Method for improving the sensitivity of a porcine circovirus type 2 cap protein antigen enzyme-linked immunosorbent assay

By using hyperimmune serum and an improved high-salt agar plate for agar amplification detection, the problems of low sensitivity and poor specificity in the detection of porcine circovirus type 2 Cap protein antigen were solved, achieving detection results with high sensitivity, strong specificity, simple operation and low cost.

CN119780429BActive Publication Date: 2025-12-26SICHUAN HUAPAI BIO PHARMA
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202411952715.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-27
Publication Date
2025-12-26
Estimated Expiration
2044-12-27

AI Technical Summary

Technical Problem

Existing methods for detecting porcine circovirus type 2 Cap protein antigen suffer from low sensitivity, poor specificity, susceptibility to buffer interference, and high cost. In particular, ELISA kits have short shelf lives and the substrates are easily oxidized.

Method used

Agar amplification detection was performed using hyperimmune serum and a modified high-salt agar plate. A high-salt diluent and a high-salt agar plate were prepared. The trivalent hyperimmune serum and Cap protein antigen were diluted with the high-salt diluent and incubated on the agar plate. Detection was performed under specific conditions of the high-salt agar plate.

Benefits of technology

It improves the sensitivity and specificity of detection, avoids interference from buffer solutions, reduces costs, and simplifies the operation process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119780429B_ABST
    Figure CN119780429B_ABST
Patent Text Reader

Abstract

The application discloses a method for improving the sensitivity of a porcine circovirus type 2 Cap protein antigen agar diffusion detection, and belongs to the technical field of veterinary products. The method is as follows: (1) inoculating piglets with a porcine circovirus 2a, 2b and 2d trivalent virus-like particle vaccine, and then separating serum to obtain a porcine circovirus 2a, 2b and 2d trivalent high-immune serum; (2) preparing a high-salt agar plate; (3) diluting the trivalent high-immune serum and the porcine circovirus type 2 Cap protein antigen with a high-salt diluent, respectively, and then adding the diluted trivalent high-immune serum and the porcine circovirus type 2 Cap protein antigen into holes of the agar plate, and incubating at 35-37 DEG C for 20-24 h to complete the detection. The application uses high-immune serum and an improved agar diffusion method to quantitatively detect the content of PCV2 Cap protein, and avoids the defects of low tolerance to buffer reagents and poor detection specificity of the commonly used BCA or Bradford protein content detection method.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of veterinary products, and particularly relates to a method for improving the sensitivity of detection of porcine circovirus type 2 Cap protein antigen. BACKGROUND

[0002] Porcine circovirus (PCV) is an immunosuppressive disease that is widely prevalent in farms, and PCV is divided into PCV1, PCV2, PCV3 and PCV4, among which PCV2 causes the most serious impact and loss, and PCV2 has multiple subtypes such as PCV2a~PCV2h. The genotype of the main epidemic strain of PCV2 has undergone a change from PCV2a to PCV2b and then to PCV2d, but PCV2a and PCV2b still account for a high proportion in current PCV2 infection.

[0003] Whole virus inactivated vaccine has played an important role in the prevention and control of PCV2, but due to the risk of incomplete inactivation, low virus titer in culture and poor immunogenicity of the whole virus inactivated vaccine, the PCV2 vaccine is gradually changing to a subunit vaccine. Cap protein is the only structural protein and immunogenic protein of PCV2, and in PCV2 subunit vaccines, there are mainly two ways of expressing Cap protein by Escherichia coli and baculovirus culture.

[0004] The two commonly used protein content detection methods, BCA method and Bradford method, for detecting the content of Cap protein after purification are often not very accurate due to the interference of the buffer in the purification process. For example: the invention patent CN114805501A discloses a competitive ELISA method to solve the problems of sensitivity, specificity and the like of antigen quantitative detection, but ELISA detection has problems such as short shelf life of reagent kit, easy oxidation of substrate and high price. SUMMARY

[0005] In view of the above deficiencies in the prior art, the present application provides a method for improving the sensitivity of detection of porcine circovirus type 2 Cap protein antigen, which uses high immune serum and improved high-salt agar plates to detect the titer of PCV2 Cap protein antigen, and has the advantages of high sensitivity, strong specificity, simple operation, effective avoidance of buffer interference and low cost.

