A SNP molecular marker related to the out-meat rate trait of procambarus clarkii and application thereof

By screening SNP molecular markers through genome-wide association analysis and combining them with PCR amplification technology to detect the meat yield trait of Procambarus clarkii, the problem of insufficient research on meat yield trait of Procambarus clarkii in existing technologies has been solved, and efficient breeding results have been achieved.

CN119570951BActive Publication Date: 2026-06-23SHANGHAI OCEAN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHANGHAI OCEAN UNIV
Filing Date
2025-01-20
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

There are few existing studies on molecular markers for meat yield traits in red swamp crayfish, which cannot meet the needs of high-quality and high-efficiency breeding.

Method used

Ten SNP molecular markers, SNP1 to SNP10, were screened through genome-wide association analysis to detect the meat yield trait of Procambarus clarkii. Genotyping was performed using PCR amplification technology to select individuals with high meat yield for breeding.

Benefits of technology

This significantly improves the breeding efficiency and accuracy of Procambarus clarkii, enabling the breeding of high-yield and high-quality new varieties to meet the needs of high-quality and high-efficiency breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119570951B_ABST
    Figure CN119570951B_ABST
Patent Text Reader

Abstract

The application discloses a SNP molecular marker related to a Procambarus clarkii meat yield character and application thereof, and relates to the following steps: genotyping P. clarkii through whole genome association analysis, performing whole genome association analysis on the meat yield of P. clarkii, and screening out SNP markers significantly related to the meat yield character, including one or more of SNPs 1-SNPs 10. In the application, the P. clarkii with high growth speed and high meat yield can be effectively predicted and selected by detecting the above-mentioned SNP markers, the selection efficiency and accuracy of the P. clarkii are significantly improved, and a new P. clarkii variety with high yield and high quality is selected, so that the application has a wide application prospect in the molecular breeding of the meat yield character of the P. clarkii.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular marker-assisted breeding technology for aquatic animals, and specifically relates to an SNP molecular marker related to the meat yield trait of Procambarus clarkii and its application. Background Technology

[0002] The red swamp crayfish (Procambarus clarkii), commonly known as the crayfish, is an important freshwater aquaculture species in my country. Red swamp crayfish farming in my country began in the late 20th century. After more than 20 years of development, in 2022, the farming area of ​​red swamp crayfish in my country reached 28 million mu (approximately 1.2 million hectares), with a total output of 2.8907 million tons, accounting for 8.79% of the total freshwater aquaculture output in my country, ranking fourth among freshwater aquaculture species (Zhang et al., 2024). The red swamp crayfish is an important aquaculture species, and its growth rate and meat yield directly affect its economic value. With the development of genotyping technology, molecular marker-assisted selection breeding has become one of the main methods to improve breeding efficiency. Currently, research on molecular markers related to crustaceans mainly focuses on growth traits, such as body length (Wang et al., 2020) and weight-related SNP markers (Lyu et al., 2021) in Litopenaeus vannamei and weight-related SNP markers (Haldar et al., 2021) in Macrobrachium rosenbergii. However, there are few studies on meat yield traits, which cannot meet the needs of high-quality and high-efficiency breeding. Summary of the Invention

[0003] The main objective of this invention is to provide a SNP molecular marker associated with the meat yield trait of Procambarus clarkii. By detecting this SNP marker, it is possible to effectively predict and breed Procambarus clarkii with high growth rate and high meat yield.

[0004] Another objective of this invention is to provide the application of the SNP molecular markers associated with the meat yield trait of Procambarus clarkii in marker-assisted selection breeding of Procambarus clarkii.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] In a first aspect, the present invention provides a SNP molecular marker related to the meat yield trait of Procambarus clarkii, comprising one or more of the following SNP1 to SNP10:

[0007] SNP1: Located at position 2044017 of the reference sequence NC_059637.1, it is associated with the high meat yield trait when the genotype is T / C;

[0008] SNP2: Located at position 2811781 of the reference sequence NC_059641.1, when the genotype is T / A, it is associated with the high meat yield trait;

[0009] SNP3: Located at position 15095358 of the reference sequence NC_059583.1, when the genotype is A / C, it is associated with the high meat yield trait;

