Application of FOXA2 detection reagent in preparation of kit for diagnosis or differentiation degree evaluation and prognosis evaluation of head and neck squamous cell carcinoma

Abstract

The invention discloses application of a reagent for detecting FOXA2 in preparation of a kit for diagnosis or differentiation degree evaluation and prognosis evaluation of head and neck squamous cell carcinoma. Wherein the reagent comprises a primer pair for amplifying the FOXA2; the primer pair comprises an upstream primer with a nucleotide sequence as shown in SEQ ID NO. 1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO. 2. By utilizing the kit, diagnosis, differentiation degree evaluation and prognosis evaluation of head and neck squamous cell carcinoma and oral squamous cell carcinoma can be effectively realized, and the kit is high in accuracy and good in repeatability.

Description

Technical Field

[0001] The present invention relates to the technical field of head and neck squamous cell carcinoma, and in particular, to the use of a reagent for detecting FOXA2 in preparing a kit for diagnosing or evaluating the degree of differentiation and prognosis of head and neck squamous cell carcinoma. Background Art

[0002] Head and neck squamous cell carcinoma (HNSCC) is a malignant tumor originating from the mucosal epithelium of the oral cavity, nasopharynx, oropharynx, hypopharynx and larynx. According to statistics, HNSCC is the sixth most common cancer in the world. In 2018, there were 890,000 new cases and 450,000 deaths. Its incidence rate is still rising, and it is expected that the number of patients will increase by 30%, or 1.08 million cases, by 2030. Among them, more than 90% of head and neck malignancies are oral squamous cell carcinoma (OSCC). According to global cancer statistics, there are about 377,000 new cases of OSCC and 177,000 deaths each year, and the five-year survival rate of patients is 50-60%. OSCC can cause disfigurement in patients and damage their physiological functions such as swallowing, pronunciation and tasting. The causes of OSCC are relatively complex, including excessive smoking, alcoholism, betel nut chewing, gene mutations, etc. In the early stages of OSCC, the survival rate of patients after completing treatment can exceed 90%, but almost half of patients are diagnosed with OSCC in the late stages. Therefore, finding key markers associated with the development of HNSCC or OSCC is of great significance for early diagnosis and prognosis prediction of patients, and even future treatment. Summary of the invention

[0003] The present invention aims to solve one of the technical problems in the related art at least to a certain extent. To this end, one purpose of the present invention is to propose a marker that is highly associated with head and neck squamous cell carcinoma, and further propose the use of a reagent for detecting the marker in the preparation of a kit for diagnosis or differentiation degree assessment and prognosis assessment of head and neck squamous cell carcinoma.

[0004] Therefore, the present invention has conducted a series of explorations and studies, and found that pioneer transcription factors are a type of cancer marker worthy of attention. Specifically, studies have shown that transcription factors are proteins that bind to DNA in a sequence-specific manner and control gene expression by regulating the gene transcription process. Transcription factors are involved in regulating multiple pathways such as cell cycle, apoptosis, differentiation, cell homeostasis and stress, and inflammatory response. Among them, pioneer transcription factors are a unique class of transcription factors that have the unique ability to initiate the opening of closed chromatin. They are the main regulators of the epigenome and cell fate, and play an important regulatory role in processes such as cell development, organ formation, and disease occurrence. Their disordered expression or structural abnormalities can lead to the deterioration of cancer. Among them, forkhead box A2 (FOXA2) is one of the important members of the pioneer FOXA transcription factor family. Its gene aliases include HNF-3-beta, HNF3B and TCF3B. Its gene ID in NCBI is 3170, the gene length is 4493bp, and the chromosome position is chr20:22580998-chr20:22585490. FOXA2 has the functions of regulating tumor development, organogenesis and differentiation, inflammation and immunity, and cellular energy metabolism, and is a cancer marker with great prognostic potential. At present, its role in many tumors is still unclear, and its mechanism of action in HNSCC is insufficiently explored, but it still has great exploration and research significance.

[0005] Further, the inventors of the present invention designed a series of scientific and rigorous experiments: First, the expression level of FOXA2 in the transcriptome data of HNSCC tissues and normal tissues in the TCGA database was analyzed, and the expression of FOXA2 in multiple HNSCC patients was analyzed for survival. The results showed that compared with normal tissues, the expression of FOXA2 in HNSCC tumor tissues was higher, and HNSCC patients with higher FOXA2 expression levels had lower survival rates. Then, the inventors conducted FOXA2 knockdown HN6 cell migration and invasion experiments, actual patient diagnosis verification, and FOXA2. All the results corroborated each other, proving that the high expression of FOXA2 promoted the proliferation, migration and invasion of HNSCC, such as oral squamous cell carcinoma and oral adenosquamous carcinoma, and its downregulation could inhibit the occurrence and development of cancer. That is, FOXA2 plays an important regulatory role in the occurrence and development of HNSCC, such as oral squamous cell carcinoma and oral adenosquamous carcinoma, and can be used as an effective clinical diagnostic marker for HNSCC, especially oral squamous cell carcinoma and oral adenosquamous carcinoma. Therefore, the inventors believe that FOXA2 is a marker for HNSCC, and the reagent for detecting FOXA2 can be effectively used to prepare a kit for diagnosing head and neck squamous cell carcinoma and oral squamous cell carcinoma. In addition, the kit for diagnosing head and neck squamous cell carcinoma prepared using the reagent for detecting FOXA2 has high diagnostic accuracy and good repeatability.

