A diagnostic biomarker for oral squamous cell carcinoma hsa-miR-331-3p and its application
By detecting the expression levels of specific miRNAs, a kit for diagnosing oral squamous cell carcinoma was developed, and using hsa-miR-331-3p inhibitor as a therapeutic target, solving diagnostic and treatment difficulties in the prior art, improving diagnostic accuracy and providing new treatment options.
Patent Information
- Application Number
- CN202411441126.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-16
- Publication Date
- 2025-04-18
- Estimated Expiration
- 2044-10-16
AI Technical Summary
The prior art is difficult to effectively diagnose and treat oral squamous cell carcinoma, and there is a lack of effective molecular markers and therapeutic targets.
By detecting the expression levels of miRNAs such as hsa-miR-331-3p, hsa-miR-642a-5p and hsa-miR-1282, kits were developed for the diagnosis of oral squamous cell carcinoma, and hsa-miR-331-3p inhibitors were used as potential therapeutic targets.
It improves the diagnostic accuracy of oral squamous cell carcinoma and shows that hsa-miR-331-3p inhibitor can significantly inhibit the proliferation and invasion of cancer cells, providing a new therapeutic target.
Smart Images
Figure CN119040464B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of tumor diagnosis and molecular targeted therapy, and more specifically, to an application of hsa-miR-331-3p in clinical diagnosis of oral squamous cell carcinoma and as a target for treating oral squamous cell carcinoma. Background Art
[0002] Oral squamous cell carcinoma (OSCC) is one of the most common malignant tumors of the head and neck, accounting for 90% of head and neck cancers. OSCC can occur in any part of the oral cavity, such as the tongue, gums, floor of mouth, palate, and buccal mucosa. The occurrence of OSCC is related to a variety of bad habits and eating habits, such as smoking, drinking, and chewing betel nut. In view of the latest progress in molecular biology research, it has been found that the occurrence and development of OSCC are related to the activation of oncogenes such as Bcl-2, c-Myc, and EGFR, and the inactivation of Rb, p16, and p53. The treatment of OSCC is mainly surgical treatment combined with adjuvant therapy such as radiotherapy or chemotherapy. Despite the progress of these clinical therapies, its long-term survival rate is still not optimistic. At present, the need for molecular markers for the diagnosis and prognosis of OSCC has always been an urgent problem to be solved in the clinic. Although there are many studies on genomics and proteomics of OSCC, due to the complexity and heterogeneity of solid tumors, there are currently no effective OSCC molecular markers for clinical application. Finding biomarkers related to OSCC and exploring the molecular mechanisms of its occurrence and development may provide new therapeutic targets for OSCC treatment.
[0003] miRNA is a type of endogenous non-coding RNA with a length of about 22 nt. It binds to the target mRNA sequence through complementary base pairing, inhibits the translation of the target mRNA or promotes the degradation of the target mRNA, thereby regulating the gene post-transcriptionally. Previous studies have shown that abnormal miRNA expression has been found in a variety of malignant tumors. hsa-miR-331-3p and hsa-miR-642a-5p are upregulated in the serum of OSCC patients, and hsa-miR-1282 is downregulated in the serum of OSCC patients. It can be used as a biomarker for the diagnosis and prognosis of OSCC, and further, it may become a potential target for the treatment of OSCC. Therefore, it is necessary to further study hsa-miR-331-3p, hsa-miR-642a-5p and hsa-miR-1282. Summary of the invention
[0004] The technical problem to be solved by the present invention is to improve the accuracy of diagnosis of oral squamous cell carcinoma and to provide a diagnostic kit and a therapeutic reagent for diagnosing oral squamous cell carcinoma.
[0005] To achieve the above objectives, the present invention provides an application of a reagent for detecting biomarkers in the preparation of a product for diagnosing oral squamous cell carcinoma, wherein the reagent for detecting biomarkers comprises a reagent for detecting one or more of hsa-miR-331-3p, hsa-miR-642a-5p and hsa-miR-1282.
[0006] In a preferred embodiment of the present invention, the present invention provides an application of a reagent for detecting a biomarker in the preparation of a product for diagnosing oral squamous cell carcinoma, wherein the reagent for detecting a biomarker comprises a reagent for detecting hsa-miR-331-3p.
[0007] Preferably, the reagents for detecting biomarkers also include reagents for detecting hsa-miR-642a-5p and / or hsa-miR-1282.
