A recombinant Corynebacterium glutamicum with high 1,3-propanediol production and its construction method and use

Abstract

The present invention relates to a recombinant Corynebacterium glutamicum with high yield of 1,3-propylene glycol, wherein the recombinant Corynebacterium glutamicum can overexpress the following genes: deaminase gene AAD, decarboxylase gene KDC, and aldehyde reductase gene yqhD. The present invention enables Corynebacterium glutamicum to overexpress AAD gene, KDC gene and yqhD gene, and enhances the expression amount of homoserine synthesis pathway related enzyme genes, so that in the process of fermentation and production of 1,3-propylene glycol, the yield in the shake flask stage is as high as 6.7g / L, the yield in the fermentation tank is as high as 54.3g / L, the fermentation cost is low and the yield is high, the benefit of producing 1,3-propylene glycol is maximized, and it is suitable for practical promotion and application.

Description

Technical Field

[0001] The invention belongs to the technical field of gene recombination fermentation, and specifically relates to a recombinant Corynebacterium glutamicum capable of producing high 1,3-propanediol, and a construction method and application thereof. Background Art

[0002] 1,3-Propanediol (1,3-PDO) is an important organic chemical raw material. It can be used as an organic solvent in inks, printing and dyeing, coatings, lubricants, antifreeze agents and other process fields. It can also be used in the synthesis of various drugs, new polyester PTT, pharmaceutical intermediates, cosmetics and new antioxidants. It is a raw material for the production of unsaturated polyesters, plasticizers, surfactants, emulsifiers and demulsifiers, and has broad market prospects.

[0003] The preparation methods of 1,3-propylene glycol mainly include chemical synthesis and microbial fermentation. Since the chemical synthesis method has many by-products, poor selectivity, and high temperature and high pressure reaction conditions when preparing 1,3-PDO, it will lead to high production costs and cause environmental pollution. Therefore, the efficient and clean microbial fermentation method has gradually replaced the chemical synthesis method to produce 1,3-PDO.

[0004] At present, the main metabolic pathway for the production of 1,3-PDO by biological fermentation is that glycerol is dehydrated to produce 3-hydroxypropionaldehyde, which is reduced to form 1,3-propanediol. The corresponding technical routes are divided into two types: 1. Using natural microorganisms (such as Klebsiella pneumoniae) to produce 1,3-PDO with glycerol as raw material; 2. Using recombinant microorganisms (such as Escherichia coli) to express exogenous pathways, first glucose is produced through the glycolysis pathway to produce DHAP and then reduced to produce glycerol, which is then dehydrated and reduced to produce 1,3-PDO. Compared with the first technical route, the second technical route has a relatively simple product, high yield, and high biosafety. However, glycerol dehydratase requires vitamin B12 as a cofactor for activation. Recombinant microorganisms often do not have the ability to synthesize VB12, and need to be added exogenously during the fermentation process, which greatly increases the production cost. It is necessary to provide a low-cost and high-yield microbial fermentation method for actual 1,3-propanediol production. Summary of the invention

[0005] To solve the above problems, the present invention provides a recombinant Corynebacterium glutamicum that produces high 1,3-propylene glycol, having the following characteristics: Figure 6 The synthetic pathway of the recombinant Corynebacterium glutamicum can overexpress the following genes:

[0006] 1) Deaminase gene AAD, which converts homoserine into 4-hydroxy-2-oxobutyrate;

[0007] 2) decarboxylase gene KDC, which converts 4-hydroxy-2-oxobutyric acid into 3-hydroxypropanal;

[0008] 3) Aldehyde reductase gene yqhD, which converts 3-hydroxypropionaldehyde into 1,3-PDO;

[0009] The nucleotide sequence of the deaminase gene AAD is shown in SEQ ID NO.1;

[0010] The nucleotide sequence of the decarboxylase gene KDC is shown in SEQ ID NO.2;

[0011] The nucleotide sequence of the aldehyde reductase gene yqhD is shown in SEQ ID NO.3.