[0006] To achieve the above-mentioned purpose, the technical scheme adopted by the present application to solve its technical problems is:

[0007] The purpose of the present application is to provide a method for improving the sensitivity of detection of porcine circovirus type 2 Cap protein antigen, which comprises the following steps:

[0008] (1) inoculate piglets with the porcine circovirus type 2a, 2b and 2d trivalent virus-like particle vaccine, then isolate serum to obtain the porcine circovirus type 2a, 2b and 2d trivalent hyperimmune serum;

[0009] (2) prepare a high-salt agar plate;

[0010] (3) dilute the trivalent hyperimmune serum and the porcine circovirus type 2 Cap protein antigen with a high-salt diluent, respectively, then add the diluted trivalent hyperimmune serum and the porcine circovirus type 2 Cap protein antigen into the holes of the agar plate, and incubate at 35-37°C for 20-24h to complete the detection.

[0011] Further, the porcine circovirus type 2a, 2b and 2d trivalent hyperimmune serum has an indirect immunofluorescence antibody titer of not less than 1:6400, which is obtained by isolating serum from piglets inoculated with the porcine circovirus type 2a, 2b and 2d trivalent virus-like particle vaccine. The piglets are preferably healthy piglets of 21 days old, which are inoculated by intramuscular injection at 2mL per head per time, and are given two booster immunizations at 14 days and 28 days after the first immunization, respectively. Aseptic blood is collected at 42 days after the first immunization, and the serum is isolated by a conventional method.

[0012] The porcine circovirus type 2a, 2b and 2d trivalent virus-like particle vaccine is prepared by mixing the porcine circovirus type 2a, 2b and 2d Cap proteins (each at a concentration of 0.15mg / mL) in a ratio of 1:1:1, and then emulsifying the mixture with an equal volume of ISA206 adjuvant.

[0013] The porcine circovirus type 2a, 2b and 2d virus-like particles are prepared by the method disclosed in CN117143888A, i.e. constructing the optimized gene nucleotide sequence into a pFastBac1 vector, obtaining a recombinant Bacmid by transforming the DH10Bac competent cells, obtaining a recombinant baculovirus by transfecting Sf9 cells, then inoculating High Five cells to harvest the culture, and purifying to obtain the PCV2a Cap protein virus-like particle or the PCV2b Cap protein virus-like particle or the PCV2d Cap protein virus-like particle.

[0014] Further, a gp64 signal peptide fragment is added to the N-terminal of the amino acid sequence of the PCV2a, 2b and 2d Cap proteins to improve the secretion expression of the proteins, and the nucleotide sequence of the gp64 signal peptide is as follows:

[0015] atggtgtccgccatcgtgctgtacgttcttctggctgccgcagctcactctgcatttgcc. (SEQ ID NO. 1)

[0016] Wherein PCV2a Cap protein is truncated N-terminal 41 amino acids, the optimized nucleotide sequence is as follows:

[0017] aacggtatctttaatgcaagactgtcgcgcaccttcggctacacagtaaaggctactaccgttagtacccctagttggtcagtcgatatgctgaggttcaacttggacgacttcgtccccccaggtggtggaactaacaagatcagcatcccgtttgaatactacaggatcagaaaggtcaaggttgagttctggccgtgttcacctattactcagggagacaggggaatcggctctagcgctataattctcgacgacaacttcgtaatgaaggtgcccgcacaaacctacgacccttatgtgaactattcttccagacacaccatcccacaacctttctcctatcactccagatacttcacacctaaaccggtcttggattcaaccattgactacttccagcccaataacaagagaaaccagttgtggatgaggctgcaaacgtcaagaaatgtcgaccacgttggcttgggaacagctttcgaaaactccaagtatgaccaggactacaacatccgtgtaaccatgtacgttcagtttcgcgaattcaacctcaaggatccaccactgaagccg. (SEQ ID NO. 2)

[0018] Wherein PCV2b Cap protein, the optimized nucleotide sequence is as follows:

