A molecular marker related to the freezing tolerance of pig sperm and application thereof

Abstract

The application provides a molecular marker related to the freezing tolerance of pig sperm, belongs to the field of pig genetic breeding, and is named g.21555606G>A, is located at a nucleotide site of 21555606bp of pig chromosome 18 in an international pig genome 11.1 version reference sequence, the base of the site is G or A, the g.21555606G>A is located in an intron region of a GRM8 gene, and corresponds to the 192th bp in a nucleotide sequence shown in SEQ ID NO:1. A superior genotype boar individual has better frozen sperm quality, so that the g.21555606G>A is applied to the genetic breeding of pigs, and the frozen sperm quality of a boar can be improved.

Description

Technical Field

[0001] This invention belongs to the field of pig genetics and breeding, and specifically relates to a molecular marker related to the cryoprotection of pig sperm and its application. Background Technology

[0002] Semen cryopreservation technology is widely used in the preservation of pig germplasm resources and the exchange of superior breeding pigs. For boars that have been selected and bred over decades and possess excellent economic traits, semen cryopreservation allows artificial insemination to be no longer limited by time and space, improving the utilization efficiency of superior boars and achieving greater genetic progress. However, during semen cryopreservation, low temperatures cause chemical and physical damage to sperm, potentially leading to poor semen quality. This manifests as decreased sperm motility, fertilization capacity, and litter size after thawing, severely impacting the preservation of pig germplasm resources and the sale of frozen semen products, thus hindering the industrialization of frozen semen production and breeding progress in pig farms.

[0003] Frozen semen quality is related to factors such as the individual genetics of the boar, feed nutrition, semen collection season, semen collection frequency, composition of cryoprotectants, and semen freezing procedures. Currently, most research on improving frozen semen quality focuses on optimizing cryoprotectant composition and improving the sperm freeze-thaw process. For example, adding sugars (Scutellaria baicalensis polysaccharides, sucrose), nanomaterials (nano-sized Rhodiola rosea polysaccharides, nano-selenium), and some non-permeable cryoprotectants (glycerol, dimethyl sulfoxide) to cryoprotectants can improve frozen semen quality to some extent. Improving the freezing rate and thawing temperature can further enhance sperm viability after thawing. However, these methods are limited to maintaining frozen semen quality at a comparable level to fresh semen quality and cannot fundamentally improve the quality of frozen semen from boars. Therefore, by screening individuals with different cryogenic tolerance, and from the perspective of individual boar genetics, identifying and determining genes and markers affecting the cryogenic tolerance of boar sperm at the molecular level, and then using molecular markers to screen superior boars with high sperm cryogenic tolerance, the quality of frozen semen from boars can be fundamentally improved.

[0004] Existing research mainly focuses on SNP genetic markers associated with boar semen motility, such as: (1) SNPs in the third exon of the CATSPER4 gene as genetic markers of boar semen quality traits (application publication number: CN109837347 A), the invention involves the association of SNPs in the third exon of the CATSPER4 gene with boar sperm density, sperm motility, and sperm abnormality rate; (2) Molecular genetic markers related to boar sperm abnormality rate and their application and acquisition methods (application publication number: CN 110144414 A), the invention involves a T>C mutation located at position 8647231bp on chromosome 3 of the pig, which is associated with boar sperm abnormality rate; (3) Molecular genetic markers related to linear motility of boar sperm and their application and acquisition methods (application publication number: CN 110195115). A), the invention relates to molecular markers related to linear sperm motility in boars, including the T>C mutation at position 136112947bp on chromosome 15, the A>G mutation at position 18505448bp on chromosome 3, and the C>T mutation at position 63272581bp on chromosome 11; (4) SNP markers related to the effective sperm count in boars and their acquisition methods and applications (application publication number: CN 110273007 A), the invention relates to 5 molecular markers related to the effective sperm count in boars, including ASGA0105629, H3GA0010032, ALGA0024878, WU_10.2_8_31060162 and WU_10.2_9_11535520; (5) a genetic marker for boar semen quality traits and its application (application publication number: CN (113215277A) The invention relates to the SNP genetic marker of the 7th exon of the SPAG6 gene and its association with the volume of boar semen, sperm density, sperm motility and sperm abnormality rate; (6) Molecular markers of C7H15orf39 gene SNPs associated with boar semen quality traits and their application (Publication No.: CN 113930521 A) The invention relates to a G>T base substitution at position 281 of the C7H15orf39 gene fragment, which causes Taq I-RFLP polymorphism, with individuals with the TT genotype showing the best sperm motility trait; (7) A molecular marker method associated with boar sperm abnormality rate trait (Publication No.: CN 115831220A), the invention utilizes the molecular marker of the A / G mutation at 163993991bp on chromosome 6 of pigs for marker-assisted selection, which can greatly accelerate the genetic improvement of the sperm abnormality rate of Duroc pigs; (8) SNP molecular markers, primer pairs and their applications in the ATP11A gene related to boar semen quality traits (application publication number: CN 116790764 A), the invention discloses an SNP molecular marker, primer pair and their applications in the ATP11A gene related to boar semen volume, sperm density and sperm motility traits.