[0012] Furthermore, the expression levels of enzyme genes related to the homoserine synthesis pathway in the recombinant Corynebacterium glutamicum are enhanced;

[0013] The homoserine synthesis pathway-related enzyme genes include aspartate aminotransferase gene aspB, aspartate kinase gene lysC, aspartate semialdehyde dehydrogenase gene asd and homoserine dehydrogenase gene thrA;

[0014] The index number of the aspartate aminotransferase gene aspB in the KEGG database is cg0294;

[0015] The index number of the aspartate kinase gene lysC in the KEGG database is cg0306;

[0016] The index number of the aspartate semialdehyde dehydrogenase gene asd in the KEGG database is cg0307;

[0017] The index number of the homoserine dehydrogenase gene thrA in the KEGG database is cg1337;

[0018] The expression enhancement is achieved by inserting a strong promoter Psod such as the nucleotide sequence shown in SEQ ID NO.4 before the gene or gene cluster.

[0019] The Corynebacterium glutamicum is Corynebacterium glutamicum ATCC13032.

[0020] The present invention also provides a method for preparing the aforementioned recombinant Corynebacterium glutamicum, comprising the following steps:

[0021] 1) Take Corynebacterium glutamicum ATCC13032, introduce the recombinant plasmid, eliminate the plasmid vector and kanamycin resistance after verification, and repeat this process to obtain the recombinant bacteria;

[0022] The introduced recombinant plasmids were pK18mobsacB-Psod-aspB, pK18mobsacB-Psod-lysC-asd, and pK18mobsacB-Psod-thrA;

[0023] 2) taking the recombinant bacteria obtained in step 1), introducing the overexpression plasmids pEC-XK99E-AAD-KDC and pXMJ19-yqhD to obtain 1,3-PDO production engineering bacteria;

[0024] The plasmid map of the recombinant plasmid pK18mobsacB-Psod-aspB is as follows Figure 1 The plasmid map of pK18mobsacB-Psod-lysC-asd is shown in Figure 2 The plasmid map of pK18mobsacB-Psod-thrA is shown in Figure 3 The plasmid map of pEC-XK99E-AAD-KDC is shown in Figure 4 The plasmid map of pXMJ19-yqhD is shown in Figure 5 shown.

[0025] The present invention also provides a use of the aforementioned recombinant Corynebacterium glutamicum in fermentation production of 1,3-propanediol, microbial genetic breeding and / or improving the ability to biosynthesize 1,3-PDO.

[0026] Finally, the present invention provides a method for producing 1,3-propanediol by fermentation, which comprises using the aforementioned Corynebacterium glutamicum to perform shake flask fermentation or fermentation tank fermentation.

[0027] Furthermore, the shake flask fermentation comprises the following steps:

[0028] The aforementioned Corynebacterium glutamicum engineering production bacteria were inoculated into LB liquid culture medium containing kanamycin, chloramphenicol and glucose for 10 to 20 hours to obtain seed liquid; the seed liquid was inoculated into fermentation medium for 2 to 8 hours, and then IPTG was added for induction culture for 24 to 72 hours, the fermentation liquid was collected, the supernatant was obtained by centrifugation, and the 1,3-PDO yield was detected after filtration.

[0029] Further, the LB liquid culture medium contains 15 μg / mL kanamycin, 10 μg / mL chloramphenicol and 20 g / L glucose;

[0030] The inoculation amount of the seed solution was 1%, and IPTG was added to a final concentration of 100 μM;

[0031] The culture conditions are a temperature of 30°C and a rotation speed of 200 rpm;

[0032] The fermentation medium formula is: glucose 40g / L, yeast powder 5g / L, urea 5g / L, KH2PO43g / L, Na2HPO4·3H2O 5g / L, NaCl 0.5g / L, NH4Cl 1g / L, thiamine hydrochloride 1g / L, biotin 0.1g / L, kanamycin 15μg / mL, chloramphenicol 10μg / mL.

[0033] Furthermore, the fermentation in the fermenter comprises the following steps:

[0034] The aforementioned Corynebacterium glutamicum engineered production bacteria were inoculated into a seed culture medium and cultured for 12 to 36 hours; the seed solution was inoculated into a fermentation medium and cultured for more than 72 hours. During this period, when the glucose concentration dropped to 1 g / L, feed culture medium was added and the residual glucose concentration was adjusted to above 1 g / L.