[0019] atgacataccccagaagacgtttccgccgcagaagacacaggccaagatctcaccttggccaaattttgcgccgcaggccttggttggttcaccccagacaccgttatcgctggcgtcgcaaaaacggtattttcaacaccaggctcagccgcaccatcggatacactgtcaagaagaccactgtacgcactccaagctggaacgtggatatgatgaggtttaacatcaatgacttccttccacccggaggtggatcaaacccgttgacggttcctttcgagtactaccgcatacgcaaggtcaaagttgagttttggccctgttctccaatcacccaaggagacaggggcgtgggttccacagctgtaatcctggacgacaatttcgtgactaaggccaacgctcttacatacgacccatacgtgaactattcttcacgccacaccataactcagcctttctcctaccactctcgctacttcacccctaagcccgtgttggacaggacaattgactatttccagcctaacaacaagcgtaatcagctctggttgcgtttgcagacaacaggcaacgtcgatcatgtgggcctgggaactgctttcgagaactcaatctacgaccaagactacaacatccgtatcaccatgtatgtgcagttcagagagttcaatctgaaggatccccccctgaacccgaag. (SEQ ID NO. 3)

[0020] wherein the PCV2d Cap protein, the optimized nucleotide sequence is as follows:

[0021] atgacctatccaagaagacgcttccgtcgccgccgccaccgccctcgttcccacctcggccagatcttgaggcgtcgcccttggctcgtccatcccagacatagatatagatggcgcaggaagaacggaatttttaacacgaggttgagccgtacaatcggctatacggtaaaaaaaaccactgttaggacgccctcatggaacgtggatatgatgcgcttcaacatcaatgatttcctgcctccaggtggcggttctaaccccctcacagtacctttcgaatattacaggatccgcaaagtcaaagtggagttctggccttgtagtcctattacccaaggtgatcgtggtgtcggatccactgctgtgatcctcgatgataacttcgtcactaaggctaatgcattgacctacgatccctatgtcaactattcctcgcgccataccattacccaacccttcagctaccactctcgttacttcacccccaaacccgtactgggaggcaccatcgactactttcagccgaacaacaagcgtaaccagctgtggcttcgcctccagactacaggaaatgttgatcacgttggattgggcactgcgtttgaaaactccatctacgaccaggactacaatatacgcattacgatgtacgtccagttccgcgaattcaatctgaaggatccacccttgaaccca. (SEQ ID NO. 4)

[0022] Furthermore, 6×His tag was added at the C-terminal of the amino acid sequence of PCV2a, 2b and 2d Cap protein respectively to facilitate protein purification.

[0023] Further, the preparation method of the high salt agar plate in step (2) is as follows:

[0024] (1) The 12 sodium hydrogen phosphate solution with a concentration of 10-15 g / L is used as the first solution, and the potassium dihydrogen phosphate solution with a concentration of 1-3 g / L is used as the second solution;

[0025] (2) mixing the liquid A and the liquid B in a ratio of 1:2-5, adding agarose and sodium chloride, adjusting the pH value of the system to neutral, heating to completely melt the agarose, then adding an antibacterial agent, and then adding purified water to 100 mL, pouring 25 mL / plate into a flat plate, and then cooling and solidifying, and then punching with a plum blossom puncher, and then picking out the agarose gel in the hole; heating the bottom of the flat plate with an alcohol lamp flame to seal the bottom, and then the high-salt agar plate is prepared.

[0026] Further, the volume ratio of the liquid A and the liquid B is 1:3, the concentration of the disodium hydrogen phosphate dodecahydrate in the liquid A is 10-11 g / L, and the concentration of the potassium dihydrogen phosphate in the liquid B is 1-1.5 g / L.

[0027] Further, the concentration of the sodium chloride in the mixed solution of step (2) is 70-80 g / L.

[0028] Further, the antibacterial agent added in step (2) is sodium azide.

[0029] Further, the preparation method of the high-salt diluent in step (3) is as follows:

[0030] (1) taking a disodium hydrogen phosphate dodecahydrate solution with a concentration of 10-15 g / L as the liquid A, and taking a potassium dihydrogen phosphate solution with a concentration of 1-3 g / L as the liquid B;

[0031] (2) mixing the liquid A and the liquid B in a ratio of 1:2-5, adding sodium chloride, and adjusting the pH value of the system to neutral.