[0006] Therefore, in the first aspect of the present invention, the present invention provides the use of a reagent for detecting FOXA2 in preparing a kit for diagnosing or evaluating the degree of differentiation and prognosis of head and neck squamous cell carcinoma. The reagent for detecting FOXA2 can be used to effectively prepare a kit for diagnosing head and neck squamous cell carcinoma, and the kit has high accuracy and good repeatability for diagnosing, evaluating the degree of differentiation and evaluating the prognosis of head and neck squamous cell carcinoma.

[0007] In some embodiments, the head and neck squamous cell carcinoma is oral squamous cell carcinoma or oral adenosquamous carcinoma. The reagent for detecting FOXA2 can be used to effectively prepare a kit for diagnosing oral squamous cell carcinoma and oral adenosquamous carcinoma.

[0008] Among them, it needs to be explained that oral squamous cell carcinoma (OSCC) refers to a cancer with squamous differentiation that originates from the oral mucosal epithelium. The oral mucosa includes at least one of the buccal mucosa, gingival mucosa, retromolar trigone mucosa, tongue (anterior 2 / 3 of the terminal sulcus) mucosa, floor of mouth mucosa, hard palate mucosa and lip mucosa.

[0009] In some embodiments, the reagent is a reagent capable of detecting the expression level of FOXA2.

[0010] In some embodiments, the reagents include a primer pair for amplifying FOXA2. In some embodiments, the primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.2.

[0011] In some embodiments, the reagent for detecting FOXA2 is a reagent for detecting the expression level of FOXA2 in a sample.

[0012] In some embodiments, the sample is at least one of a cell, a tissue, or a body fluid.

[0013] In some embodiments, the sample is at least one of oral mucosal tissue, blood, urine, and saliva.

[0014] In some embodiments, for the kit for diagnosing head and neck squamous cell carcinoma, when the expression level of FOXA2 in the sample of the subject is higher than a threshold value, the subject is diagnosed with head and neck squamous cell carcinoma.

[0015] In some embodiments, the threshold value is a cutoff value when a ROC curve constructed by the OSCC patient group and the control group meets a certain specificity and / or sensitivity, for example, the cutoff value when the sum of the specificity and the sensitivity is the maximum.

[0016] In some embodiments, the OSCC patient group and the control group are cancer tissues and paracancerous tissues of OSCC patients, respectively. In other embodiments, the OSCC patient group and the control group can also be cancer tissues of OSCC patients and sample tissues of normal persons, respectively.

[0017] In some embodiments, the expression level of FOXA2 is the relative expression level of FOXA2 relative to an internal reference gene, for example, any one of β-Actin, GAPDH, tubulin, etc. In some embodiments, the internal reference gene used to calculate the relative expression level is β-Actin.

[0018] In some embodiments, the expression level of FOXA2 is the relative expression level of FOXA2 relative to an internal reference gene calculated according to the 2-ΔΔCt formula, for example, the internal reference gene is β-Actin.

[0019] In some embodiments, the expression level of FOXA2 is the relative expression level of FOXA2 relative to the internal reference gene β-Actin calculated according to the 2-ΔΔCt formula. When the expression level of FOXA2 in the subject's sample is higher than a threshold, the subject is diagnosed with head and neck squamous cell carcinoma, and the threshold is 29.92.

[0020] In some embodiments, the reagent for detecting FOXA2 includes a primer pair for amplifying FOXA2. The specific primer pair can be designed based on the above-mentioned nucleotide sequence of FOXA2 in combination with primer design software commonly used in the art, such as Prime 3.

[0021] In some embodiments, the primer pair for amplifying FOXA2 comprises:

[0022] The nucleotide sequence of the upstream primer is 5'-AGTTAAAGTATGCTGGGAGCG-3' (SEQ ID NO. 1); and the nucleotide sequence of the downstream primer is 5'-TCATGTTGCTCACGGAGGAG-3' (SEQ ID NO. 2).

[0023] In some embodiments, the kit further comprises RNA extraction reagents and reverse transcription reagents.

[0024] In some embodiments, the RNA extraction reagent includes TRIzol total RNA extraction reagent.

[0025] In some embodiments, the reverse transcription reagents include reverse transcription polymerase, dNTPs, and RT primers.

[0026] In some embodiments, the reverse transcriptase polymerase comprises Evo M-MLV RTase.

[0027] In some embodiments, the RT primer comprises at least one of a random primer and oligo dT.

[0028] In some embodiments, the reverse transcription reagent further comprises an RNase inhibitor.

[0029] In some embodiments, the reverse transcription reagents further include a gDNA removal reagent.

[0030] In some embodiments, the reverse transcription reagent further comprises RNase-free water.

[0031] In some embodiments, the kit further comprises an internal reference primer pair.

[0032] In some embodiments, the internal reference primer pair is a primer pair for β-Actin.

[0033] In some embodiments, the internal reference primer pair comprises:

[0034] An upstream primer having a nucleotide sequence as shown in 5'-AAACTGGAACGGTGAAGGTG-3' (SEQ ID NO. 3); and

[0035] The nucleotide sequence of the downstream primer is shown as 5'-AGTGGGGTGGCTTTTAGGAT-3' (SEQ ID NO. 4).

