Feruloyl esterase mutants with improved activity and use thereof

Abstract

The application provides ferulic acid esterase mutants with improved specific activity and application thereof, and the application carries out directional evolution on a ferulic acid esterase gene derived from Bacillus pumilus, expresses the ferulic acid esterase gene in an E. coli expression system, and obtains ferulic acid esterase mutants DV1 and DV2 with improved enzyme activity and expression efficiency through screening. The amino acid sequences of the ferulic acid esterase mutants DV1 and DV2 are shown in SEQ ID NO. 4 and SEQ ID NO. 6 respectively, and the mutants DV1 and DV2 obtained by the application have higher protein yield, higher specific activity of methyl ferulate esterase, and higher degradation efficiency of macromolecular p-nitrophenol ester substrates compared with the original bacteria BpFAE. Therefore, the mutants can be used for degrading plant fibers and preparing feed fermenting agents, and have good market application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to a ferulic acid esterase mutant with improved specific activity and application thereof. Background Art

[0002] my country faces a severe shortage of feed resources, making it increasingly important to exploit the energy potential of plant feed fiber and improve feed resource utilization. Ferulic acid, covalently cross-linked with hemicellulose and lignin in plant cell walls, creates a complex structure that hinders the degradation and utilization of wood fiber. Ferulic acid esterase acts on the ester bond between ferulic acid and polysaccharides, promoting plant fiber degradation. Improving ferulic acid esterase gene expression and molecular catalytic efficiency is key to the efficient application of ferulic acid esters in plant fiber degradation.

[0003] Because the industrial application of microbial enzymes is subject to numerous limitations, improving enzyme activity, stability, and substrate specificity is crucial. Protein engineering provides opportunities for this. Techniques for protein modification are primarily categorized into three types: directed evolution, semi-rational design, and rational design. Directed evolution is currently widely used in molecular engineering, encompassing techniques such as error-prone PCR, DNA shuffling, saturation mutagenesis, and staggered extension. Protein modification using error-prone PCR has been successfully applied to modify the properties of various enzymes.

[0004] The bacterial expression system is a very mature expression system, and Escherichia coli has a clear genetic background, high safety, fast reproduction, low cost, high conversion efficiency, and is easy to culture on a large scale. Ferulic acid esterase can achieve extracellular soluble secretion in the Escherichia coli expression host. Summary of the Invention

[0005] The present invention aims to provide a feruloyl esterase mutant with improved catalytic activity and its application. The present invention molecularly modifies a feruloyl esterase gene derived from Bacillus pumilus and expresses it in Escherichia coli. The feruloyl esterase mutants DV1 and DV2 with high catalytic activity and expression efficiency are obtained by using an error-prone PCR technique and a rescreening method using an ethyl ferulate plate screening method.

[0006] In order to achieve the above-mentioned purpose, the present invention adopts the following technical solutions:

[0007] The present invention provides a feruloyl esterase mutant DV1, whose amino acid sequence is shown in SEQ ID NO.4. The mutant DV1 is obtained by changing the 41st amino acid of the amino acid sequence shown in SEQ ID NO.2 from aspartic acid to valine.

[0008] The present invention provides a gene encoding the feruloyl esterase mutant DV1, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0009] The present invention provides a feruloyl esterase mutant DV2, whose amino acid sequence is shown in SEQ ID NO.6. The mutant DV2 is obtained by changing the 41st amino acid of the amino acid sequence shown in SEQ ID NO.2 from aspartic acid to valine and the 147th glycine to alanine.

[0010] The present invention provides a gene encoding the feruloyl esterase mutant DV2, the nucleotide sequence of which is shown in SEQ ID NO.5.

[0011] The present invention further provides a recombinant vector and a recombinant strain containing the feruloyl esterase mutant DV1 or the feruloyl esterase mutant DV2.

[0012] The present invention further provides a starter culture containing the feruloyl esterase mutant DV1 or the feruloyl esterase mutant DV2.

[0013] The present invention further provides the use of the feruloyl esterase mutant DV1 or the feruloyl esterase mutant DV2 in fermenting plant feed.

[0014] Furthermore, the enzymatic hydrolysis reaction conditions of the ferulic acid esterase mutants DV1 and DV2 are: pH 9, 50° C., and reaction time 10 min.

[0015] Furthermore, the ferulic acid esterase mutants DV1 and DV2 are used to catalyze the enzymatic hydrolysis of substrates containing ferulic acid ester bond sites in plant feed.

[0016] Furthermore, the substrate includes methyl ferulate and C4-C16 p-nitrophenol ester.