[0008] Preferably, the hsa-miR-331-3p, hsa-miR-642a-5p and hsa-miR-1282 are derived from serum samples or cancer tissues.
[0009] Preferably, the product is a kit.
[0010] Preferably, the reagents for detecting hsa-miR-331-3p, hsa-miR-642a-5p and hsa-miR-1282 are primers, the upstream primer for detecting hsa-miR-331-3p is shown in SEQ ID NO: 2, the upstream primer for detecting hsa-miR-642a-5p is shown in SEQ ID NO: 3, the upstream primer for detecting hsa-miR-1282 is shown in SEQ ID NO: 4, and the downstream universal primer for detecting hsa-miR-331-3p, hsa-miR-642a-5p and hsa-miR-1282 is shown in SEQ ID NO: 5.
[0011] In another preferred embodiment of the present invention, the present invention provides an application of an hsa-miR-331-3p inhibitor in the preparation of a drug for treating OSCC.
[0012] Preferably, the hsa-miR-331-3p inhibitor is an antisense oligonucleotide thereof.
[0013] Preferably, the hsa-miR-331-3p inhibitor is an oligonucleotide as shown in SEQ ID NO:7.
[0014] The technical effects of the present invention are as follows:
[0015] (1) The present invention found that hsa-miR-331-3p is significantly overexpressed in oral squamous cell carcinoma and can be used as a potential biomarker for oral squamous cell carcinoma;
[0016] (2) The present invention found that hsa-miR-331-3p can significantly inhibit the proliferation and invasion of oral squamous cell carcinoma cells after down-regulation of expression, and can be used as a potential target for the treatment of oral squamous cell carcinoma.
[0017] The concept, specific structure and technical effects of the present invention will be further described below in conjunction with the accompanying drawings to fully understand the purpose, characteristics and effects of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 This is a volcano map of oral squamous cell carcinoma biomarkers screened by the GEO online database.
[0019] Figure 2 is the ROC curve of the expression levels of miR-331-3p, miR-642a-5p, and miR-1282 in serum samples from 52 patients with oral squamous cell carcinoma and 40 healthy volunteers.
[0020] Figure 3 is a box plot of the expression level of miR-331-3p in oral squamous cell carcinoma tissues and adjacent tissues of 52 patients with oral squamous cell carcinoma.
[0021] Figure 4 This is a graph showing the effects of overexpression and silencing of miR-331-3p on the proliferation ability of SCC25 cells.
[0022] Figure 5 This is a graph showing the effect of silencing miR-331-3p on the invasion ability of SCC25 cells.
[0023] FIG. 6 is a graph showing the effect of silencing miR-331-3p on the molecular levels of the EMT pathway in SCC25 cells.
[0024] Figure 7 This figure shows the in vivo study results of silencing miR-331-3p on oral squamous cell carcinoma. DETAILED DESCRIPTION
[0025] The following describes several preferred embodiments of the present invention with reference to the drawings in the specification, so that the technical content is clearer and easier to understand. The present invention can be embodied in many different forms of embodiments, and the protection scope of the present invention is not limited to the embodiments mentioned in the text.
[0026] Example 1: miR-331-3p and miR-642a-5p are upregulated in oral squamous cell carcinoma, and miR-1282 is downregulated in oral squamous cell carcinoma
[0027] Fifteen healthy volunteers in the GSE113956 dataset were used as controls, and 25 oral squamous cell carcinoma patients were used as the oral squamous cell carcinoma group. The differentially expressed miRNAs in the two groups of samples were screened under the conditions of log2FC>2 and P<0.05, and the differentially expressed miRNA data of oral squamous cell carcinoma were visualized and analyzed.
[0028] like Figure 1 As shown in the volcano plot, from the 2050 candidate miRNAs, a total of 531 differentially expressed miRNAs (fold change>2, P<0.05) were obtained according to the screening conditions of the present invention, of which 364 were significantly upregulated and 167 were downregulated in the oral squamous cell carcinoma group, among which miR-331-3p, miR-642a-5p and miR-1282 were taken as potential oral squamous cell carcinoma biomarkers of interest for further study.
[0029] Example 2: Expression levels of miR-331-3p, miR-642a-5p and miR-1282 in the serum of oral squamous cell carcinoma patients and healthy subjects
[0030] With the patients' informed consent, serum samples from 52 clinical OSCC patients were collected before surgery and stored in a -80°C refrigerator for future use. Serum samples from 40 healthy volunteers were also collected and stored in a -80°C refrigerator for future use.