[0036] In a second aspect of the present invention, the present invention provides a computer-readable storage medium storing computer-executable instructions for causing a computer to perform the following operations: Step 1: obtaining information on the expression level of FOXA2 in a sample of a subject; Step 2: comparing the expression level with a threshold, and indicating whether the subject suffers from head and neck squamous cell carcinoma according to the comparison result. Using the computer-readable storage medium, the diagnosis of head and neck squamous cell carcinoma has high accuracy and good repeatability.

[0037] In some embodiments, the head and neck squamous cell carcinoma is oral squamous cell carcinoma or oral adenosquamous carcinoma. The computer-readable storage medium can be used to effectively diagnose oral squamous cell carcinoma and oral adenosquamous carcinoma.

[0038] In some embodiments, the information on the expression level of FOXA2 in a sample from a subject is obtained by detecting the sample using a reagent for detecting FOXA2.

[0039] In some embodiments, the sample is at least one of a cell, a tissue, or a body fluid.

[0040] In some embodiments, the sample is at least one of oral mucosal tissue, blood, urine, and saliva.

[0041] In some embodiments, when the expression level of FOXA2 in the sample of the subject is higher than a threshold value, it indicates that the subject has head and neck squamous cell carcinoma.

[0042] In some embodiments, the threshold value is a cutoff value when a ROC curve constructed by the OSCC patient group and the control group meets a certain specificity and / or sensitivity, for example, the cutoff value when the sum of the specificity and the sensitivity is the maximum.

[0043] In some embodiments, the OSCC patient group and the control group are cancer tissues and paracancerous tissues of OSCC patients, respectively, or cancer tissues of OSCC patients and sample tissues of normal persons, respectively.

[0044] In some embodiments, the expression level of FOXA2 is the relative expression level of FOXA2 relative to an internal reference gene, for example, any one of β-Actin, GAPDH, tubulin, etc. In some embodiments, the internal reference gene used to calculate the relative expression level is β-Actin.

[0045] In some embodiments, the expression level of FOXA2 is the relative expression level of FOXA2 relative to an internal reference gene calculated according to the 2-ΔΔCt formula, for example, the internal reference gene is β-Actin.

[0046] In some embodiments, the expression level of FOXA2 is the relative expression level of FOXA2 relative to the internal reference gene β-Actin calculated according to the 2-ΔΔCt formula. When the expression level of FOXA2 in the subject's sample is higher than a threshold, it indicates that the subject has head and neck squamous cell carcinoma, and the threshold is 29.92.

[0047] In some embodiments, the reagents for detecting FOXA2 include a primer pair for amplifying FOXA2.

[0048] In some embodiments, the primer pair for amplifying FOXA2 comprises:

[0049] An upstream primer having a nucleotide sequence as shown in 5'-AGTTAAAGTATGCTGGGAGCG-3' (SEQ ID NO. 1); and

[0050] The nucleotide sequence of the downstream primer is shown as 5'-TCATGTTGCTCACGGAGGAG-3' (SEQ ID NO. 2).

[0051] In some embodiments, the kit further comprises RNA extraction reagents and reverse transcription reagents.

[0052] In some embodiments, the RNA extraction reagent includes TRIzol total RNA extraction reagent.

[0053] In some embodiments, the reverse transcription reagents include reverse transcription polymerase, dNTPs, and RT primers.

[0054] In some embodiments, the reverse transcriptase polymerase comprises Evo M-MLV RTase.

[0055] In some embodiments, the RT primer comprises at least one of a random primer and oligo dT.

[0056] In some embodiments, the reverse transcription reagent further comprises an RNase inhibitor.

[0057] In some embodiments, the reverse transcription reagents further include a gDNA removal reagent.

[0058] In some embodiments, the reverse transcription reagent further comprises RNase-free water.

[0059] In some embodiments, the kit further comprises an internal reference primer pair.

[0060] In some embodiments, the internal reference primer pair is a primer pair for β-Actin.

[0061] In some embodiments, the internal reference primer pair comprises:

[0062] An upstream primer having a nucleotide sequence as shown in 5'-AAACTGGAACGGTGAAGGTG-3' (SEQ ID NO. 3); and

[0063] The nucleotide sequence of the downstream primer is shown as 5'-AGTGGGGTGGCTTTTAGGAT-3' (SEQ ID NO. 4).

[0064] In a third aspect of the present invention, the present invention provides a device, which includes a processor and a memory, the memory stores a computer program that can be run on the processor, and the processor implements the following operations when running the computer program: Step 1: obtaining information on the expression level of FOXA2 in a sample of a subject: Step 2: comparing the expression level with a threshold, and indicating whether the subject suffers from head and neck squamous cell carcinoma according to the comparison result. Using this device, the diagnosis, differentiation degree assessment, and prognosis assessment of head and neck squamous cell carcinoma have high accuracy and good repeatability.

[0065] In some embodiments, the head and neck squamous cell carcinoma is oral squamous cell carcinoma or oral adenosquamous carcinoma. The device can effectively diagnose oral squamous cell carcinoma and oral adenosquamous carcinoma.

[0066] In some embodiments, the information on the expression level of FOXA2 in a sample from a subject is obtained by detecting the sample using a reagent for detecting FOXA2.

[0067] In some embodiments, the sample is at least one of a cell, a tissue, or a body fluid.

[0068] In some embodiments, the sample is at least one of oral mucosal tissue, blood, urine, and saliva.