[0035] Further, the inoculation amount of the seed solution is 10%; the culture conditions are: temperature 30°C, pH value of the fermentation solution is maintained at 7.0 by adding 25% ammonia water, and air flow rate is maintained at 1.0 vvm;

[0036] The formula of the fermentation feed medium is: 500g / L glucose, 9g / L KH2PO4, 2.5g / LMgSO4, 3.5g / LK2SO4, 0.28g / L Na2SO4, 10ml / L micronutrient solution;

[0037] The formula of the feed medium is: 10.2g / L ZnSO4·7H2O, 0.50g / L MnCl2·4H2O, 0.5g / L CuSO4, 0.86g / L CoCl2·6H2O, 0.56g / L Na2MoO4·2H2O, 3.84g / L CaCl2·2H2O, 5.12g / LFeSO4·7H2O, 0.05g / L biotin, 1g / L thiamine hydrochloride, and 1g / L nicotinic acid.

[0038] The recombinant Corynebacterium glutamicum with high 1,3-propylene glycol production of the present invention enables the Corynebacterium glutamicum to overexpress AAD gene, KDC gene and yqhD gene and enhance the expression of homoserine biosynthesis pathway related enzyme genes, so that during the fermentation process of producing 1,3-propylene glycol, the yield in the shake flask stage is as high as 6.7 g / L, and the yield in the fermenter is as high as 54.3 g / L. The fermentation cost is low and the yield is high, the benefit of producing 1,3-propylene glycol is maximized, and the plant is suitable for practical promotion and application.

[0039] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0040] The above contents of the present invention are further described in detail below through specific implementation modes in the form of embodiments, but it should not be understood that the scope of the above subject matter of the present invention is limited to the following examples. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 pK18mobsacB-Psod-aspB Plasmid Map

[0042] Figure 2 pK18mobsacB-Psod-lysC-asd plasmid map

[0043] Figure 3 pK18mobsacB-Psod-thrA plasmid map

[0044] Figure 4 pEC-XK99E-AAD-KDC Plasmid Map

[0045] Figure 5 pXMJ19-yqhD Plasmid Map

[0046] Figure 6 1,3-PDO biosynthetic pathway DETAILED DESCRIPTION

[0047] The amino acid or nucleotide sequence information involved in the present invention

[0048] (I) Nucleotide sequence

[0049] Nucleotide sequence of deaminase gene (AAD) (SEQ ID NO.1)