[0032] Further, the concentration of the sodium chloride in the high-salt diluent is 70-80 g / L.

[0033] Further, the dilution multiple of the high-titer serum is 8 times.

[0034] Another object of the present application is to provide a high-salt agar plate prepared by the above method.

[0035] Another object of the present application is to provide a high-salt diluent with a neutral pH value, which comprises a disodium hydrogen phosphate dodecahydrate solution, a potassium dihydrogen phosphate solution, and sodium chloride.

[0036] The concentration of the disodium hydrogen phosphate dodecahydrate solution is 10-15 g / L, the concentration of the potassium dihydrogen phosphate solution is 1-3 g / L, and the volume ratio of the two is 1:2-5.

[0037] The concentration of the sodium chloride in the high-salt diluent is 70-80 g / L.

[0038] The present application has the following beneficial effects:

[0039] 1. The application provides a porcine circovirus 2a, 2b, 2d type trivalent hyperimmune serum, the hyperimmune serum is obtained by inoculating piglets with a porcine circovirus 2a, 2b, 2d type trivalent virus-like particle vaccine, compared with the traditional method of inoculating piglets with a whole virus inactivated vaccine, no virus is involved, and there is no biological safety risk of incomplete inactivation; the antigen has high purity after purification treatment, the virus-like particle formed has the shell structure of the virus, and therefore has the advantages of good specificity, high immunogenicity and the like.

[0040] 2. The conventional method for preparing an agar plate mainly adds NaCl and agarose in PBS, punches and seals the bottom for detection. However, the solubility of the detected antigen is not considered, resulting in an insensitive detection result, or the bacterial growth on the agar plate affects the observation of the result. The application also provides an improved method for preparing an agar plate, and a high-salt agar plate is prepared, the composition of the buffer solution is adjusted, the migration of the antigen and antibody in the agarose gel is facilitated, the solubility of the Cap protein is increased by a high concentration of salt and control of the pH value of the buffer solution, the diffusion and combination of the antigen and antibody to form a precipitate are facilitated, and the sensitivity of the detection is improved; the growth of bacteria on the agar plate is inhibited by adding a certain concentration of a preservative, and the observation of the precipitate line is facilitated.

[0041] The application also provides a method for detecting the titer of porcine circovirus type 2 Cap protein antigen using hyperimmune serum and an improved agar plate, which solves the problems of buffer interference in the BCA method and the Bradford method, short storage period of the ELISA kit, easy oxidation of the substrate, high price and the like; the titer of porcine circovirus type 2 Cap protein antigen is detected using hyperimmune serum and an improved agar plate, and the method has high sensitivity, strong specificity, simple operation, can effectively avoid buffer interference, and low cost. BRIEF DESCRIPTION OF DRAWINGS

[0042] Figure 1 It is an indirect immunofluorescence picture of hyperimmune serum;

[0043] Figure 2 It is a detection result of different dilution multiples of hyperimmune serum;

[0044] Figure 3 It is a comparison detection result of a high-salt diluent and other diluents;

[0045] Figure 4 It is a detection result of different pH buffer solutions;

[0046] Figure 5 It is a comparison detection result of the addition of sodium azide;

[0047] Figure 6 It is a comparison detection result of the addition of an interference agent. DETAILED DESCRIPTION

[0048] The specific embodiments of the present application are described below to facilitate the understanding of the present application for those skilled in the art, but it should be clear that the present application is not limited to the scope of the specific embodiments, and for those skilled in the art, it is obvious that various changes are within the spirit and scope of the present application defined and determined by the appended claims, and all the inventions utilizing the concept of the present application are within the scope of protection.

[0049] Example 1 Preparation of trivalent hyperimmune serum of porcine circovirus 2a, 2b, and 2d types

[0050] 1. Preparation of trivalent virus-like particle vaccine of porcine circovirus 2a, 2b, and 2d types

[0051] (1) The virus-like particles of porcine circovirus 2a, 2b, and 2d types were prepared according to the method disclosed in the invention patent with application number CN117143888A.