[0069] In some embodiments, when the expression level of FOXA2 in the sample of the subject is higher than a threshold value, it indicates that the subject has head and neck squamous cell carcinoma.

[0070] In some embodiments, the threshold value is a cutoff value when a ROC curve constructed by the OSCC patient group and the control group meets a certain specificity and / or sensitivity, for example, the cutoff value when the sum of the specificity and the sensitivity is the maximum.

[0071] In some embodiments, the OSCC patient group and the control group are cancer tissues and paracancerous tissues of OSCC patients, respectively, or cancer tissues of OSCC patients and sample tissues of normal persons, respectively.

[0072] In some embodiments, the expression level of FOXA2 is the relative expression level of FOXA2 relative to an internal reference gene, for example, any one of β-Actin, GAPDH, tubulin, etc. In some embodiments, the internal reference gene used to calculate the relative expression level is β-Actin.

[0073] In some embodiments, the expression level of FOXA2 is the relative expression level of FOXA2 relative to an internal reference gene calculated according to the 2-ΔΔCt formula, for example, the internal reference gene is β-Actin.

[0074] In some embodiments, the expression level of FOXA2 is the relative expression level of FOXA2 relative to the internal reference gene β-Actin calculated according to the 2-ΔΔCt formula. When the expression level of FOXA2 in the subject's sample is higher than a threshold, it indicates that the subject has head and neck squamous cell carcinoma, and the threshold is 29.92.

[0075] In some embodiments, the reagent for detecting FOXA2 includes a primer pair for amplifying FOXA2. In some embodiments, the primer pair includes: an upstream primer with a nucleotide sequence such as 5'-AGTTAAAGTATGCTGGGAGCG-3' (SEQ ID NO. 1); and a downstream primer with a nucleotide sequence such as 5'-TCATGTTGCTCACGGAGGAG-3' (SEQ ID NO. 2).

[0076] In some embodiments, the kit further comprises RNA extraction reagents and reverse transcription reagents.

[0077] In some embodiments, the RNA extraction reagent includes TRIzol total RNA extraction reagent.

[0078] In some embodiments, the reverse transcription reagents include reverse transcription polymerase, dNTPs, and RT primers.

[0079] In some embodiments, the reverse transcriptase polymerase comprises Evo M-MLV RTase.

[0080] In some embodiments, the RT primer comprises at least one of a random primer and oligo dT.

[0081] In some embodiments, the reverse transcription reagent further comprises an RNase inhibitor.

[0082] In some embodiments, the reverse transcription reagents further include a gDNA removal reagent.

[0083] In some embodiments, the reverse transcription reagent further comprises RNase-free water.

[0084] In some embodiments, the kit further comprises an internal reference primer pair.

[0085] In some embodiments, the internal reference primer pair is a primer pair of β-Actin. In some embodiments, the internal reference primer pair includes: an upstream primer having a nucleotide sequence such as 5'-AAACTGGAACGGTGAAGGTG-3' (SEQ ID NO.3); and a downstream primer having a nucleotide sequence such as 5'-AGTGGGGTGGCTTTTAGGAT-3' (SEQ ID NO.4).

[0086] In a fourth aspect of the present invention, the present invention provides a head and neck squamous cell carcinoma risk assessment system, comprising: an acquisition module for acquiring information on the expression level of FOXA2 in a sample of a subject; and an assessment module for comparing the expression level with a threshold value, and indicating whether the subject suffers from head and neck squamous cell carcinoma according to the comparison result. Using this system, the risk assessment of head and neck squamous cell carcinoma has high accuracy and good repeatability.

[0087] In some embodiments, the head and neck squamous cell carcinoma is oral squamous cell carcinoma or oral adenosquamous carcinoma. The system has high accuracy and good repeatability in assessing the risk of oral squamous cell carcinoma and oral adenosquamous carcinoma.

[0088] In some embodiments, the method further comprises a detection module for detecting the expression level of FOXA2 based on a sample from a subject.

[0089] It is understandable that the acquisition module can directly or indirectly acquire the information on the expression level of FOXA2 in the sample of the subject according to the detection result of FOXA2.

[0090] In some embodiments, the sample is at least one of a cell, a tissue, or a body fluid.

[0091] In some embodiments, the sample is at least one of oral mucosal tissue, blood, urine, and saliva.

[0092] In some embodiments, the detection module includes a reagent for detecting FOXA2.

[0093] In some embodiments, the reagents for detecting FOXA2 include a primer pair for amplifying FOXA2.

[0094] In some embodiments, the primer pair includes: an upstream primer having a nucleotide sequence as shown in 5'-AGTTAAAGTATGCTGGGAGCG-3' (SEQ ID NO. 1); and a downstream primer having a nucleotide sequence as shown in 5'-TCATGTTGCTCACGGAGGAG-3' (SEQ ID NO. 2).

[0095] In some embodiments, the kit further comprises RNA extraction reagents and reverse transcription reagents.

[0096] In some embodiments, the RNA extraction reagent includes TRIzol total RNA extraction reagent.

[0097] In some embodiments, the reverse transcription reagents include reverse transcription polymerase, dNTPs, and RT primers.

[0098] In some embodiments, the reverse transcriptase polymerase comprises Evo M-MLV RTase.

[0099] In some embodiments, the RT primer comprises at least one of a random primer and oligo dT.

[0100] In some embodiments, the reverse transcription reagent further comprises an RNase inhibitor.

[0101] In some embodiments, the reverse transcription reagents further include a gDNA removal reagent.