[0017] Furthermore, the ferulic acid esterase mutants DV1 and DV2 have increased enzyme specific activities for methyl ferulate and p-nitrophenolate substrates, and the larger the molecule, the greater the increase in specific activity.

[0018] Compared with the existing technology, the present invention offers the following advantages and technical effects: Using the feruloyl esterase gene BpFAE (shown in SEQ ID NO. 1) as a template, the invention randomly mutates the nucleotide sequence of the feruloyl esterase gene using error-prone PCR to generate the gene encoding the FAE mutant. Using pET22b as the expression vector, a recombinant plasmid carrying the mutant gene is constructed, and the mutant protein is expressed in Escherichia coli BL21 (DE3) as the host. The mutant strains are fermented, and the production of circles between the mutant and the original fermentation supernatant on ethyl ferulate substrate plates is compared using an Oxford cup method to screen for positive mutants. After protein purification, the protein activity is measured using methyl ferulate and p-nitrophenol esters of different carbon chain lengths (C4, C6, C8, C12, and C16) as substrates.

[0019] The present invention obtained mutants DV1 and DV2 through mutation screening. Compared with the original BpFAE, mutants DV1 and DV2 have significantly increased protein production, significantly improved specific activity for methyl ferulate, and higher efficiency in degrading the macromolecular p-nitrophenolate substrate. They can be used to degrade plant fibers and prepare feed starter cultures, showing promising market application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Flowchart for constructing recombinant expression vector;

[0021] Figure 2 Agarose gel electrophoresis results for linearization identification of target gene and vector;

[0022] Figure 3 The results of PCR verification of recombinant bacterial solution were obtained;

[0023] Figure 4 Comparison of the results of extracellular crude enzyme activity assay of mutant ferulic acid esterase; 1: DV2; 2: DV1;

[0024] Figure 5 These are the protein electrophoresis results of the mutant protein and the original protein after purification; 1: DV1; 2: DV2; 3: BpFAE. DETAILED DESCRIPTION

[0025] The following embodiment is only a preferred solution of the present invention and does not limit the present invention in any form. There are other variations and modifications without exceeding the technical solution described in the claims. The protection scope of the present invention and the scope of claims are not limited to the cases provided.

[0026] Solution preparation:

[0027] LB liquid medium: 5 g of Yeast extract, 10 g of Tryptone, and 10 g of NaCl, add 1 L of deionized water, and sterilize by autoclaving at 121°C for 30 min.

[0028] Ethyl ferulate substrate plate: Dissolve 0.3 g of ethyl ferulate in 3 mL of N,N-dimethylformamide, add 2 g of agar powder to 100 mL of deionized water, and heat to mix.

[0029] Ampicillin sodium solution (Amp 100 mg / mL): Dissolve 1 g of Amp in 10 mL of water and sterilize through a 0.22 μM filter.

[0030] PBS buffer (pH 7.4): KCl 0.2 g, NaCl 8 g, KH2PO4 0.24 g, Na2HPO4·12H2O 3.63 g, dissolved in 1 L of deionized water.

[0031] pH 9 0.05M Tris-HCl buffer: 50mL 0.1M Tris + 7mL 0.1N HCl, dilute to 100mL with water.

[0032] 3 mM methyl ferulate solution: 15.7 mg of methyl ferulate was dissolved in 1 mL of methanol and then diluted with 24 mL of pH 9 0.05 M Tris-HCl buffer.

[0033] Lysis Buffer: 7.80 g NaH2PO4·2H2O, 17.54 g NaCl, 0.68 g imidazole, dissolved in 1 L deionized water, adjusted to pH 8.0 with NaOH solution, and filtered through a 0.22 μM aqueous filter.

[0034] Wash Buffer: Add 1.36 g of imidazole. Other ingredients are the same as those in Lysis Buffer.

[0035] Elution Buffer: Add 34.0 g of imidazole. Other ingredients are the same as those in Lysis Buffer.

[0036] Nickel column storage buffer: 1× PBS containing 20% ​​ethanol.

[0037] Example 1: Construction of expression vector

[0038] 1. Construction of recombinant expression vector

[0039] PCR primer design and target fragment amplification and recovery

[0040] Primers BpFAE-F (pET22b), BpFAE-R (pET22b), pET22b-F, and pET22b-R were designed using SnapGene software. Linearization was performed at the vector's cloning site, and 15-20 bp of homologous sequences identical to both ends of the vector's cloning site were introduced at the 5' end of the insert PCR primer. Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The process for constructing the recombinant expression vector is as follows: Figure 1 shown.