[0031] The expression levels of miR-331-3p, miR-642a-5p, and miR-1282 were detected in serum samples of 52 OSCC patients and 40 healthy volunteers, and the ROC curves were drawn.
[0032] Primer design The sequence information of miR-331-3p, miR-642a-5p and miR-1282 was searched in miRBase, and primers were designed using the neck loop method based on the obtained sequence information. The neck loop sequence (5'-3') is as follows: GTCGTATCCAGTGCAGGGTCCGAGGTATTTCGCACTGGATACGAC (SEQ ID NO: 1). The primer sequences are as follows:
[0033] Table 1: RT-qPCR primer list
[0034]
[0035] The RNA concentration and quality of the serum of patients with oral squamous cell carcinoma and healthy subjects were detected using the Nanodrop2000 ultra-micro spectrophotometer, and the integrity of the extracted RNA was ensured by agarose quality inspection. The collar method was used to reverse transcribe the first-strand cDNA of miRNA, and the primers used were the same as in Example 2. PCR amplification was performed in the Thermal QuantStudio 5 real-time fluorescence quantitative PCR system. The qPCR reaction was performed using the kit 2×Universal HotStart SYBR qPCR Master Mix, and the reaction system was as follows:
[0036] Table 2: qRT-PCR reaction system
[0037]
[0038] After the above components are mixed evenly, the following procedures are followed: stage 1: react at 95°C for 30 seconds; stage 2: react at 95°C for 10 seconds, and react at 60°C for 34 seconds (40 cycles).
[0039] like Figure 2A -C, the AUC area of miR-331-3p, which is specifically highly expressed in patients with oral squamous cell carcinoma, was the highest, which was 0.816. The AUCs of miR-642a-5p and miR-1282 were 0.742 and 0.687, respectively. The sensitivity and specificity were both higher than 70%. MiR-331-3p, miR-642a-5p, miR-1282 or their combination can be used as biomarkers for the diagnosis of oral squamous cell carcinoma.
[0040] Example 3 Analysis of miR-331-3p expression levels in tumor tissues and normal adjacent tissues of patients with oral squamous cell carcinoma
[0041] Oral squamous cell carcinoma and adjacent tissue specimens were collected from 52 patients with OSCC during surgery, washed with saline, and preserved.
[0042] Real-time quantitative PCR was used to detect the expression of miR-331-3p in oral squamous cell carcinoma and adjacent tissues.
[0043] The primer design and specific detection method are the same as in Example 2.
[0044] After the reaction, the amplification curve and melting curve of PCR were confirmed, and the 2-ΔΔCT method was used for relative quantification to detect the expression level of miR-331-3p. Figure 3 As shown in the figure, the expression level of miR-331-3p was significantly higher than that in normal adjacent cancer tissues.
[0045] Example 4 Effects of overexpression and silencing of miR-331-3p on the proliferation ability of SCC25 cells
[0046] miR-331-3p mimics (GCCCCUGGGCCUAUCCUAGAA) and miR-331-3p inhibitor (CGGGGACCCGGAUAGGAUCUU) were synthesized. The nucleotide sequence of miR-331-3p mimics is shown in SEQ ID NO:6, and the nucleotide sequence of miR-331-3p inhibitor is shown in SEQ ID NO:7.
[0047] Oral squamous cell carcinoma cells SCC25 and human oral epithelial HOEC were cultured in an incubator at 37°C and 5% CO2 until the density reached 90%, then digested and collected with trypsin and prepared into a cell suspension. The cell concentration was adjusted to 2.0×10 4 / mL, the cell suspension was inoculated in a well plate, SCC25 was transfected with miR-331-3p mimics and miR-331-3p inhibitor, and cultured in a 37°C, 5% CO2 incubator. Cell activity was detected by CCK-8 after 0h, 24h, 48h and 72h of culture. The absorbance was measured with an ELISA reader at a detection wavelength of 450nm and a reference wavelength of 650nm, and the growth inhibition rate (PI) was calculated. The experiment was repeated 3 times independently, and the results obtained were expressed as mean±SD, and statistical T test was performed. *P<0.05 was a significant difference, and **P<0.01 was a very significant difference.