[0052] (2) The virus-like particles of porcine circovirus 2a, 2b, and 2d types were diluted to 0.15 mg / mL with PBS, then mixed at 1:1:1, and then mixed with an equal volume of ISA206 adjuvant to emulsify into a water-in-oil-in-water type vaccine at about 30°C.

[0053] 2. Screening of porcine circovirus type 2 negative pigs

[0054] The 21-day-old healthy piglet serum antibodies were detected using the porcine circovirus type 2 antibody detection kit from Guangzhou Yueyang Biotechnology Co., Ltd., and the results were negative for immunization.

[0055] 3. Immunization

[0056] The piglets were injected intramuscularly with 2 mL per head per time, and the first immunization was followed by two booster immunizations at 14 days and 28 days, respectively. Aseptic blood was collected 42 days after the first immunization, and the serum was separated after 2 hours of storage at 2-8°C at 3000 rpm, and stored at -20°C or below. The serum antibodies were detected using the porcine circovirus type 2 antibody detection kit, and the OD 450nm value was higher than 1.5, which was the hyperimmune serum. Negative serum was also collected from non-immunized pigs.

[0057] 4. Indirect immunofluorescence antibody level detection

[0058] The porcine circovirus type 2 ZJ / C strain was diluted to 2000 TCID 50 / mL, 50 μL / well was inoculated into 96-well plates, 100 μL of PK15 cell suspension was added to each well, and the cells were cultured at 37°C for 72 hours, then fixed, and after the fixing solution was discarded, 5% skim milk was used for blocking, and after the plate was washed, the hyperimmune serum obtained in the previous step was diluted to different folds and added to the 96-well plate at 100 μL / well, and negative control wells were set, and the plate was incubated at 37°C for 2 hours, then washed, and 100 μL / well of FITC-labeled goat anti-pig IgG was added, and the plate was incubated at 37°C for 1 hour, then washed, and observed under a microscope. The results showed that the negative control wells had no specific fluorescence, and the hyperimmune serum still showed specific fluorescence at a dilution of 6400 times, indicating that the indirect immunofluorescence antibody titer of the hyperimmune serum was more than 1:6400, and the hyperimmune serum fluorescence map is shown in Figure 1 .

[0059] Example 2 Establishment of improved gel diffusion method

[0060] 1. Determination of dilution fold of hyperimmune serum

[0061] (1) Add 1 g of agarose to 100 mL of PBS, heat until the agarose is completely melted, then add purified water to 100 mL, pour 25 mL / plate into a flat dish, cool and solidify, then use a 7-hole clover punch to punch out the agarose gel in the hole, and use an alcohol lamp flame to heat the bottom of the flat dish to seal the bottom.

[0062] (2) Add PCV2 Cap protein antigen to the middle hole, and add hyperimmune serum to the surrounding holes 1-5 in order according to the original fold, dilution of 2 times, 4 times, 8 times, and 16 times, and add negative serum to the 6th hole, each hole is added with 30-50 μL, cover the flat dish cover and place it in a wet box at 37°C for 24 hours to observe the results.

[0063] (3) The results are shown in Figure 2 When the hyperimmune serum is at the original fold, the precipitation line is curved, when it is diluted by 2 and 4 times, the precipitation line is thicker, but it is closer to the center hole of the antigen and is relatively blurred, when it is diluted by 8 times, the precipitation line is clear and straight, and when it is diluted by 16 times, the precipitation line is very shallow, so the best dilution fold of the hyperimmune serum is determined to be 8 times.