[0041] BpFAE--F(pET22b): cggcgatggccatggatatcATGAACCTGCAAGAACAAATTAAAAT (SEQ ID NO.7);

[0042] BpFAE--R(pET22b):tgctcgagtgcggccgcaagTTCAAATGCCTTCTTCAGTTGATC (SEQ IDNO.8);

[0043] pET22b-F: GATATCCATGGCCATCGCCGGCT (SEQ ID NO.9);

[0044] pET22b-R: CTTGCGGCCGCACTCGAGCA (SEQ ID NO. 10).

[0045] A plasmid containing the full-length BpFAE encoding nucleotide sequence (SEQ ID NO. 1) (synthesized by Beijing Qingke Biotechnology Co., Ltd.) was used as a template for error-prone PCR amplification to obtain the amplified product.

[0046] The PCR reaction system is as follows: Error-prone PCR mix 15 μL; MnCl2 for Error-prone PCR 3 μL; DNA (4 ng / μL) 5 μL; Primer-F (10 μM) 1 μL; Primer-R (10 μM) 1 μL; add ddH2O to 30 μL.

[0047] PCR reaction conditions: (1) 95°C, 3 min; (2) 95°C, 30 s; 63°C, 30 s; 72°C, 1 min; 40 cycles; (3) 72°C, 10 min.

[0048] Using a plasmid containing the full-length pET22b sequence as a template, the vector was linearized by PCR amplification. The reaction system was as follows: 2× PrimeSTAR Max DNA Polymerase 25 μL; DNA (4 ng / μL) 2 μL; Primer-F (10 μM) 2.5 μL; Primer-R (10 μM) 2.5 μL; add ddH2O to 50 μL.

[0049] Reaction conditions: (1) 98°C, 2 min; (2) 98°C, 10 s; 55°C, 15 s; 72°C, 20 s; 32 cycles; (3) 72°C, 10 min.

[0050] 2. Agarose gel electrophoresis of PCR products and recovery of target gene

[0051] Take 1 μL of PCR product and check it by 1.0% agarose gel electrophoresis to check whether it is a single band, and purify it using a DNA purification kit. Figure 2 As shown, a single band of the target gene BpFAE and the vector pET22b was obtained, with the correct size. The purified PCR product of the target gene and vector was digested with Dpn I to reduce the possibility of false positives during transformation due to the template plasmid. The reaction system is as follows: Dpn I 1 μL; 10×T buffer 2 μL; DNA ≤ 1 μg; add ddH2O to 20 μL.

[0052] 3. Construction of BpFAE-pET22b expression vector

[0053] The target gene PCR product was seamlessly cloned and connected with the vector. The reaction system was as follows: Mix 5;

[0054] DNA X; Vector Y; add ddH2O to 10. Ligate at 50°C for 5 min, place on ice or at 4°C for transformation.

[0055] IV. Transformation of cloning host DH5α

[0056] (1) Thaw the DH5α competent cells on ice, add 10 μL of enzyme-linked product, and let it stand on ice for 30 min;

[0057] (2) Heat shock in a 42°C water bath for 45 seconds, then place on ice for 2-3 minutes;

[0058] (3) Add 0.9 mL of fresh LB solution and incubate in a shaker at 37°C and 200 rpm for 1 h.

[0059] (4) Spread on Amp-resistant plates and culture at 37°C overnight.

[0060] Pick a single colony, inoculate it in LB (100 μg / mL Amp), shake the culture for 7-8 hours, perform PCR verification on the bacterial solution, and send the correct transformant for sequencing. If the sequencing result is correct, proceed to the next step of transformation.

[0061] 5. Transformation of Expression Hosts

[0062] The BL21 (DE3) transformation operation is the same as DH5α. Take part of the transformation solution to plate and culture overnight. Take a single colony of the positive transformant, shake the bacteria, and perform PCR verification on the bacterial solution. The result is as follows Figure 3 Verify that the stripe size is correct as shown.

[0063] Example 2: Fermentation and screening of recombinant bacteria

[0064] Single colonies of mutant recombinant bacteria and control strains (containing resistance) were shaken and incubated at 37°C for 8 hours to prepare seed culture. A 2% inoculum was then inoculated into fermentation flasks for fermentation, with triplicate inoculations for each positive strain. The culture grew to an OD value of 0.6-0.8, and IPTG (final concentration 0.5 mM) was added for overnight induction. 200 μL of the fermentation supernatant was added to an Oxford cup and observed for 10 hours at 37°C for the formation of ferulate rings on the plate containing ethyl ferulate. Positive mutants DV1 and DV2 were initially screened.