[0005] Currently, most inventions focus on researching SNP genetic markers associated with the viability of fresh boar semen, including sperm density, motility, linear motility, and abnormality rate in fresh semen. However, there are few related inventions or technologies for exploring SNPs associated with the cryogenic tolerance of boar semen and improving the quality of frozen boar semen.

[0006] This invention is based on the applicant's research group's previous genome resequencing results of boars with cryogenic and non-cryosensitive sperm, and further analysis revealed a molecular marker affecting the cryogenic tolerance of boar sperm. Currently, no such results have been reported; therefore, the discovery of this marker has potentially significant value for the genetic improvement of cryogenic tolerance in boar sperm. Summary of the Invention

[0007] To address the problem of poor frozen semen quality in boars, this invention provides a molecular marker related to the cryogenic tolerance of boar sperm. This marker, named g.21555606G>A, is located in the intron region of the GRM8 gene. Boars with a dominant genotype exhibit superior frozen semen quality. Therefore, applying g.21555606G>A to pig genetic breeding can help improve the quality of frozen semen in boars.

[0008] This invention is achieved through the following technical solution:

[0009] This invention provides a molecular marker associated with the cryoprotective properties of porcine sperm. The molecular marker associated with the cryoprotective properties of porcine sperm is named g.21555606G>A, located at nucleotide position 21555606 bp on chromosome 18 of the international porcine genome version 11.1 reference sequence. The base at this position is G or A. The g.21555606G>A is located in the intron region of the GRM8 gene, corresponding to position 192 bp in the nucleotide sequence shown in SEQ ID NO:1.

[0010] The breed of pigs mentioned includes at least one of Duroc, Landrace, and Large White.

[0011] Based on the same inventive concept, this invention provides the application of molecular markers related to the cryoprotection of pig sperm in pig genetic breeding, wherein the pig genetic breeding is the genetic breeding of pig sperm cryoprotection;

[0012] Among them, the sperm of individuals with the AA genotype g.21555606G>A showed higher cryoprotection than that of individuals with the AG genotype; and the sperm of individuals with the AG genotype g.21555606G>A showed higher cryoprotection than that of individuals with the GG genotype.

[0013] Based on the same inventive concept, this invention provides an early selection method for the cryoprotective trait of porcine sperm, the early selection method comprising early selection of the cryoprotective trait of porcine sperm based on the genotype of the molecular marker g.21555606G>A;

[0014] The g.21555606G>A is located at the nucleotide site 21555606bp on chromosome 18 of the international pig genome version 11.1 reference sequence. The base at this site is G or A. The g.21555606G>A is located in the intron region of the GRM8 gene, corresponding to the 192nd bp position in the nucleotide sequence shown in SEQ ID NO:1.