[0102] In some embodiments, the reverse transcription reagent further comprises RNase-free water.

[0103] In some embodiments, the kit further comprises an internal reference primer pair.

[0104] In some embodiments, the internal reference primer pair is a primer pair for β-Actin.

[0105] In some embodiments, the internal reference primer pair includes: an upstream primer having a nucleotide sequence such as 5'-AAACTGGAACGGTGAAGGTG-3' (SEQ ID NO. 3); and a downstream primer having a nucleotide sequence such as 5'-AGTGGGGTGGCTTTTAGGAT-3' (SEQ ID NO. 4).

[0106] In some embodiments, in the evaluation module, when the expression level of FOXA2 in the sample of the subject is higher than a threshold, it indicates that the subject has head and neck squamous cell carcinoma.

[0107] In some embodiments, the threshold value is a cutoff value when a ROC curve constructed by the OSCC patient group and the control group meets a certain specificity and / or sensitivity, for example, the cutoff value when the sum of the specificity and the sensitivity is the maximum.

[0108] In some embodiments, the OSCC patient group and the control group are cancer tissues and paracancerous tissues of OSCC patients, respectively, or cancer tissues of OSCC patients and sample tissues of normal persons, respectively.

[0109] In some embodiments, the expression level of FOXA2 is the relative expression level of FOXA2 relative to an internal reference gene, for example, any one of β-Actin, GAPDH, tubulin, etc. In some embodiments, the internal reference gene used to calculate the relative expression level is β-Actin.

[0110] In some embodiments, the expression level of FOXA2 is the relative expression level of FOXA2 relative to an internal reference gene calculated according to the 2-ΔΔCt formula, for example, the internal reference gene is β-Actin.

[0111] In some embodiments, the expression level of FOXA2 is the relative expression level of FOXA2 relative to the internal reference gene β-Actin calculated according to the 2-ΔΔCt formula. When the expression level of FOXA2 in the subject's sample is higher than a threshold, it indicates that the subject has head and neck squamous cell carcinoma, and the threshold is 29.92.

[0112] In a fifth aspect, the present invention also provides the use of a substance that specifically inhibits FOXA2 expression in the preparation of a1-a2: a1. A drug for treating head and neck squamous cell carcinoma; a2. A drug for inhibiting the proliferation, migration or invasion of head and neck squamous cell carcinoma cells.

[0113] In some embodiments, the head and neck squamous cell carcinoma is oral squamous cell carcinoma or oral adenosquamous carcinoma. The substance that specifically inhibits FOXA2 expression of the present invention can be used to effectively prepare drugs for treating head and neck squamous cell carcinoma, as well as drugs for inhibiting the proliferation, migration or invasion of head and neck squamous cell carcinoma cells.

[0114] In some embodiments, the substance includes any one of the antisense oligonucleotide (ASO) of FOXA2, small interfering RNA (siRNA), short hairpin RNA (shRNA), micro RNA (miRNA), clustered regularly interspaced short palindromic repeats (CRSIPR) system, transcription activator-like effector nuclease (TALEN) system, and zinc finger nuclease (ZFN) system. Among them, ASO can be, for example, GapmeR, and the CRSIPR system can be, for example, a CRISPR-Cas13 system.

[0115] In some embodiments, the substance comprises shRNA of FOXA2. In some embodiments, the nucleotide sequences of the top strand and bottom strand of the shRNA are shown as SEQ ID NO.7 and SEQ ID NO.8, respectively;

[0116] in:

[0117] GATCCGAACGGCATGAACACGTACATCTCGAGATGTACGTGTTCATGCCGTTC TTTTTTG(SEQ ID NO.7)(SEQ ID NO.7);

[0118] AATTCAAAAAAGAACGGCATGAACACGTACATCTCGAGATGTACGTGTTCATG CCGTTCG (SEQ ID NO. 8).

[0119] In some embodiments, the substance also includes a carrier loaded with the above-mentioned ASO, siRNA, shRNA, miRNA, CRS IPR system, TALEN system, and ZFN system.

[0120] In some embodiments, the carrier is any one of an inorganic carrier, an organic carrier, and an inorganic-organic composite carrier.

[0121] In some embodiments, the vector comprises any one of a plasmid, a lentivirus, an adenovirus, and an adeno-associated virus.

[0122] In some embodiments, the oral squamous cell carcinoma is tongue squamous cell carcinoma.

[0123] In some embodiments, the oral squamous carcinoma cells include at least one of HSC-3, HN6, and CAL-27.

[0124] According to the above application, the embodiment of the present invention also relates to a drug combination, including a substance that specifically inhibits the expression of FOXA2. The drug combination can effectively treat head and neck squamous cell carcinoma.

[0125] In some embodiments, the drug combination further includes a combined drug, such as at least one of a chemotherapy drug, a photosensitizer, a photothermal agent, and an immunotherapy drug for head and neck squamous cell carcinoma. Among them, the chemotherapy drug can be, for example, at least one of paclitaxel, camptothecin, 5-fluorouracil, cisplatin, doxorubicin, mitomycin, and epirubicin; the photosensitizer can be, for example, at least one of boron dipyrrole, dihydrochlorin, and Bengal red; the photothermal agent can be, for example, at least one of precious metal nanoparticles, organic polymers, carbon-based nanomaterials, magnetic nanomaterials, and semiconductor nanomaterials; the immunotherapy drug can be, for example, at least one of an immune cell therapy drug and an immune checkpoint inhibitor. It is understandable that the combined drug and FOXA2 or a substance that reduces the expression of FOXA2 can be used simultaneously or successively.