[0010] SNP4: Located at position 15095371 of the reference sequence NC_059583.1, it is associated with the high meat yield trait when the genotype is C / T;

[0011] SNP5: Located at position 15095372 of the reference sequence NC_059583.1, when the genotype is A / G, it is associated with the high meat yield trait;

[0012] SNP6: Located at position 16436323 of the reference sequence NC_059583.1, when the genotype is A / G, it is associated with the high meat yield trait;

[0013] SNP7: Located at position 18359132 of the reference sequence NC_059588.1, when the genotype is G / A, it is associated with the high meat yield trait;

[0014] SNP8: Located at position 23482715 of the reference sequence NC_059588.1, when the genotype is A / G, it is associated with the high meat yield trait;

[0015] SNP9: Located at position 23872620 of the reference sequence NC_059586.1, when the genotype is A / G, it is associated with the high meat yield trait;

[0016] SNP10: Located at position 23903204 of the reference sequence NC_059586.1, it is associated with the high meat yield trait when the genotype is T / G.

[0017] Preferably, the SNP molecular markers associated with the meat yield trait of Procambarus clarkii are screened and identified by genome-wide association analysis (GWAS), and the SNP molecular markers include one or more of SNP1 to SNP10.

[0018] A second aspect of the present invention provides the application of the SNP molecular markers associated with the meat yield trait of *Procambarus clarkii* in the early breeding of *Procambarus clarkii* with high meat yield.

[0019] A third aspect of the present invention provides the application of the SNP molecular markers associated with the meat yield trait of Procambarus clarkii in marker-assisted selection (MAS) breeding of Procambarus clarkii.

[0020] A fourth aspect of the present invention provides a method for identifying the meat yield trait of Procambarus clarkii, comprising the following steps:

[0021] (1) Extract genomic DNA from the red swamp crayfish to be identified;

[0022] (2) The SNP molecular markers related to the meat yield of *Procambarus clarkii* were detected using PCR amplification technology, among which:

[0023] The primers used to amplify the SNP1 molecular marker are as follows:

[0024] F: CAATCGAACTTCTTCAGGTGTC; R: CCAGCCATGTTGAACAGAAA;

[0025] The primers used to amplify the SNP2 molecular marker are as follows:

[0026] F: AGCAAGTCCATTCCATCCAG; R: GCGTCTCGGGTAAACAAACA;

[0027] The primers used to amplify the SNP3 molecular marker are as follows:

[0028] F: AGTTGTGCTTGTGGATGTCG; R: TGGAATGCGTTAGGAAGTGA;

[0029] The primers used to amplify the SNP4 molecular marker are as follows:

[0030] F: GTTCTCCTCTGATGTTTGTTGG; R: TGGAATGCGTTAGGAAGTGA;

[0031] The primers used to amplify the SNP5 molecular marker are as follows:

[0032] F: TCTCCTCTGATGTTTGTTGGG; R: TGGAATGCGTTAGGAAGTG;

[0033] The primers used to amplify the SNP6 molecular marker are as follows:

[0034] F: ACATCACTTCCTAATGCGTTCC; R: AGATTACCAATGAGGAGGCG;

[0035] The primers used to amplify the SNP7 molecular marker are as follows:

[0036] F: AAGTCAACGGAGAGGCAAAG; R: TGTTGCGTCGGTTCTCTTCT;

[0037] The primers used to amplify the SNP8 molecular marker are as follows:

[0038] F: ACGTAGAAACCGATCCTGATG; R: GACCCTGTGTTACTGGTATTGG

[0039] The primers used to amplify the SNP9 molecular marker are as follows:

[0040] F: TACGAAGAATGCCAGAAGACAG; R: GAAAACGGAACCACTGACCA;

[0041] The primers used to amplify the SNP10 molecular marker are as follows:

[0042] F: GTAAGCGACATGCTCACGAA; R: TTCACCTATTCTGTTCCTGGCG.