[0015] Among them, the sperm of individuals with the AA genotype g.21555606G>A has higher cryoprotective properties than those of individuals with the AG genotype; the sperm of individuals with the AG genotype g.21555606G>A has higher cryoprotective properties than those of individuals with the GG genotype.

[0016] The breed of pigs mentioned includes at least one of Duroc, Landrace, and Large White.

[0017] Furthermore, the early selection method specifically includes:

[0018] Detect the genotype of the molecular marker g.21555606G>A in the genome of the pig to be tested;

[0019] Early selection of sperm freeze tolerance traits in pigs was carried out based on the g.21555606G>A genotype.

[0020] Furthermore, the detection of the genotype of the molecular marker g.21555606G>A in the genome of the pig to be tested specifically includes:

[0021] Using forward primer F1 and reverse primer R1 as primers, PCR amplification was performed on the genomic DNA of the pigs to be tested.

[0022] The PCR amplification products were sequenced to obtain the genotype of the 21555606 bp nucleotide site on chromosome 18 of the pig to be tested.

[0023] The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO.2; the nucleotide sequence of the reverse primer R1 is shown in SEQ ID NO.3.

[0024] Based on the same inventive concept, this invention provides the application of primers for detecting molecular markers related to porcine sperm cryoprotection in porcine genetic breeding. The molecular marker related to porcine sperm cryoprotection is named g.21555606G>A, located at nucleotide 21555606 bp on chromosome 18 of the international porcine genome version 11.1 reference sequence. The base at this site is G or A. The g.21555606G>A is located in the intron region of the GRM8 gene, corresponding to the 192nd bp position in the nucleotide sequence shown in SEQ ID NO:1.

[0025] The primers for detecting molecular markers related to porcine sperm cryoresistance include a forward primer F1 and a reverse primer R1, the nucleotide sequence of which is shown in SEQ ID NO.2; and the nucleotide sequence of which is shown in SEQ ID NO.3.

[0026] The pig genetic breeding mentioned refers to genetic breeding of pig sperm freeze tolerance:

[0027] Among them, the sperm of individuals with the AA genotype g.21555606G>A has higher cryoprotective properties than those of individuals with the AG genotype; the sperm of individuals with the AG genotype g.21555606G>A has higher cryoprotective properties than those of individuals with the GG genotype.

[0028] The breed of pigs mentioned includes at least one of Duroc, Landrace, and Large White.

[0029] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0030] This invention discloses a molecular marker related to the cryoprotective properties of boar sperm. The marker, named g.21555606G>A, is located in an intron region of the GRM8 gene, with the dominant genotype being AA. AA-type boars exhibit superior frozen semen quality. Therefore, applying g.21555606G>A to the genetic breeding of boars can assist in screening boars with high sperm cryoprotective properties, fundamentally improving the quality of frozen semen from boars, increasing the utilization rate of high-quality boars, and ultimately maximizing the economic benefits for pig farming enterprises. Attached Figure Description

[0031] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0032] Figure 1This is an agarose gel electrophoresis image of the PCR amplification products in step S2 of Example 4 of the present invention: where DL2000 is the marker, lanes 1-3 are the amplified fragments from pigs, and the fragment sizes are 371bp respectively.

[0033] Figure 2 This is the sequencing map of the g.21555606G>A site of the GRM8 gene in step S3 of embodiment 4 of the present invention. Detailed Implementation

[0034] The present invention will be described in detail below with reference to specific embodiments and examples, thereby making the advantages and various effects of the present invention more clearly apparent. Those skilled in the art should understand that these specific embodiments and examples are for illustrative purposes only and are not intended to limit the present invention.

[0035] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the event of any conflict, this specification shall prevail.

[0036] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0037] The overall concept of this invention is as follows:

[0038] Currently, most inventions focus on researching SNP genetic markers associated with the viability of fresh boar semen, including sperm density, motility, linear motility, and abnormality rate in fresh semen. However, there are few related inventions or technologies for exploring SNPs associated with the cryogenic tolerance of boar semen and improving the quality of frozen boar semen.