[0126] In some embodiments, the pharmaceutical combination further comprises a targeted delivery system.

[0127] The embodiments of the present invention also relate to the use of a substance that specifically inhibits the expression of FOXA2 in treating head and neck squamous cell carcinoma or inhibiting the proliferation, migration or invasion of head and neck squamous cell carcinoma cells.

[0128] Embodiments of the present invention also relate to a method for treating head and neck squamous cell carcinoma, comprising administering to a patient an effective dose of a substance that specifically inhibits FOXA2 expression.

[0129] The embodiments of the present invention also relate to a method for inhibiting proliferation, migration or invasion of head and neck squamous cell carcinoma cells, comprising mixing an effective dose of a substance that specifically inhibits FOXA2 expression with the head and neck squamous cell carcinoma cells.

[0130] In a sixth aspect of the present invention, the present invention also provides a kit for diagnosing or evaluating the degree of differentiation and prognosis of head and neck squamous cell carcinoma, which comprises a reagent for detecting FOXA2. The kit has high accuracy and good repeatability in diagnosing, evaluating the degree of differentiation and evaluating prognosis of head and neck squamous cell carcinoma.

[0131] In some embodiments, the reagent is a reagent capable of detecting the expression level of FOXA2. In some embodiments, the reagent comprises a primer pair for amplifying FOXA2; the primer pair comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.2.

[0132] In some embodiments, the head and neck squamous cell carcinoma is oral squamous cell carcinoma or oral adenosquamous carcinoma. The drug combination or the diagnostic and evaluation kit of the present invention can effectively realize the diagnosis, differentiation degree assessment, prognosis assessment, and even treatment of oral squamous cell carcinoma and oral adenosquamous carcinoma.

[0133] Additional aspects and advantages of the present invention will be given in part in the following description and in part will be obvious from the following description, or will be learned through practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0134] Figure 1 The bioinformatics analysis results of TCGA-HNSCC patient tissues and healthy tissues in the embodiment are shown. Figure 1 A is the analysis result of FOXA2 expression level in HNSCC patients and normal tissues. Mann-Whitney test was used for significant difference analysis, *P<0.05; Figure 1 B is the survival analysis of HNSCC patients. The difference was analyzed by Log-rank test, P<0.001, HR=1.789.

[0135] Figure 2 The results of the detection of the expression of FOXA2 in clinical OSCC tissues in the embodiment are shown. Figure 2 A is the analysis result of FOXA2 expression level in OSCC patients and healthy tissues. Wilcoxon test was used for significant difference analysis, *P<0.05; Figure 2 B is the ROC curve.

[0136] Figure 3 The results of the detection of FOXA2 expression in HNSCC cell lines in the examples are shown. The significance of the difference was analyzed using multiple t-tests, *Padj<0.05, **Padj<0.01.

[0137] Figure 4The knockdown efficiency test results of FOXA2 in the embodiment are shown. The significant difference was analyzed by independent sample t test, **P<0.01.

[0138] Figure 5 The scratch test results of the HN6 cell line with knockdown of FOXA2 in the Example are shown. The significant difference was analyzed by independent sample t test, ***P<0.05, scale bar=50 μm.

[0139] Figure 6 The results of migration and invasion experiments of the HN6 cell line with knockdown of FOXA2 in the examples are shown. The significant difference was analyzed by independent sample t test, ***P<0.001, scale bar=250 μm.

[0140] Figure 7 The results of Western blotting for detecting the expression levels of EMT-related proteins in shNC and shFOXA2 cells in the Examples are shown. DETAILED DESCRIPTION

[0141] The following will clearly and completely describe the concept of the present application and the technical effects produced in combination with the embodiments, so as to fully understand the purpose, features and effects of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, not all of them. Based on the embodiments of the present application, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present application.

[0142] Embodiments of the present invention are described in detail below, examples of which are shown in the accompanying drawings, wherein the same or similar reference numerals throughout represent the same or similar elements or elements having the same or similar functions. The embodiments described below with reference to the accompanying drawings are exemplary and are intended to be used to explain the present invention, and should not be construed as limiting the present invention.

[0143] Example 1 FOXA2 is highly expressed in HNSCC patient tissues and HNSCC cell lines

[0144] The inventors downloaded transcriptome data of 523 HNSCC tissues and 44 normal tissues from The Cancer Genome Atlas (TCGA) and analyzed the expression level of FOXA2 using Graphpad Prism, and performed survival analysis on the FOXA2 expression levels of the 523 patients.

[0145] According to the diagnostic criteria for OSCC of the World Health Organization, approved by the Ethics Committee of Peking University Shenzhen Hospital, and after the patients themselves or their families agreed and signed the informed consent form, the cancer and adjacent normal mucosal tissues of 28 patients treated in the Department of Oral and Maxillofacial Surgery of Peking University Shenzhen Hospital were collected. The selection criteria for the patients were as follows: ① All patients were diagnosed based on histopathological results; ② All patients had complete follow-up data after surgery; ③ All patients underwent thorough primary lesion cleaning surgery and selective neck lymph node dissection; ④ All patients had not received preoperative radiotherapy or chemotherapy, and the patients themselves had no history of other systemic diseases such as rheumatoid arthritis, cardiovascular disease, diabetes, hyperthyroidism, or other tumor diseases. The pathological information of the patients is shown in Table 1.