[0065] The amino acid sequence of the feruloyl esterase mutant DV1 is shown in SEQ ID NO. 4, which is obtained by changing the amino acid at position 41 of the amino acid sequence shown in SEQ ID NO. 2 from aspartic acid to valine. The nucleotide sequences of the feruloyl esterase mutant DV1 are shown in SEQ ID NO. 3. The amino acid sequence of the feruloyl esterase mutant DV2 is shown in SEQ ID NO. 6, which is obtained by changing the amino acid at position 41 of the amino acid sequence shown in SEQ ID NO. 2 from aspartic acid to valine and mutating the glycine at position 147 to alanine. The nucleotide sequences of the feruloyl esterase mutant DV2 are shown in SEQ ID NO. 5.

[0066] Example 3: Determination and comparison of enzyme activity and protein content of crude fermentation enzyme solution

[0067] The crude enzyme solution reacted with methyl ferulate as the substrate, and the reaction product, ferulic acid, was preliminarily identified by HPLC. The detection wavelength was 320 nm, the flow rate was 0.8 mL / min, and the injection volume was 10 μL. The mobile phase A consisted of 1‰ formic acid in water, and the mobile phase B was methanol.

[0068] Enzyme reaction conditions: Preheat 3 mM methyl ferulate solution at 50°C for 5 min, aspirate 300 μL, mix with 200 μL crude enzyme solution, react at 50°C for 10 min, add 600 μL of methanol to terminate the reaction, filter through a 0.22 μM filter, and analyze by HPLC. Each group was run in triplicate, with an equal volume of buffer replacing the enzyme solution as a blank control. Standards were dissolved in 50% methanol at a concentration of 1 mg / mL.

[0069] Enzyme activity unit definition: the amount of enzyme added that hydrolyzes the substrate MFA to produce 1 μmol FA per minute at 50°C.

[0070] Fermentation broth proteins were run on gel for comparison.

[0071] The results of enzyme activity test are as follows Figure 4 As shown, the results showed that the extracellular enzyme activity of the mutants was increased, among which the extracellular enzyme activity of DV1 was increased by about 2 times.

[0072] Example 4: Purification of recombinant ferulic acid esterase BpFAE-pET22b protein

[0073] Ferment the positive mutant strain with the highest enzyme activity in the fermentation supernatant, and then use the supernatant for protein purification. After centrifugation, the supernatant is concentrated 10-fold by ultrafiltration at 5000 g for 20 minutes. The concentrated enzyme solution is then purified by passing it through a self-assembled nickel column. The procedure is as follows:

[0074] (1) Add 5 column volumes of Lysis Buffer to the Ni gravity column to equilibrate the filler. Repeat twice.

[0075] (2) Sample addition. Add the enzyme solution to the gravity column, control the dripping rate to ensure full contact between the sample and the medium, collect the effluent and repeat the sample addition to improve the binding efficiency.

[0076] (3) Add 12 column volumes of Wash Buffer to remove weakly bound impurities and collect the wash buffer for detection.

[0077] (4) Add 5 times the column volume of Elution Buffer to elute the target protein, collect the solution and analyze it by SDS-PAGE to verify the band and molecular weight.

[0078] (5) Determine the concentration of the purified protein by BCA method.

[0079] The experimental results are as follows Figure 5 As shown, single protein bands of mutants DV1, DV2 and BpFAE were obtained with the correct size.

[0080] Example 5: Enzyme activity levels of mutant feruloyl esterase on different substrates

[0081] Using methyl ferulate and p-nitrophenol esters with different C chain lengths, including p-nitrophenyl butyrate (C4), p-nitrophenyl hexanoate (C6), p-nitrophenyl octanoate (C8), p-nitrophenyl laurate (C12), and p-nitrophenyl palmitate (C16), as substrates, the enzyme activity levels of FAE before and after mutation on different substrates were compared.

[0082] The reaction conditions were the same as above using methyl ferulate as substrate. The results in Table 1 showed that the enzyme specific activities of mutants DV1 and DV2 increased by 45.98% and 50.96% respectively.

[0083] Table 1 Enzyme activity results using methyl ferulate as substrate

[0084]

[0085] Feruloyl esterase degrades p-nitrophenol esters of varying C-chain lengths, producing 4-NP with a strong absorption peak at 410 nm. Assay conditions: 100 μL of a 10 mM substrate solution in DSMO, 800 μL of 0.1 M Tris-HCl (pH 9) containing 2.5% (v / v) Triton X-100, and 100 μL of the enzyme solution. The reaction was incubated at 50°C for 10 min, followed by termination on ice for 5 min. Enzyme activity was calculated using triplicate assays per group.