[0039] This invention addresses the technical problem of poor quality of frozen boar semen that cannot be solved in existing technologies. The purpose is to use biological detection technology to provide SNP genetic markers associated with the cryoprotectiveness of boar semen and their applications, thereby improving the quality of frozen boar semen and providing new marker resources for the assisted selection of boars.

[0040] Previously, genome resequencing was performed on 25 boars with cryopreserved sperm (frozen sperm recovery rate ≥70%) and 25 boars with non-cryopreserved sperm (frozen sperm recovery rate ≤50%). Using bioinformatics analysis, the fixation index (Fst) was calculated, revealing a 21,555,606 bp G / A mutation on chromosome 18. This mutation showed significant genetic differentiation between the cryopreserved and non-cryopreserved sperm groups, with an Fst of 0.38. The mutation site is located in the GRM8 gene (glutamate metabolism receptor 8), a protein-coding gene belonging to the G protein-coupled receptor family, and is associated with the inhibition of the cyclic AMP cascade. GRM8 has been shown to be closely related to sperm acrosome function; during spermatogenesis, GRM8 regulates cAMP and thus the acrosome response, playing a crucial role in sperm formation and maturation. Currently, there are no reports on whether this mutation site is related to sperm cryopreservation tolerance or whether it can be used as a molecular marker to improve the quality of frozen boar semen.

[0041] This invention analyzes and mines SNP genetic markers based on the genome resequencing data of 50 boars with high and low sperm cryoprotection. Further validation was performed on a population of 364 boars, increasing the accuracy and reliability of the GRM8 gene g.21555606G>A genetic marker associated with porcine sperm cryoprotection. This allows for biological detection of boar frozen semen quality at the molecular level, providing new genetic markers for assisted selection breeding of boars, screening for boars with high sperm cryoprotection, fundamentally improving the quality of frozen semen, increasing the utilization rate of high-quality boars, and ultimately maximizing the economic benefits for pig farming enterprises.

[0042] The following will provide a detailed description of a molecular marker related to the freeze resistance of porcine sperm, based on embodiments and experimental data.

[0043] Example 1

[0044] Obtaining the g.21555606G>A site of the GRM8 gene, a molecular marker for cryoprotection in porcine sperm.

[0045] 1. Collect boar semen and extract genomic DNA

[0046] Boars aged 1-3 years were selected, exhibiting robust physique and good reproductive performance. Before semen collection, collection cups, gloves, and bags were sterilized. The area around the penis was disinfected and cleaned with a low-concentration potassium permanganate solution, and the hair around the penis was trimmed. Semen was collected manually using the hand-holding method. The initial gelatinous semen was discarded during collection. Once the semen turned milky white, it was filtered through sterile membrane filter paper and collected in a collection cup containing a collection bag. Genomic DNA extraction from the boars was performed using the Invitrogen PureLink™ Pro96 Genomic DNA Purification Kit (K182104A). The extracted DNA was tested for concentration and quality and stored at -20°C for later use. Semen samples from a total of 364 boars were collected and genomic DNA was extracted.

[0047] 2. Collect sperm cryoprotection phenotype data

[0048] (1) Fresh sperm motility testing and semen cryopreservation

[0049] The beakers and glass rods used for semen dilution were sterilized in advance. The slides and coverslips were preheated to 37°C on the heating stage of the CASA sperm analyzer (Fuzhou Hongshiye). The diluent was also preheated to 37°C in a water bath. After collecting fresh semen, the temperatures of the semen and the frozen diluent were measured using an electronic thermometer. Once the temperatures were equal, 0.1 mL of fresh semen was added to 0.9 mL of the preheated diluent at a 1:9 ratio. After gently inverting to mix, 5 μL was added to a glass slide, covered, and the sperm density and motility were measured using the CASA sperm analyzer. This data represents the sperm motility of fresh bovine semen and was recorded. After passing microscopic examination, the remaining semen was added to the preheated frozen diluent at a 1:1 ratio, gently mixed, and then incubated at 25°C for approximately 1 hour.