[0050] ATGAAGATCTCCCGTCGCAAGCTGCTGCTCGGCGTTGGCGCAGCAGGC

[0051] GTTTTGGCAGGCGGTGCAGCACTGGTGCCAATGGTTCCGCCGTGATGGC

[0052] AAGTTCGTGGAAGCAAAGTCCCGTGCATCCTTCGTCGAAGGCACCGAA

[0053] GGCGCACTGCCAAAGGCATCCGATGCAGTGATCATCGGTGGCGGTATCC

[0054] AGGGCATCATGACCGCAATCAACCTGGCAGAACGCGGTATGTCCGTGA

[0055] CCATCCTGGAAAAGGGCGAAATCGGTGGTGAACAGTCCGGTCGCGCTT

[0056] ACTCCCAGATCATCTCCTACCAGACCTCTCCAGAAATCTTCCCACTGCA

[0057] CCACTACGGCAAGATCCTGTGGCGTGGCATGAACGAAAAGATCGGTGC

[0058] AGATACCTCCTATCGCACCCAGGGTCGCGTGGAAGCCCTGGCAGATGA

[0059] AAAGGCATTCGATAAGGCACAGGCATGGATCAAGACCGCAAAGGGCTC

[0060] CGCAGGCTTCGATACCCCACTGAACACCCGCATCATCAAGGGCGAAGA

[0061] ACTGTCCAACCGCCTGGTTGGCGCACAGACCCCATGGACCGTGGCAGC

[0062] ATTCGAAGAGGATTCCGGCTCCGTGGATCCAGAAACCGGCACTCCAGC

[0063] ACTGGCACGCTACGCAAAGCAGATCGGCGTGAAGATCTACACCAACTG

[0064] CGCTGTTCGCGGTATCGAAACCGCAGGCGGTAAGATCTCCGATGTGGT

[0065] GACCGAAAAGGGTGCAATCCGCACCTCTCACGTGGTGCTGGCTGGCGG

[0066] TATTTGGTCCCGCTTGTTCATGGGCAACATGGGCATCGATATCCCAACCT

[0067] TGAACGTGTACTTGTCCCAGCAGCGCGTGTCCGGTGTGCCAGGTGCAC

[0068] CACGCGGTAACGTGCACCTTCCAAACGGCATCCACTTCCGCGAGCAGG

[0069] CAGATGGCACCTACGCCGTGGCTCCTCGTATCTTCACCTCCTCTATCGTG

[0070] AAGGATTCCTTCCTGCTGGGTCCAAAGTTCATGCACTTGCTTGGCGGTG

[0071] GCGAACTGCCACTGGAATTCTCCATCGGCGAAGATCTCTTCAACTCCTT

[0072] CAAGATGGCAACCTCCTGGAAGCTGGATGAAAAGACCCCATTCGAACA

[0073] GTACCGCATTGCAACCGCAACTCAGAACACCGAACACCTGGATGCAGT

[0074] GTTCCAGCGCATGAAAACCGAATTTCCAGTGTTCGAAAAGTCCCAGGT

[0075] GGTGGAACGCTGGGGTGCCGTGGTGTCCCCAACCTTCGATGAACTGCC

[0076] AATCATCTCCGAAGTGAAAGAATACCCAGGCCTCGTGATCAACACCGCT

[0077] ACCGTGTGGGGCATGACCGAAGGTCCAGCCGCAGGCGAAGTGACCGC

[0078] AGATATCGTGACCGGCAAGAAGCCAGTCATCGATCCAACTCCATTCTCC

[0079] ATGGATCGCTTCAAGAAGTAA

[0080] Nucleotide sequence of the decarboxylase (KDC) gene (SEQ ID NO.2)