[0043] (3) Determine the meat yield of the red swamp crayfish to be identified based on the test results;

[0044] SNP1: When the genotype is T / C, it is associated with the high meat yield trait;

[0045] SNP2: When the genotype is T / A, it is associated with the high meat yield trait;

[0046] SNP3: When the genotype is A / C, it is associated with the high meat yield trait;

[0047] SNP4: When the genotype is C / T, it is associated with the high meat yield trait;

[0048] SNP5: When the genotype is A / G, it is associated with the high meat yield trait;

[0049] SNP6: When the genotype is A / G, it is associated with the high meat yield trait;

[0050] SNP7: When the genotype is G / A, it is associated with the high meat yield trait;

[0051] SNP8: When the genotype is A / G, it is associated with the high meat yield trait;

[0052] SNP9: When the genotype is A / G, it is associated with the high meat yield trait;

[0053] SNP10: When the genotype is T / G, it is associated with the high meat yield trait.

[0054] A fifth aspect of the present invention provides a breeding method for red swamp crayfish with a high meat yield, comprising the following steps:

[0055] (a) Select parental individuals carrying favorable SNP genotypes;

[0056] (b) Obtaining offspring through hybridization;

[0057] (c) SNP genotyping was performed on offspring individuals, and individuals carrying favorable genotypes were selected for breeding as red swamp crayfish with high meat yield.

[0058] Preferably, the favorable genotype is a specific allele combination of the SNP molecular marker.

[0059] In a sixth aspect, the present invention provides a kit for detecting high-meat-yield Procambarus clarkii, comprising primers for detecting the SNP molecular markers of Procambarus clarkii, as shown in the table below:

[0060]

[0061] Preferably, the primers or probes are used for PCR, real-time quantitative PCR, SNP microarray, or high-throughput sequencing technologies.

[0062] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0063] 1. The SNP molecular markers of the present invention can improve breeding efficiency and selection effect through MAS breeding. For example, PCR amplification and gene sequencing technology can be used to detect the genotype of Procambarus clarkii, screen out Procambarus clarkii individuals with excellent growth and meat yield traits, and use them as parents for breeding, which can improve the meat yield of offspring populations.

[0064] 2. Combining traditional phenotypic selection methods with molecular marker-assisted selection breeding using SNP molecular markers related to the meat yield trait of Procambarus clarkii in this invention, the breeding efficiency and accuracy of Procambarus clarkii can be significantly improved, and new high-yielding and high-quality Procambarus clarkii varieties can be bred. This has broad application prospects in molecular breeding of Procambarus clarkii meat yield trait. Attached Figure Description

[0065] Figure 1 The Manhattan-QQ plot of the meat yield trait on chromosomes 1-23 in the genome-wide association analysis of Procambarus clarkii in the example is shown. After taking the intersection of multiple models, there is a total of 1 SNP on the threshold line, of which 1 is on chromosome 1.

[0066] Figure 2 The Manhattan-QQ plot of the meat yield trait on chromosomes 24–47 in the genome-wide association analysis of Procambarus clarkii in the example is shown. After taking the intersection of multiple models, there are a total of 3 SNPs on the threshold line, of which 3 are on chromosome 25.

[0067] Figure 3The Manhattan-QQ plot of the meat yield trait on chromosomes 48-70 in the genome-wide association analysis of Procambarus clarkii in this example shows that after taking the intersection of multiple models, there are a total of 5 SNPs above the threshold line, one each on chromosomes 57, 62, 63, 64 and 67.

[0068] Figure 4 The Manhattan-QQ plot of the meat yield trait on chromosomes 71–93 of Procambarus clarkii in the genome-wide association analysis of Procambarus clarkii in the example shows that after taking the intersection of multiple models, there is a total of 1 SNP on the threshold line, of which 1 is on chromosome 73. Detailed Implementation

[0069] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the described embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0070] Example 1: Genomic DNA Extraction and Genomic Resequencing

[0071] S01. DNA Extraction and Quality Testing:

[0072] (1) Take muscle tissue from 150 adult red swamp crayfish, grind the collected tissue in an ice bath using an automatic tissue homogenizer, place it in a 1.5 mL centrifuge tube, and immediately add 200 μL of buffer GA.

[0073] (2) Add 20 μL of Proteinase K solution, mix well, and place in a 56°C constant temperature water bath until the tissue is completely digested. Centrifuge briefly every 30 minutes to remove water droplets from the inner wall of the tube cap.