[0050] After settling, gently agitate the semen to prevent sperm from becoming suspended in place. Then, place the semen in a programmed cooling system (Beijing Tianyuan Aorui) and set the cooling program to slowly lower the temperature to 17°C over 1-2 hours. After cooling, centrifuge at 800g / min for 10-15 minutes at 17°C to remove the supernatant. Resuspend the sperm in pre-cooled cryogenic basal solution I (Beijing Tianyuan Aorui) to achieve a sperm density of 2 billion / mL. Then, place the semen in a programmed cooling system (Beijing Tianyuan Aorui) to slowly cool to equilibrate over 2.5-3.0 hours to 4°C and equilibrate at 4°C for 0.5-1.0 hours. After equilibration, add cryogenic basal solution II (Beijing Tianyuan Aorui), mix well, and immediately place the semen in a low-temperature operating cabinet (Germany Mini itube) using a semen filling machine (Germany Min itube). The process involves filling the semen capillaries with a microtube (itube); then, following the technical requirements of the programmed cryostat (Beijing Tianyuan Aorui), the cryostat is activated to lower the chamber temperature to 4-5°C. The filled semen capillaries are then placed in the cryostat and the semen capillaries cryostat reference program is called for cooling. The specific program is as follows: 4°C, constant temperature pre-cooling; 1°C, cooling for 1.5 min, rate -2°C / min; -26°C, cooling for 2.4 min, rate -30°C / min; -140°C, cooling for 6.2 min, rate -30°C / min; -140°C, constant temperature for 21.2 min; and then the contents are transferred to a liquid nitrogen tank.

[0051] (2) Semen thawing and frozen sperm motility testing

[0052] Frozen capillary tubes were thawed in a 50°C water bath for 16 seconds. Both ends of the capillary tubes were cut off, and the semen was transferred into 15mL centrifuge tubes. The tubes were diluted with thawing buffer preheated to 37°C at a ratio of 1:8. After restoring at 37°C for 15-20 minutes, the sperm motility was tested under a CASA microscope. At least three capillary tubes were taken from each individual for thawing, and each capillary tube underwent at least three motility tests.

[0053] (3) Screening for individuals with extreme sperm cryoprotection

[0054] Following the steps outlined above, the semen motility of 364 boars was tested for both fresh and frozen semen. The frozen semen recovery rate was used to reflect the sperm's cryogenic tolerance phenotype, as shown in the following formula:

[0055]

[0056] Where, x i Y represents the frozen sperm recovery rate of the i-th individual. i For the frozen sperm motility of the i-th individual, X i Let be the fresh sperm vitality of the i-th individual.

[0057] To eliminate the influence of different test batches on sperm motility test results, the Z-score method was used to standardize sperm motility, as shown in the following formula:

[0058]

[0059] Among them, Z i Let x represent the standardized score of the frozen sperm recovery rate of the i-th individual. i Let μ represent the frozen sperm recovery rate of the i-th individual, μ represent the mean frozen sperm recovery rate of all individuals in each batch, and σ represent the standard deviation of the frozen sperm recovery rate of all individuals in each batch. The formula for σ is as follows:

[0060]

[0061] Where σ represents the standard deviation of the frozen sperm recovery rate for all individuals, N is the number of individuals, and x i Let be the recovery rate of the frozen sperm of the i-th individual, and μ represent the average recovery rate of the frozen sperm of all individuals in each batch.

[0062] The 364 individuals were sorted according to their Z-scores. The top 25 individuals with high Z-scores were selected as the sperm cryopreservation group, indicating a high sperm recovery rate. The bottom 25 individuals with low Z-scores were selected as the sperm cryopreservation intolerant group, indicating a low sperm recovery rate.

[0063] 3. Discovering molecular markers related to sperm cryoprotection based on genome resequencing

[0064] (1) Genome resequencing

[0065] Following the standard library construction procedure of the TruSeq DNA PCR-free prep kit from Illumina, genomic resequencing libraries were constructed from the genomic DNA of 50 pigs in the sperm cryoprotective and sperm non-cryoprotective groups. The raw sequencing data were obtained by performing 10× depth resequencing on the Novaseq-PE150 platform.