[0081] ATGACCTACACCGTGGGCTCCTACCTGGGCGAACGCCTGGCACAGATC

[0082] GGCCTGAAGCACCACTTCGCAGTGGCAGGCGATTACAACCTGGTGCTG

[0083] CTGGATCAGCTGCTGACCGTGAAGGGCACCGAACAGGTGTACTGCTGC

[0084] AACGAACTGAACTGCGGCTTCTCCGCAGAAGGCTACGCACGCGCAAA

[0085] CGGTGCATCCGCAGCAGTGGTGACCTTCTCCGTTGGCGCAATCTCCGCA

[0086] TTCAACGCAGTGGGCTCCGCATACGCAGAAAACCTGCCACTCATCCTG

[0087] ATCTCCGGTGCACCAAACTCCAACGATCACGGCTCCGGTCACGTGCTG

[0088] CACCACACCATCGGCACCACCGATTACACCTACCAGCTGGAACTGGCA

[0089] AAGAAGATTACCTGCGCAGCCGTGTCCATCATCTCCCCAGATCACGCAC

[0090] CAACCTTGATCGACCACGCAATCCGCACCGCACTGCGCGAAAAGAAGC

[0091] CAGCATACATCGAAATCGCATGCAACGTGTCCGGTCTGCCATGCGCAGC

[0092] CCCAGGTCCAGTGTCCGCACTGCTGCCAACCACTCCATCCGATTCCGCA

[0093] ACCGTGAACGCAGCTGTGGAAGCAGCCGTGGAATTCCTGTCCAAGCGC

[0094] GAGAAGATCGTGCTGCTGATCGGCTCCAAGCTTCGCGCAGCAGGCGCA

[0095] GAAGCAGAAGCAATCAAGCTGGCAGATGCACTGGAATGCGCAGTGGC

[0096] CACCATGGCAGCAGCAAAGTCCTTCTTTCCAGAAGATCACCCACACTA

[0097] CATTGGCACCTACTGGGGTGAAGTGTCCTCCGCAGGCGTGAAAGAAAT

[0098] CGTGGATTGGGCAGATGGCATCCTGTGCCTGGGTCCAGTTTTCAACGAT

[0099] TACTCCACCGTCGGCTGGACCGCATGGCCAAAGGGTCCAAACGTGCTC

[0100] GTGGCAGATAAGGATGAAATCACCCTGACCGATCACGCCTTCAACGGTA

[0101] TTACCCTGAAAGAATTCCTGGCAACCCTCACCGAACGCCTCAAGGGCG

[0102] TGAAGAAAAACGCAACCATGGTCGAATTCCACCGCGTGGTGCGTCCAG

[0103] TGGCACCAACCATTGCAGCAGATCCAAAGGCAAAGCTGATGCGTGCAG

[0104] AAATGGCACGCCAGATCGAAACCGTGCTGACCGAAAACACCACCTTGG

[0105] TGGTGGAAACCGGTGATTCCTGGTTCAACGCAATGCGCATGAAGCTGC

[0106] CACACGGTGCACGCGTCGAATTCGGCATGCAGTGGGGTCACATCGGCT

[0107] GGTCCATTCCAGCAACCTTCGGCTACGCCGTGGCAGAACCAGATCGCC

[0108] GTATCGTGACTATGGTCGGCGACGGCTCCTTCCAGCTGACCGCACAAG

[0109] AGGTGGCCCAGATGGTGCGTCGCAACCTGCCAGTGATCATCTTCCTGAT

[0110] CAACAACCACGGCTACACCATCGAAGTGGAAATTCACGATGGCCCATA

[0111] CAACAACATCAAGAACTGGGATTACGCAGGCATCATCGAGGTGTTCAA

[0112] CGCCGATGAAGGCAAAGGCAAGGGCTTTCGCGCAACCAACGGTGGCG

[0113] AACTGGCCGATGCAATCAAGGCAGCACTGGCAAACAAGGCAGGCCCA

[0114] ACTCTGATCGAATGCGTGATCGATCGCGACGATTGTACCTCCGAACTGA

[0115] TCTCCTGGGGTCGTCGCGTGGCAACCGCAAACGCACGCCCTCCAGCAA

[0116] AGTAA

[0117] Nucleotide sequence of aldehyde dehydrogenase (yqhD) gene (SEQ ID NO.3)

[0118] ATGAACAACTTCAACCTGCACACCCCAACTCGCATCCTGTTCGGCAAG

[0119] GGTGCAATCGCTGGCCTGCGCGAGCAGATCCCACACGATGCTCGCGTG

[0120] CTGATCACCTACGGTGGCGGTTCCGTGAAGAAAACCGGTGTGCTGGAT

[0121] CAGGTGCTGGATGCACTGAAAGGCATGGATGTGCTGGAATTCGGTGGC

[0122] ATCGAACCAAATCCAGCATACGAAACCCTGATGAACGCAGTGAAGCTG

[0123] GTGCGCGAACAGAAGGTGACCTTCCTGCTGGCAGTTGGCGGTGGCTCC

[0124] GTGCTGGACGGCACCAAGTTCATTGCAGCAGCAGCAAACTACCCAGAA

[0125] AACATCGATCCATGGCACATCCTGCAGACCGGTGGCAAAGAAATCAAG

[0126] TCCGCAATTCCAATGGGCTGCGTGCTGACCCTGCCAGCAACCGGCTCC

[0127] GAATCCAACGCAGGCGCAGTGATCTCCCGCAAGACCACCGGTGATAAG

[0128] CAGGCATTCCACTCCGCACACGTGCAGCCAGTGTTCGCAGTGCTGGAC

[0129] CCAGTGTACACCTACACCTTGCCACCACGCCAGGTGGCAAACGGCGTG

[0130] GTCGATGCATTCGTGCACACCGTGGAACAGTACGTGACCAAGCCAGTG

[0131] GATGCAAAGATCCAGGATCGCTTCGCAGAAGGCATCCTGCTCACCCTGA

[0132] TCGAAGATGGCCCAAAGGCTCTGAAAGAACCAGAAAACTACGATGTTC

[0133] GCGCTAACGTGATGTGGGCAGCAACCCAGGCACTGAACGGCCTGATCG

[0134] GTGCAGGCGTGCCACAGGATTGGGCAACCCACATGCTGGGCCACGAAC

[0135] TGACCGCAATGCACGGCCTGGATCACGCACAGACCCTGGCAATCGTGC

[0136] TGCCAGCACTGTGGAACGAAAAGCGCGATACCAAACGCGCAAAGCTG

[0137] CTGCAGTACGCAGAACGCGTGTGGAACATCACCGAAGGCTCCGATGAT

[0138] GAGCGCATCGACGCAGCAATCGCAGCTACCCGCAACTTCTTCGAACAG

[0139] CTGGGCGTGCCAACTCACCTGTCCGATTACGGCCTCGATGGCTCCTCCA

[0140] TTCCAGCTCTGCTGAAGAAGCTGGAAGAACACGGCATGACCCAGCTCG

[0141] GCGAAAACCACGATATCACCCTGGATGTGTCCCGTCGCATCTACGAAGC

[0142] AGCACGCTAA

[0143] (II) Promoter sequence

[0144] Strong promoter Psod sequence (SEQ ID NO.4)