[0146] After grinding the tissue, TRIzol reagent was used to extract total RNA from the patient's tissue, and reverse transcription reagent (Evo M-MLVRT Mix Kit with gDNAClean for qPCR, Cat.#AG11728) was used to obtain cDNA. Finally, qRT-PCR reagent (SYBR Green Premix Pro Taq HS qPCR Kit II, Cat.#AG11702) and Lightcycler480Ⅱ real-time fluorescence quantitative PCR instrument were used to detect the cycle threshold (Ct) of the internal reference gene (β-Actin) and FOXA2 in the patient's tissue. Finally, the 2-ΔΔCt formula was used to calculate the relative expression level of FOXA2 in each cancer tissue and adjacent tissue. The primer sequences are shown in Table 2.

[0147] Similarly, TRIzol and the above-mentioned reagents and instruments were used to detect the expression of FOXA2 in human normal oral cell line HOK, oral adenosquamous carcinoma cell line CAL27, and OSCC cell lines HSC3 and HN6. The qRT-PCR primer sequences are shown in Table 2.

[0148] Table 1 Clinical information of patients

[0149]

[0150] Table 2 qRT-PCR primer sequences

[0151]

[0152]

result

[0153] Analysis of TCGA data revealed that FOXA2 was more highly expressed in HNSCC tumor tissues compared with normal tissues ( Figure 1 A), among which, HNSCC patients with higher FOXA2 expression levels (n=262) had a lower survival rate ( Figure 1 B).

[0154] In clinical tissue samples, compared with adjacent normal tissues, the expression of FOXA2 in OSCC tissues was significantly increased ( Figure 2 A), the area under the ROC curve is 0.6171 ( Figure 2 B), HR = 1.789, indicating that FOXA2 has a certain diagnostic significance for OSCC. Consistently, FOXA2 is highly expressed in HNSCC cell lines ( Figure 3 ).

[0155] Example 2 Knockdown of FOXA2 inhibits the migration and invasion ability of HN6 cells

[0156] HN6 cells were infected with a lentivirus carrying a short hairpin RNA (shRNA) vector to construct a control cell line (shNC) and a stable cell line knocking down FOXA2 (shFOXA2), and the knockdown efficiency of FOXA2 was detected by qRT-PCR according to the primers in Table 2 in Example 1. The interference vector was a lentiviral vector purchased from Hanbio Biotech (Shanghai) Co., Ltd., and the shRNA sequence is shown in Table 3 below.

[0157] Table 3 shRNA sequences of lentiviral vectors

[0158]

[0159] In a 6-well plate (purchased from Corning), shNC and shFOXA2 cells were inoculated with DMEM medium (purchased from Thermo Fisher Scientific) and cultured. When the cell coverage was 100%, the tip of the gun was perpendicular to the bottom of the well plate to scrape a uniform scratch. After culturing for 24 hours, the migration of cells at the scratch was observed under a microscope and photographed. The scratch area was calculated using Image J, and the cell migration rate (%) = (initial scratch area - scratch area at time t) / initial scratch area × 100%. Graphpad prism software was used to draw statistical graphs and perform statistical analysis.

[0160] shNC and shFOXA2 cells suspended in serum-free DMEM were inoculated in Transwell chambers (purchased from Corning, 8.0 μm pore size polycarbonate membrane), and DMEM containing 10% serum was added under the chamber. After culturing in an incubator (37°C, 5% CO2) for 24 h, the cells were washed 2-3 times with PBS and fixed with 10% paraformaldehyde, then stained with 1% crystal violet solution, and finally the dye was rinsed off and the residual dye in the chamber was wiped off with a cotton swab. The images were taken under a microscope (Leica, Germany), and the number of migrated cells was calculated using Image J software. Graphpad prism software was used to draw statistical graphs and perform statistical analysis.

[0161] Add basement membrane matrix (purchased from Corning, 356234) to the bottom of the Transwell chamber. After drying the matrix gel, inoculate shNC and shFOXA2 cells suspended in serum-free DMEM, and add DMEM containing 10% serum to the bottom of the chamber. After culturing in an incubator (37°C, 5% CO2) for 48 hours, wash 2-3 times with PBS and fix the cells with 10% paraformaldehyde, then stain with 1% crystal violet solution, finally rinse off the dye and wipe the residual dye in the chamber with a cotton swab. The number of migrated cells was calculated using ImageJ software after being photographed under a microscope. Graphpad prism software was used to draw statistical graphs and perform statistical analysis.

[0162]

result

[0163] like Figure 4 , the expression level of FOXA2 in the stably transfected cell lines was significantly reduced. Figure 5 ) and Transwell assay ( Figure 6 ), compared with the control group, knockdown of FOXA2 inhibited the migration ability of HN6 cells; in the invasion assay ( Figure 6 ), compared with the control cells, knockdown of FOXA2 inhibited the invasion ability of HN6 cells.

[0164] Example 3 Silencing of FOXA2 inhibits EMT

[0165] The cultured shNC and shFOXA2 cells were scraped with a cell scraper, transferred to a centrifuge tube, centrifuged (1000 rpm, 3 min), and the supernatant was discarded. RIPA lysis buffer (purchased from Millipore) and protease inhibitors (purchased from Beyotime) were added, incubated on ice for 30 min, and then centrifuged (12000 rpm, 15 min); the total protein solution in the upper layer was aspirated and transferred to a new centrifuge tube, SDS-PAGE protein loading buffer (purchased from Biosharp) was added, and the protein sample was prepared by incubation at 100°C for 5 min.