[0048] like Figure 4 As shown, overexpression of miR-331-3p significantly promoted the proliferation of SCC25 cells, while silencing miR-331-3p had a significant inhibitory effect on SCC25 cells, indicating that miR-331-3p has the ability to promote the proliferation of oral squamous cell carcinoma cells in vitro, and knocking down miR-331-3p can treat oral squamous cell carcinoma cells.
[0049] Example 5 Effect of silencing miR-331-3p on the invasion ability of SCC25 cells
[0050] Dilute Matrigel with culture medium, apply it on the transwell chamber membrane, and air dry. Digest SCC25 cells in the logarithmic phase with trypsin and resuspend. 5The cells were inoculated into the transwell chamber at a concentration of 100 μL / mL, and complete culture medium was added to the lower chamber of the transwell to stimulate cell invasion. The cells were cultured at 5% CO2 and 37°C for 24 h. The cells were fixed with 90% alcohol and stained with crystal violet. Three fields of view were selected under a microscope to take pictures and count, and the invasion inhibition rate was calculated. The experiment was repeated 3 times independently, and the results were calculated as mean ± SD, and statistical t-tests were performed. *P < 0.05 was a significant difference, and **P < 0.01 was an extremely significant difference.
[0051] like Figure 5 As shown in the results, the number of SCC25 cell invasion was significantly reduced after silencing miR-331-3p, which indicates that silencing miR-331-3p can alleviate the cell invasion of oral squamous cell carcinoma.
[0052] Example 6 Study on the mechanism of silencing miR-331-3p inhibiting the invasion ability of SCC25 cells
[0053] EMT is a complex cell biological process, a reversible and dynamic cell phenotypic change produced by tumor cells in order to invade and spread to distant tissues and subsequently form metastatic lesions. During the EMT process, cancer cells acquire some mesenchymal characteristics, including motility, invasiveness, and some stem cell properties. The expression level of SNAI1, a key regulator of EMT, at the mRNA level, as well as the expression levels of epithelial marker E-cadherin and mesenchymal marker N-cadherin were detected after silencing miR-331-3p. The experiment was repeated 3 times independently, and the results obtained from the experiment were calculated as mean±SD, and statistical t-tests were performed. *P<0.05 was a significant difference, and **P<0.01 was an extremely significant difference.
[0054] After silencing miR-331-3p, Fig. 6A As shown, the mRNA expression level of SNAI1 was significantly increased. Figure 6B As shown in the results, the expression level of E-cadherin increased and the expression level of N-cadherin decreased, which also confirmed that silencing miR-331-3p can inhibit the invasion of oral squamous cell carcinoma cells.
[0055] Example 7 In vivo study on the inhibition of oral squamous cell carcinoma by silencing miR-331-3p
[0056] Nude mice aged 4-6 weeks were raised in an SPF animal breeding room for 1 week, and SCC25 and SCC25 with silenced miR-331-3p were inoculated subcutaneously into the mice to construct a transplant mouse model. The mice were continued to be raised under the same conditions. After 35 days, the subcutaneous tumors of the mice were removed and the tumors were evaluated. The experiment was repeated 3 times independently, and the results of the experiment were calculated as mean±SD, and statistical t-tests were performed. *P<0.05 was a significant difference, and **P<0.01 was an extremely significant difference.
[0057] like Figure 7 As shown, the results of in vivo studies in transplanted mice showed that the proliferation activity of tumors was significantly inhibited after silencing miR-331-3p, proving that inhibiting miR-331-3p expression can be used to treat oral squamous cell carcinoma.
[0058] The preferred specific embodiments of the present invention are described in detail above. It should be understood that ordinary technicians in the field can make many modifications and changes based on the concept of the present invention without creative work. Therefore, all technical solutions that can be obtained by technicians in the technical field based on the concept of the present invention through logical analysis, reasoning or limited experiments on the basis of the prior art should be within the scope of protection determined by the claims.
Claims
1. Use of a reagent for detecting biomarkers in the preparation of a product for diagnosing oral squamous cell carcinoma, characterized in that: The reagents for detecting biomarkers include reagents for detecting miR-1282.
2. The use according to claim 1, characterized in that: The miR-1282 is derived from serum samples or cancer tissues.
3. The use according to claim 2, characterized in that: The product is a test kit.
4. The use according to claim 1, characterized in that: The reagent for detecting miR-1282 is a primer, the upstream primer for detecting miR-1282 is shown as SEQ ID NO:4, and the downstream universal primer for detecting miR-1282 is shown as SEQ ID NO:5.