[0145] AACAGGAATGTTCCTTTCGAAAATTGAGGAAGCCTTATGCCCTTCAACC

[0146] CTACTTAGCTGCCAATTATTCCGGGCTTGTGACCCGCTACCCGATAAATA

[0147] GGTCGGCTGAAAAATTTCGTTGCAATATCAACAAAAAGGCCTATCATTG

[0148] GGAGGTGTCGCACCAAGTACTTTTGCGAAGCGCCATCTGACGGATTTTC

[0149] AAAAGATGTATATGCTCGGTGCGGAAACCTACGAAAGGATTTTTTACCC(III) Primer sequences

[0150]

[0151]

[0152] Example 1 Construction of Corynebacterium glutamicum gene editing plasmids pK18mobsacB-Psod-aspB, pK18mobsacB-Psod-lysC-asd and pK18mobsacB-Psod-thrA

[0153] The genome of Corynebacterium glutamicum ATCC13032 is used as a template, and primer pairs aspB-LH-F / aspB-LH-R, aspB-RH-F / aspB-RH-R, lysC-LH-F / lysC-LH-R, lysC-RH-F / lysC-RH-R, thrA-LH-F / thrA-LH-R, thrA-RH-F / thrA-RH-R and Psod-F / Psod-R are used for PCR amplification to obtain fragments aspB-LH, aspB-RH, lysC-LH, lysC-RH, thrA-LH, thrA-RH and Psod (SEQ ID NO. 4), respectively; and primers pK18-F / pK18-R are used to perform PCR amplification on an empty plasmid vector pK18mobsacB to obtain a fragment pK18mobsacB-BB. The 8 PCR products were detected by 1.0% agarose gel electrophoresis and the fragments were purified by a clean-up kit. The recovered fragments (Table 1) were then homologously recombined using a kit, and the ligation products were transformed into DH5α competent cells, coated with kanamycin resistance plates for overnight culture, and positive clones were selected for colony PCR verification. The correct transformants were sequenced and verified. The correct recombinant plasmids were named pK18mobsacB-Psod-aspB, pK18mobsacB-Psod-lysC-asd and pK18mobsacB-Psod-thrA, and the plasmid maps were shown in Figure 1-3 .

[0154] Table 1 Plasmid construction fragment connection table

[0155] Constructed plasmid Required fragment pK18mobsacB-Psod-aspB pK18mobsacB-BB, Psod, aspB-LH, aspB-RH pK18mobsacB-Psod-lysC-asd pK18mobsacB-BB, Psod, lysC-LH, lysC-RH pK18mobsacB-Psod-thrA pK18mobsacB-BB, Psod, thrA-LH, thrA-RH

[0156] Example 2 Construction of Corynebacterium glutamicum overexpression plasmids pEC-XK99E-AAD-KDC and pXMJ19-yqhD

[0157] The corresponding genes AAD (SEQ ID NO.1), KDC (SEQ ID NO.2) and yqhD (SEQ ID NO.3) of the overexpressed enzyme were synthesized by the whole gene synthesis method, and the primer pairs AAD-F / AAD-R, KDC-F / KDC-R and yqhD-F / yqhD-R were used for PCR amplification to obtain fragments AAD, KDC and yqhD; at the same time, the plasmid vectors pEC-XK99E and pXMJ19 were PCR amplified by primer pairs pEC-XK99E-F / pEC-XK99E-R and pXMJ19-F / pXMJ19-R to obtain fragments pEC-XK99E-BB and pXMJ19-BB. The obtained 5 PCR products were detected by 1.0% agarose gel electrophoresis and the fragments were purified by a clean-up kit.

[0158] The recovered fragments AAD, KDC and pEC-XK99E-BB were homologously recombined using a kit, and the ligation products were transformed into DH5α competent cells, coated with kanamycin-resistant plates and cultured overnight, positive clones were selected for colony PCR verification, and the correct transformants were sequenced for verification. The correct recombinant vector was named pEC-XK99E-AAD-KDC. The plasmid map is shown in Figure 4 .