[0066] (2) Raw data processing

[0067] Using the fastp (v0.20.0) program, the raw data were filtered under the following conditions: 3' end adapter contamination was removed; a sliding window method was used for quality filtering, with a window size of 5 bp and a step size of 1 bp. Moving forward one base at a time, the average Q value of the window was calculated over 5 bases. If the Q value of the last base was ≤2, only the bases before that position were retained; if the average Q value of the window was ≤20, only the second-to-last base and the bases before that position were retained; if the length of any read in the paired-end region was ≤50 bp, that paired-end read was removed. The results showed that 3.2 billion high-quality reads were obtained from 20 individuals. Using BWA software, these were aligned to the Sus Scrofa 11.1 reference genome, with an average alignment rate of 99.31% and an average sequencing coverage depth of 7.13 (6.45-7.90).

[0068] (3) Genomic variation analysis and calculation of genetic differentiation index between the cryogenically resistant and non-cryoresistant sperm groups

[0069] For the resequencing data of 50 pig genomes, SNP mining was performed using Samtoo ls software, yielding a total of 26,323,490 high-quality SNPs. To obtain molecular markers related to sperm cryoprotection, population genetic differentiation degree Fst analysis was performed based on SNP genotype information. Fst represents the degree of genetic differentiation between subpopulations within a population, with Fst values ​​generally ranging from 0 to 1. A smaller Fst value indicates less genetic differentiation between subpopulations; a value of 0 indicates that all individuals within two subpopulations can freely interbreed, representing the lowest degree of genetic differentiation. A larger Fst value indicates greater genetic differentiation between subpopulations; a value of 1 indicates that two subpopulations do not share any genetic diversity.

[0070] The distribution of θπ (θπ, cryoresistant group / non-cryoresistant group) and Fst values ​​was used to detect regions in the genome that were subject to significant selective clearance. Regions with extremely low or high θπ ratios (1% left tail and 1% right tail) and significantly high Fst values ​​(i.e., the portion where Fst accounts for the top 1%) were selected as regions subject to strong selective clearance.

[0071] (4) Screening for sperm cryoprotection using the GRM8 gene (g.21555606G>A molecular marker).

[0072] Based on the above analysis, a total of 150,217 SNPs were identified and annotated into 5,632 genes. To further screen for molecular markers related to sperm cryoprotection, the above genes were subjected to the following functional analysis and filtering: Comparison with the International Mouse Phenotyping Association (IMPC) database revealed 709 genes potentially related to sperm function, of which 209 genes were shared by two or three breeds. GO analysis showed that these genes were mainly enriched in pathways such as spermatogenesis and sperm development. Through literature indexing and gene haplotype analysis, the GRM8 gene g.21555606G>A molecular marker was finally identified as being associated with sperm cryoprotection.

[0073] Example 2

[0074] Detection of polymorphic distribution of the GRM8 gene g.21555606G>A genetic marker in pigs.

[0075] In this embodiment, the polymorphism distribution of the GRM8 gene g.21555606G>A molecular marker was detected in 364 boars. The detection results are shown in Table 1.

[0076] Table 1. Genotype and gene frequencies of the GRM8 gene locus g.21555606G>A.

[0077]

[0078] As shown in Table 1, the GRM8 gene g.21555606G>A locus in boars exhibits three genotypes: GG, GA, and AA. Among them, the GG genotype is more common, and the frequency of the G allele is 79%.

[0079] Example 3

[0080] Association analysis of the GRM8 gene g.21555606G>A molecular marker with the cryoprotectiveness of boar sperm.