[0074] (3) Add 200 μL of buffer GB, mix thoroughly by inverting, place at 70°C for 10 min, vortex every 3 min during the period, the solution should become clear, and centrifuge briefly to remove water droplets from the inner wall of the tube cap.

[0075] (4) Add 200 μL of anhydrous ethanol, gently invert to mix the sample, place at room temperature for 5 min, and briefly centrifuge to remove water droplets from the inner wall of the tube cap.

[0076] (5) Take the solution obtained in the previous step and transfer it into the adsorption column CR2 (place the adsorption column in the collection tube), centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column back into the collection tube.

[0077] (6) Add 500 μL of buffer GD to the adsorption column CR2, centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column back into the collection tube.

[0078] (7) Add 600 μL of washing solution PW to the adsorption column CR2, centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, put the adsorption column back into the collection tube, and repeat the operation once.

[0079] (8) Centrifuge at 12,000 rpm for 2 min, discard the waste liquid, and place the adsorption column CR2 at room temperature for 5 min until the residual rinsing liquid is dried.

[0080] (9) Transfer the adsorption column CR2 into a clean centrifuge tube, add 50 μL of elution buffer TB to the middle of the adsorption membrane, place at room temperature for 3 min, centrifuge at 12,000 rpm for 2 min, collect the solution into the centrifuge tube, obtain the sample genomic DNA, and use agarose gel electrophoresis to detect the DNA quality.

[0081] S02, Genome Resequencing and Genotyping:

[0082] (1) A DNA sequencing library was constructed using the DNA samples extracted above, and genome sequencing was performed using a high-throughput platform;

[0083] (2) Quality control was performed on the sequencing data of Procambarus clarkii. The quality-controlled data were then aligned to the Procambarus clarkii reference genome using BWA and SNP typing was performed.

[0084] (3) The obtained VCF files were subjected to quality control of SNP sites, and SNPs of individuals with a missing rate of more than 10% and SNP sites with non-binary variants were removed.

[0085] (4) The SNP data were filled and 24 SNP molecular marker sites were selected for subsequent analysis.

[0086] Example 2: Genome-wide association analysis of growth traits in Procambarus clarkii

[0087] 1. SNP molecular marker quality control

[0088] Based on the reliable SNP molecular marker sites selected after genotype filling, the filled SNPs were quality controlled, and SNPs with a minimum allele frequency of less than 0.05 and deviating from the Haven equilibrium (P = 1E-5) were removed for genome-wide association analysis.

[0089] 2. Genome-wide association analysis of growth and meat yield traits in Procambarus clarkii

[0090] The experimental population used for the genome-wide association analysis (GWIA) was derived from Wuhu Shengdian Leisure Ecological Park Co., Ltd., Fanchang District, Wuhu City, Anhui Province, and included 150 adult crayfish. GWIA was performed using Linux and R languages ​​to analyze the SNP molecular markers and their correlation with meat yield in *Procambarus clarkii*.

[0091] Based on the GWAS results, the P value of each SNP site is calculated as -log(P). According to the significance threshold calculation formula -log(1 / number of SNPs), when the -log(P) value of each SNP site is not less than 5, it indicates that there is a significant association between the SNP and the trait.

[0092] 3. Analysis of genome-wide association analysis results of growth and meat yield traits in Procambarus clarkii

[0093] GWAS results identified significant SNP sites for the meat yield trait in *Procambarus clarkii*. The QQ plot results showed that most sites in the lower left corner were on the diagonal, indicating the accuracy of the selected model. Sites in the upper right corner that exceeded the diagonal and confidence intervals represented highly significant trait results. Furthermore, the QQ plots were largely consistent across different models used in this analysis, demonstrating the reliability of the results.