[0159] The recovered fragment yqhD and pXMJ19-BB were connected by homologous recombination using a kit, and the connection product was transformed into DH5α competent cells. The cells were coated with chloramphenicol resistance plates and cultured overnight. Positive clones were selected for colony PCR verification. The correct transformants were sequenced and verified. The correct recombinant vector was named pXMJ19-yqhD. The plasmid map is shown in Figure 5 .

[0160] Example 3 Improving the expression of enzymes related to the homoserine synthesis pathway of Corynebacterium glutamicum

[0161] The pK18mobsacB-Psod-aspB plasmid was transferred into C. glutamicum ATCC 13032, and the positive clones with successful recombination were screened by kanamycin and colony PCR (primer pair aspB-UC-F / Psod-R). The selected transformants were cultured with sucrose to reversely screen and eliminate the plasmid vector and kanamycin resistance. The steps are as follows: the transformants were inoculated in 5mL BHI-Sucrose liquid culture medium, cultured overnight at 30℃ and 220rpm, and the bacterial solution was diluted to a certain multiple and coated on a BHI-Sucrose solid plate. The colonies grown on the plate were plated on a BHI solid plate without resistance and a BHI solid plate containing 15μg / mL kanamycin. The colonies that grew on the plate without resistance but not on the kanamycin plate were selected for PCR verification (primer pair Psod-F / aspB-DC-R), and the aspB gene (cg0294) expression enhanced strain PDO1 was obtained.

[0162] Similarly, the pK18mobsacB-Psod-lysC-asd plasmid was transferred into PDO1, and positive clones with successful recombination were screened using kanamycin and colony PCR (primer pair lysC-UC-F / Psod-R). The selected transformants were cultured with sucrose to reversely screen for eliminating the plasmid vector and kanamycin resistance, and then verified by PCR (primer pair Psod-F / lysC-DC-R), thus obtaining the strain PDO2 with enhanced expression of the lysC-asd gene cluster (lysC, cg0306; asd, cg0307).

[0163] Similarly, the pK18mobsacB-Psod-thrA plasmid was transferred into PDO2, and positive clones with successful recombination were screened using kanamycin and colony PCR (primer pair thrA-UC-F / Psod-R). The selected transformants were cultured with sucrose to reversely screen for eliminating the plasmid vector and kanamycin resistance, and then verified by PCR (primer pair Psod-F / thrA-DC-R), thus obtaining the strain PDO3 with enhanced expression of the thrA gene (thrA, cg1337).

[0164] Example 4 Fermentation and production of 1,3-propylene glycol by recombinant Corynebacterium glutamicum

[0165] 1) Shake flask fermentation

[0166] The overexpression vector pEC-XK99E-AAD-KDC and pXMJ19-yqhD were co-transformed into Corynebacterium glutamicum ATCC13032 to obtain the engineered strain PDO4; the overexpression vector pEC-XK99E-AAD-KDC and pXMJ19-yqhD were co-transformed into PDO3 to obtain the engineered strain PDO5. The above two strains PDO4 and PDO5 were inoculated into 5 mL of LB liquid medium containing 15 μg / mL kanamycin, 10 μg / mL chloramphenicol and 20 g / L glucose, respectively, and cultured at 30°C 200rpm for 16 hours, and then transferred to a 250 mL Erlenmeyer flask containing 30 mL of fermentation medium at 1% (v / v), and IPTG was added at a final concentration of 100 μM after culturing at 30°C 200rpm for 4 hours. After induction culture for 48 hours, the fermentation broth was collected, and the concentration of 1,3-PDO was detected by HPLC. The results showed that the 1,3-PDO yield of PDO4 was 1.4 g / L, and the 1,3-PDO yield of PDO5 was 6.7 g / L.

[0167] The formula of shake flask fermentation medium is: glucose 40g / L, yeast powder 5g / L, urea 5g / L, KH2PO4 3g / L, Na2HPO4·3H2O 5g / L, NaCl 0.5g / L, NH4Cl 1g / L, thiamine hydrochloride (VB1) 1g / L, biotin 0.1g / L. The final concentration of kanamycin is 15μg / mL, and the final concentration of chloramphenicol is 10μg / mL.