[0086] The enzyme activity unit is defined as the amount of 1 μmol of 4-NP released from 4-NPF in 1 min. The results, as shown in Table 2, show that for the three substrates C4, C6, and C8, the catalytic specific activities of mutants DV1 and DV2 were significantly improved compared to wild-type BpFAE, with the improvement level ranked C8 > C6 > C4.

[0087] Table 2 Enzyme activity results using different p-nitrophenolates as substrates

[0088]

[0089] Example 6: Catalytic efficiency of mutant feruloyl esterase

[0090] Methyl ferulate was prepared at concentrations of 0.02, 0.04, 0.06, 0.08, 0.1, 0.2, 0.4, 0.6, 0.8, 1.0, 2.0, 3.0, 4.0, and 5.0 mM, respectively. An equal amount of purified feruloyl esterase was added and the reaction was carried out at an optimum temperature of 50°C and an optimum pH of pH 9 for 10 min. The enzyme activity was measured by HPLC, and the Km and Vmax values ​​were calculated using double reciprocal plotting. The Kcat and Kcat / Km values ​​were then calculated. The kinetic parameters of feruloyl esterase are shown in Table 3.

[0091] Table 3 Kinetic parameters of enzymes using methyl ferulate as substrate

[0092]

[0093] 0.8, 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, and 14.0 mM p-nitrophenylbutyrate (C4), p-nitrophenylhexanoate (C6), and p-nitrophenyloctanoate (C8) were added to an equal amount of purified feruloyl esterase and 0.1 M Tris-HCl buffer containing Triton X-100. The reaction was incubated at the optimal temperature and pH for 10 min. After termination, the enzyme activity was measured, and double reciprocal plots were performed to calculate the Km and Vmax values, and the Kcat and Kcat / Km values ​​were calculated. The kinetic parameters for p-nitrophenyl ester reactions are shown in Table 4.

[0094] Table 4 Kinetic parameters of enzymes using different p-nitrophenolates as substrates

[0095]

[0096] Vmax represents the maximum value reached by the enzymatic reaction rate as substrate concentration increases, given a certain amount of enzyme. Km reflects the affinity between the enzyme and the substrate; a larger Km indicates a lower affinity for the substrate. Kcat indicates the enzyme's ability to catalyze a specific substrate; a larger Kcat indicates a stronger catalytic ability. Kcat / Km reflects the enzyme's catalytic efficiency for the substrate, reflecting both the enzyme's affinity for the substrate and its catalytic ability. A larger Kcat / Km indicates a higher catalytic efficiency. As shown in Table 3, mutants DV1 and DV2 both showed improved catalytic efficiency for methyl ferulate. As shown in Table 4, mutants DV1 and DV2 also showed improved catalytic efficiency for different p-nitrophenolate substrates.

[0097] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein with equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. A ferulic acid esterase mutant DV1, characterized in that The amino acid sequence is shown in SEQ ID NO. 4, which is obtained by changing the 41st amino acid of the amino acid sequence shown in SEQ ID NO. 2 from aspartic acid to valine.

2. The gene encoding the feruloyl esterase mutant DV1 according to claim 1, characterized in that Its nucleotide sequence is shown in SEQ ID NO.

3.

3. A ferulic acid esterase mutant DV2, characterized in that The amino acid sequence is shown in SEQ ID NO.6, which is obtained by changing the 41st amino acid of the amino acid sequence shown in SEQ ID NO.2 from aspartic acid to valine and the 147th glycine to alanine.

4. The gene encoding the feruloyl esterase mutant DV2 according to claim 3, characterized in that Its nucleotide sequence is shown in SEQ ID NO.

5.

5. A recombinant vector or recombinant strain comprising the feruloyl esterase mutant DV1 according to claim 1 or the feruloyl esterase mutant DV2 according to claim 3. A starter culture comprising the feruloyl esterase mutant DV1 according to claim 1 or the feruloyl esterase mutant DV2 according to claim 3.

7. Use of the feruloyl esterase mutant DV1 according to claim 1 or the feruloyl esterase mutant DV2 according to claim 3 as a catalyst in a catalytic reaction, characterized in that: The catalytic reaction is a catalytic reaction using methyl ferulate, p-nitrophenyl butyrate, p-nitrophenyl hexanoate and p-nitrophenyl octanoate as substrates.

Images