[0166] The protein sample was added to a protein precast gel (purchased from ACE), and protein electrophoresis was performed at 180V using a Biorad electrophoresis device, followed by electrophoresis at 400mA and 50min using a 0.2μm PVDF membrane (purchased from Millipore), ACE electrotransfer solution, and a Biorad electrotransfer device. The PVDF membrane was blocked with a 5% skim milk powder (purchased from Sangon)-TBST solution, and the primary antibody was incubated overnight at 4°C. After the primary antibody was washed off with TBST, the secondary antibody was incubated at room temperature for 1-2h, and after the secondary antibody was washed off with TBST (purchased from Solarbio), the PVDF membrane was developed and photographed using an ECL chemiluminescent substrate (purchased from Biosharp) and an Amersham ImageQuant800. developer (GE, USA).

[0167] Antibodies used: internal control GAPDH (Bioss, bs-10900R), FOXA2 (Proteintech, 22474-1-AP), MMP3 (Cell Signaling Technology, 14351), Slug (Proteintech, 12129-1-AP), Snail (Proteintech, 61367), Smad4 (Proteintech, 10231-1-AP), Smad2 / 3 (Cell Signaling Technology, 8685) and phosphorylated Smad2 / 3 (Cell Signaling Technology, 8828).

[0168]

result

[0169] Western blotting was used to detect the expression levels of epithelial-mesenchymal transition (EMT)-related proteins. The results showed that compared with the control group, the expression levels of MMP3, Slug, Snail, Smad4, Smad2 / 3 and phosphorylated Smad2 / 3 in HN6 cells with silencing of FOXA2 were reduced, indicating that silencing of FOXA2 inhibited the EMT process of HN6 cells, thereby inhibiting the progression of OSCC. Among them, MMP3 is matrix metalloproteinases3; Slug is Snail Family Transcriptional Repressor 2; Snail is snail family transcriptionalrepressor1; Smad is Mothers Against Decapentaplegic Homolog; P-Smad2 / 3 is phosphorylated Smad; GAPDH is Glyceraldehyde-3-Phosphate Dehydrogenase.

[0170] Based on the above results, it can be seen that the expression of FOXA2 is tissue-specific, and the expression of FOXA2 is significantly upregulated in tumor tissues and OSCC cells of OSCC patients; at the same time, FOXA2 has a regulatory effect on the proliferation, migration and invasion of OSCC cells. Therefore, FOXA2 plays an important regulatory role in the occurrence and development of OSCC and HNSCC, and is expected to become an effective clinical diagnostic marker and targeted therapeutic drug for OSCC and HNSCC.

[0171] Example 4 Diagnostic Experiment

[0172] According to the method and selection criteria of Example 1, multiple OSCC patients and normal subjects were enrolled, and cancer tissues of patients and oral mucosal tissue samples of normal subjects were collected to detect the relative expression level of FOXA2. The results showed that the relative expression level of the patient group was significantly higher than that of the control group of normal subjects, and the difference was statistically significant (p<0.05); the ROC curve showed that the AUC value was greater than 0.7. These results further demonstrated the diagnostic ability of FOXA2 for OSCC.

[0173] In addition, the terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined as "first" and "second" may explicitly or implicitly include at least one of the features. In the description of the present invention, the meaning of "plurality" is at least two, such as two, three, etc., unless otherwise clearly and specifically defined.

[0174] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, unless they are contradictory.

[0175] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. Use of a reagent for detecting FOXA2 in the preparation of a kit for diagnosis or differentiation assessment and prognosis assessment of head and neck squamous cell carcinoma.

2. The use according to claim 1, wherein the reagent is a reagent capable of detecting the expression level of FOXA2.

3. The use according to claim 1, wherein the reagent comprises a primer pair for amplifying FOXA2; the primer pair comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.

2.

4. The use according to claim 1, characterized in that: The kit also includes an RNA extraction reagent and a reverse transcription reagent. Optionally, the head and neck squamous cell carcinoma is oral squamous cell carcinoma or oral adenosquamous carcinoma.

5. A kit for diagnosis, differentiation assessment, or prognosis assessment of head and neck squamous cell carcinoma, characterized in that: Contains reagents for detecting FOXA2. The kit according to claim 5 , wherein the reagent is a reagent capable of detecting the expression level of FOXA2.

7. The kit according to claim 5, wherein the reagents include a primer pair for amplifying FOXA2; the primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.2, Optionally, the head and neck squamous cell carcinoma is oral squamous cell carcinoma or oral adenosquamous carcinoma.

8. Use of a substance that specifically inhibits FOXA2 expression in the preparation of a drug for inhibiting the proliferation, migration or invasion of head and neck squamous cell carcinoma cells.

9. The use according to claim 8, wherein the substance comprises shRNA of FOXA2.

10. The use according to claim 9, wherein the nucleotide sequences of the Top strand and the Bottom strand of the shRNA are shown in SEQ ID NO.7 and SEQ ID NO.8, respectively. Optionally, the head and neck squamous cell carcinoma is oral squamous cell carcinoma or oral adenosquamous carcinoma.

Images