[0081] This embodiment aims to determine the association between the g.21555606G>A locus and the cryopreservation tolerance of boar sperm. Polymorphism was detected in 364 boar populations, and the correlation between different genotypes of this polymorphic locus and the frozen sperm recovery rate was analyzed. Analysis of variance for different SNP genotype combinations was performed using SPSS statistical analysis software (IBM SPSS Statistics 26) GLM program, and significance tests were conducted. The model used is as follows:

[0082] y = μ + G + B + T + e

[0083] ijkl ijk ijkl

[0084] Among them, y ijkl The recovery rate is the measured value, μ represents the population mean, and G...i Represents genotype effect, B j Representative variety effect, T k Represents the batch effect, e ijkl This represents a random effect.

[0085] Association analysis was conducted on different genotypes and the recovery rate of frozen semen in boars. The statistical results are shown in Table 2.

[0086] Table 2. Association analysis between the GRM8 gene g.21555606G>A site and the recovery rate of frozen semen in boars.

[0087]

[0088] In Table 2, the trait means are all composed of mean ± standard error, and different superscript letters indicate significant differences (P<0.05).

[0089] As shown in Table 2, the frozen semen recovery rate of boars with the AA genotype at the g.21555606G>A locus of the GRM8 gene was significantly higher than that of boars with the GG genotype (P<0.05).

[0090] Example 4

[0091] The application of the GRM8 gene g.21555606G>A molecular marker in the screening of sperm freeze-resistant boars includes the following steps:

[0092] Step S1: Collect ear tissue samples from the boars to be tested, and perform DNA extraction and quality testing;

[0093] Step S2: PCR amplification was performed using forward primer F1 and reverse primer R1 to obtain and purify the PCR amplification product. The PCR reaction system was 40 μL, and the components were: 1 μL genomic DNA, 20 μL PCR mix, 2 μL each of the forward and reverse primers, and ddH2O added to bring the total volume to 40 μL. The PCR program was as follows: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 60℃ annealing for 10 s, 72℃ extension for 15 s, 35 cycles; 72℃ extension for 2 min; storage at 4℃. The agarose gel electrophoresis image of the PCR amplification product is shown below. Figure 1 As shown.

[0094] Step S3: Sequencing was performed on a portion of the purified PCR product. The genotype at position 192 bp was analyzed, and the sequencing map of the g.21555606G>A site was as follows. Figure 2 As shown, individuals with the AA genotype are preferentially retained, individuals with the GG genotype are preferentially eliminated, and individuals with the GA genotype are selected to be retained.

[0095] The GRM8 gene g.21555606G>A molecular marker is significantly associated with boar reproductive traits, especially the recovery rate of frozen semen, with the AA genotype being the dominant genotype. Therefore, this molecular marker can be used to assist in the selection of AA individuals with good reproductive performance, which is beneficial to improving the production performance of the herd, increasing the utilization rate of high-quality breeding boars, and maximizing the economic benefits of pig farming enterprises.

[0096] In this invention, the specific sequences of SEQ ID NO:1 to 3 are as follows:

[0097] The nucleotide sequence shown in SEQ ID NO:1:

[0098] AAAGCTGCCTAACATGGCACCTGGCGCAAAACAGCAGCTTCTAAAAGACATTTTAGTATGTATGTACTCAGCAGAAGTGATCTTGCTCTTTCTCCCCCAAGGGTTACTCTGTACCATGCTAATGCCATGTCTCTTACTATTTTTTCTTTATTTTGATAAATAGTATTTGTGTCATCCTTTCTAAATAAAG G ATAGTTGTTGAAGTCACAGACCCTTGCTCATAGTATGTATGTTTTTATTTGTCTAAAAATATATGACGTGAGACTTCCCATTTCCATTTCTGAAGATAAGGAGCTTGGAAGTCTTCACCCTGCTCTAACAAGTAAAATGCTAAACAGACTGAAACATCAACAATACTGCTGCATGCCCT;

[0099] The forward primer F1 shown in SEQ ID NO:2 is: AAAGCTGCCTAACATGGCAC;

[0100] The reverse primer R1 shown in SEQ ID NO:3 is AGGGCATGCAGCAGTATTGT.