[0094] After integrating the analysis results, 10 SNPs were found to be significantly associated with meat yield, namely:

[0095] SNP1: Located at position 2044017 of the reference sequence NC_059637.1, it is associated with the high meat yield trait when the genotype is T / C;

[0096] SNP2: Located at position 2811781 of the reference sequence NC_059641.1, when the genotype is T / A, it is associated with the high meat yield trait;

[0097] SNP3: Located at position 15095358 of the reference sequence NC_059583.1, when the genotype is A / C, it is associated with the high meat yield trait;

[0098] SNP4: Located at position 15095371 of the reference sequence NC_059583.1, it is associated with the high meat yield trait when the genotype is C / T;

[0099] SNP5: Located at position 15095372 of the reference sequence NC_059583.1, when the genotype is A / G, it is associated with the high meat yield trait;

[0100] SNP6: Located at position 16436323 of the reference sequence NC_059583.1, when the genotype is A / G, it is associated with the high meat yield trait;

[0101] SNP7: Located at position 18359132 of the reference sequence NC_059588.1, when the genotype is G / A, it is associated with the high meat yield trait;

[0102] SNP8: Located at position 23482715 of the reference sequence NC_059588.1, when the genotype is A / G, it is associated with the high meat yield trait;

[0103] SNP9: Located at position 23872620 of the reference sequence NC_059586.1, when the genotype is A / G, it is associated with the high meat yield trait;

[0104] SNP10: Located at position 23903204 of the reference sequence NC_059586.1, it is associated with the high meat yield trait when the genotype is T / G.

[0105] The primers used to detect the SNP molecular markers in Procambarus clarkii are shown in Table 1:

[0106] Table 1

[0107]

[0108]

[0109] 4. Identification of candidate genes

[0110] Using sequences within a 250bp range upstream and downstream of the genomic region containing the aforementioned SNP markers, online annotation and identification of candidate genes were performed using the KOBAS database. A candidate gene, LOC123773676 (tight junction protein ZO-1-like), was identified as significantly associated with the meat yield of Procambarus clarkii. This gene is mainly related to the cytoskeleton and molting.

[0111] 5. Application of molecular marker-assisted breeding

[0112] The selected SNP molecular markers were applied to the breeding of red swamp crayfish. By detecting the SNP marker genotypes, the meat yield trait of red swamp crayfish was determined, thereby breeding high-quality new varieties of red swamp crayfish.

[0113] Table 2: Candidate SNP loci for meat yield traits in Procambarus clarkii identified based on GWAS

[0114]

[0115]

[0116] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.

Claims

1. Application of SNP molecular markers related to meat yield in the early breeding of high-meat-yield Procambarus clarkii, wherein the SNP molecular markers related to meat yield include one or more of SNP1 to SNP6, wherein: SNP1: Located at position 2044017 of the reference sequence NC_059637.1, it is associated with the high meat yield trait when the genotype is T / C; SNP2: Located at position 2811781 of the reference sequence NC_059641.1, when the genotype is T / A, it is associated with the high meat yield trait; SNP3: Located at position 15095358 of the reference sequence NC_059583.1, when the genotype is A / C, it is associated with the high meat yield trait; SNP4: Located at position 15095371 of the reference sequence NC_059583.1, it is associated with the high meat yield trait when the genotype is C / T; SNP5: Located at position 15095372 of the reference sequence NC_059583.1, when the genotype is A / G, it is associated with the high meat yield trait; SNP6: Located at position 16436323 of the reference sequence NC_059583.1, when the genotype is A / G, it is associated with the high meat yield trait.

2. A method for identifying the meat yield trait of Procambarus clarkii, characterized in that, Includes the following steps: (1) Extract genomic DNA from the red swamp crayfish to be identified; (2) PCR amplification technology was used to detect SNP molecular markers related to the meat yield trait of Procambarus clarkii. The primer sequences used to amplify the SNP1 to SNP6 molecular markers described in claim 1 are shown in the table below: (3) Determine the meat yield trait of the red swamp crayfish to be identified based on the test results, including: SNP1: When the genotype is T / C, it is associated with the high meat yield trait; SNP2: When the genotype is T / A, it is associated with the high meat yield trait; SNP3: When the genotype is A / C, it is associated with the high meat yield trait; SNP4: When the genotype is C / T, it is associated with the high meat yield trait; SNP5: When the genotype is A / G, it is associated with the high meat yield trait; SNP6: When the genotype is A / G, it is associated with the high meat yield trait.