[0168] 2) 5L fermenter fed-batch fermentation

[0169] The strain PDO5 was inoculated into the seed culture medium, and cultured on a shaking table at 30°C and 200rpm for 24h. The seed solution was taken and inoculated into a 5L fermenter containing 2L fermentation culture medium at 10% (v / v). The fed-batch fermentation of the present invention was carried out at 30°C, and the pH in the fermentation system was maintained at pH 7.0 by automatically adding 25% ammonia water. The air flow rate range was 1.0 vvm (air volume / working volume / minute). When the glucose concentration in the culture medium dropped to 1g / L, the feed culture medium solution was added and the residual glucose concentration was adjusted to above 1g / L. The fermentation was carried out for more than 72h, and the 1,3-PDO yield was 54.3g / L.

[0170] Among them, the formula of seed culture medium and fermentation medium is the same as that of shake flask fermentation step.

[0171] The fermentation feed medium was an aqueous solution containing the following ingredients: 500 g / L glucose, 9 g / L KH2PO4, 2.5 g / LMgSO4, 3.5 g / L K2SO4, 0.28 g / L Na2SO4, 10 ml / L micronutrient solution;

[0172] The trace element solution in the feed medium is an aqueous solution containing the following ingredients: 10.2 g / L ZnSO4·7H2O, 0.50 g / L MnCl2·4H2O, 0.5 g / L CuSO4, 0.86 g / L CoCl2·6H2O, 0.56 g / L Na2MoO4·2H2O, 3.84 g / L CaCl2·2H2O, 5.12 g / L FeSO4·7H2O, 0.05 g / L biotin, 1 g / L thiamine hydrochloride (VB1), 1 g / L nicotinic acid. After the solution is prepared, it is heated at 121°C for 20 min and sterilized at 4°C for storage.

[0173] In summary, the Corynebacterium glutamicum with high 1,3-propylene glycol production of the present invention makes the Corynebacterium glutamicum overexpress AAD gene, KDC gene and yqhD gene, and enhances the expression of enzyme genes related to the homoserine biosynthesis pathway, so that in the process of fermentation and production of 1,3-propylene glycol, the yield in the shake flask stage is as high as 6.7 g / L, and the yield in the fermenter fermentation is as high as 54.3 g / L, the fermentation cost is low and the yield is high, the benefit of producing 1,3-propylene glycol is maximized, and the Corynebacterium glutamicum is suitable for practical promotion and application.

Claims

1. A recombinant Corynebacterium glutamicum with high yield of 1,3-propanediol, characterized in that: The recombinant Corynebacterium glutamicum can overexpress the following genes: 1) Deaminase gene AAD, which converts homoserine into 4-hydroxy-2-oxobutyrate; 2) decarboxylase gene KDC, which converts 4-hydroxy-2-oxobutyric acid into 3-hydroxypropanal; 3) Aldehyde reductase gene yqhD, which converts 3-hydroxypropionaldehyde into 1,3-PDO; The nucleotide sequence of the deaminase gene AAD is shown in SEQ ID NO.1; The nucleotide sequence of the decarboxylase gene KDC is shown in SEQ ID NO.2; The nucleotide sequence of the aldehyde reductase gene yqhD is shown in SEQ ID NO.

3.

2. The recombinant Corynebacterium glutamicum according to claim 1, characterized in that: The expression amount of the homoserine synthesis pathway-related enzyme genes in the recombinant Corynebacterium glutamicum is enhanced; The homoserine synthesis pathway-related enzyme genes include aspartate aminotransferase gene aspB, aspartate kinase gene lysC, aspartate semialdehyde dehydrogenase gene asd and homoserine dehydrogenase gene thrA; The index number of the aspartate aminotransferase gene aspB in the KEGG database is cg0294; The index number of the aspartate kinase gene lysC in the KEGG database is cg0306; The index number of the aspartate semialdehyde dehydrogenase gene asd in the KEGG database is cg0307; The index number of the homoserine dehydrogenase gene thrA in the KEGG database is cg1337.

3. Use of the recombinant Corynebacterium glutamicum according to any one of claims 1 to 2 in the fermentation production of 1,3-propanediol, microbial genetic breeding and / or improving the ability to biosynthesize 1,3-PDO.

Images