[0101] In SEQ ID NO:1, the bolded and underlined site is the g.21555606G>A site of this invention.

[0102] Finally, it should be noted that the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0103] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0104] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. Use of a molecular marker associated with the cryotolerance of pig sperm in the genetic breeding of pigs, characterized in that, The molecular marker related to the sperm freezing tolerance of the pig is named g.21555606G>A, which is located at the nucleotide site of 21555606bp on the pig chromosome 18 in the international pig genome reference sequence version 11.1, the base of the site is G or A, the g.21555606G>A is located in the intron region of the GRM8 gene, and corresponds to the 192th bp in the nucleotide sequence shown in SEQ ID NO:1; The pig genetic breeding is genetic breeding of the pig on sperm freezing tolerance; The sperm freezing tolerance of the AA genotype individual of the g.21555606G>A is higher than that of the AG genotype individual; and the sperm freezing tolerance of the AG genotype individual of the g.21555606G>A is higher than that of the GG genotype individual; The breed of the pig is at least one of Duroc pig, Landrace pig and Large White pig.

2. A method for early selection of the cryotolerance trait of porcine spermatozoa, characterized in that, The early selection method comprises early selection of the sperm freezing tolerance trait of the pig based on the genotype of the molecular marker g.21555606G>A; The g.21555606G>A is located at the nucleotide site of 21555606bp on the pig chromosome 18 in the international pig genome reference sequence version 11.1, the base of the site is G or A, the g.21555606G>A is located in the intron region of the GRM8 gene, and corresponds to the 192th bp in the nucleotide sequence shown in SEQ ID NO:1; The sperm freezing tolerance of the AA genotype individual of the g.21555606G>A is higher than that of the AG genotype individual; and the sperm freezing tolerance of the AG genotype individual of the g.21555606G>A is higher than that of the GG genotype individual; The breed of the pig is at least one of Duroc pig, Landrace pig and Large White pig.

3. A method for early selection of a cryotolerance trait in pig sperm according to claim 2, characterized in that, The early selection method specifically comprises: Detecting the genotype of the molecular marker g.21555606G>A in the genome of the pig to be tested; Early selection of the sperm freezing tolerance trait of the pig to be tested based on the genotype of the g.21555606G>A.

4. A method for early selection of a cryotolerance trait in pig sperm according to claim 3, characterized in that, The detection of the genotype of the molecular marker g.21555606G>A in the genome of the pig to be tested specifically comprises: PCR amplification of the genomic DNA of the pig to be tested by using a forward primer F1 and a reverse primer R1 as primers; Sequencing the PCR amplification product to obtain the genotype of the pig to be tested at the nucleotide site of 21555606bp on chromosome 18; The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO.2; and the nucleotide sequence of the reverse primer R1 is shown in SEQ ID NO.

3.

5. Use of a molecular marker associated with the cryotolerance of pig sperm in pig genetic breeding, characterized in that, The molecular marker related to the sperm freezing tolerance of the pig is named g.21555606G>A, which is located at the nucleotide site of 21555606bp on the pig chromosome 18 in the international pig genome reference sequence version 11.1, the base of the site is G or A, the g.21555606G>A is located in the intron region of the GRM8 gene, and corresponds to the 192th bp in the nucleotide sequence shown in SEQ ID NO:1; The primer for detecting the molecular marker related to the freezing tolerance of the pig sperm is a forward primer F1, and a reverse primer R1, wherein a nucleotide sequence of the forward primer F1 is shown as SEQ ID NO. 2; and a nucleotide sequence of the reverse primer R1 is shown as SEQ ID NO. 3; The pig genetic breeding is genetic breeding of the pig on the freezing tolerance of the sperm; The freezing tolerance of the AA genotype individual of g.21555606G>A is higher than that of the AG genotype individual; and the freezing tolerance of the AG genotype individual of g.21555606G>A is higher than that of the GG genotype individual; The breed of the pig is at least one of Duroc pig, Landrace pig and Large White pig.

Images