drought-resistant cotton germplasm; when the genotype of the Indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA, the upland cotton to be tested is drought-sensitive cotton germplasm.

8. The method for identifying drought resistance of upland cotton according to claim 7, characterized in that: The detection primers include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown as SEQ ID NO.2 or SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.3 or SEQ ID NO.

5.

9. The method for identifying drought resistance of upland cotton according to claim 8, characterized in that: The nucleotide sequence of the upstream primer is shown in SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.5; Detecting the genotype of the Indel molecular marker in the PCR amplification product includes: detecting the sequence information of the PCR amplification product by sequencing, and analyzing the genotype of the Indel molecular marker according to the sequence information.

10. The method for identifying drought resistance of upland cotton according to claim 8, characterized in that: The nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3; Detecting the genotype of the Indel molecular marker in the PCR amplification product includes: when the PCR amplification product cannot specifically amplify a band or the amplified band pattern does not contain a 177bp band pattern, the genotype of the Indel molecular marker is G; when the PCR amplification product can specifically amplify a band and contains a 177bp band pattern, the genotype of the Indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA.

Images