[0064] 2. Comparison of high-salt diluent and other diluents

[0065] (1) Preparation of agar plate

[0066] Take 3.58 g of dodecahydrate sodium hydrogen phosphate, 0.24 g of potassium dihydrogen phosphate, 0.2 g of potassium chloride and 8 g of sodium chloride, and dissolve them in 1 L of purified water to obtain a PBS solution; take 10.74 g of dodecahydrate sodium hydrogen phosphate and dissolve it in 1 L of purified water to obtain a liquid A, and take 1.36 g of potassium dihydrogen phosphate and dissolve it in 1 L of purified water to obtain a liquid B; take 6 triangular flasks, add 100 mL of the liquid A to the first flask, 100 mL of the liquid B to the second flask, 100 mL of PBS to the third flask, 25 mL of the liquid A and 75 mL of the liquid B to the fourth flask, 25 mL of the liquid A, 75 mL of the liquid B and 2 g of sodium chloride to the fifth flask, and 25 mL of the liquid A, 75 mL of the liquid B and 8 g of sodium chloride to the sixth flask;

[0067] Add 1 g of agarose to each of the first to sixth flasks, heat until the agarose is completely melted, and then add purified water to make up to 100 mL, pour into a flat dish at 25 mL per plate and mark as 1-6 respectively, and after cooling and solidification, use a plum blossom puncher to punch out the agarose gel in the holes. Heat the bottom of the flat dish with an alcohol lamp flame to seal the bottom. The concentration of sodium chloride in PBS is 0.8%, and the concentrations of sodium chloride in the fifth and sixth flat dishes are 2% and 8% respectively, and the concentrations of dodecahydrate sodium hydrogen phosphate and potassium dihydrogen phosphate are also increased, so the fifth flat dish is called a low-salt diluent agar plate, and the sixth flat dish is called a high-salt diluent agar plate.

[0068] (2) Add 8-fold diluted hyperimmune serum to the middle hole of each of the first to sixth agar plates, and add gradient-diluted PCV2 Cap protein antigen to the surrounding 6 holes in order, wherein the hyperimmune serum and the antigen added to the first agar plate are diluted with the liquid A, the hyperimmune serum and the antigen added to the second agar plate are diluted with the liquid B, the hyperimmune serum and the antigen added to the third agar plate are diluted with PBS, the hyperimmune serum and the antigen added to the fourth agar plate are diluted with a mixture of 25 mL of the liquid A and 75 mL of the liquid B, the hyperimmune serum and the antigen added to the fifth agar plate are diluted with a low-salt diluent mixture of 25 mL of the liquid A, 75 mL of the liquid B and 2 g of sodium chloride, and the hyperimmune serum and the antigen added to the sixth agar plate are diluted with a high-salt diluent mixture of 25 mL of the liquid A, 75 mL of the liquid B and 8 g of sodium chloride, 30-50 μL is added to each hole, the flat dish cover is put on, and then the flat dish is placed upside down in a wet box and incubated at 37°C for 24 hours to observe the results.

[0069] The results are as follows Figure 3As shown, the detection results of the first agar plate using the A liquid and the second agar plate using the B liquid showed that the titer of the agglutination was 1:8, the detection results of the third agar plate using PBS and the fourth agar plate using the A liquid + the B liquid showed that the titer of the agglutination was 1:16, but the precipitin line at the 1:16 titer of the fourth agar plate was more obvious, the detection results of the fifth agar plate using 25 mL of the A liquid + 75 mL of the B liquid + 2 g of sodium chloride showed that the titer of the agglutination was 1:32, and the detection results of the sixth agar plate using 25 mL of the A liquid + 75 mL of the B liquid + 8 g of sodium chloride showed that the titer of the agglutination was 1:64, indicating that the high-salt agar plate and the high-salt diluent improved the detection sensitivity.

[0070] 3. Comparison of pH of buffer

[0071] (1) The A liquid and the B liquid were prepared according to the above method, 25 mL of the A liquid and 75 mL of the B liquid were mixed in four triangular flasks, then 1 g of agarose and 8 g of NaCl were added, the pH was adjusted to 6.0, 7.0, 8.0 and 9.0 respectively, heated to completely melt the agarose, then 100 mL of purified water was added to make up the volume, 25 mL / plate was poured into the flat dishes, and after cooling and solidification, the agarose gel in the holes was punched out with a plum blossom puncher. The bottom of the flat dish was heated and sealed with a alcohol lamp flame.

[0072] (2) 8-fold diluted hyperimmune serum was added to the middle hole of the agar plate with pH of 6.0, 7.0, 8.0 and 9.0, and gradient-diluted PCV2 Cap protein antigen was added to the surrounding 6 holes in order, the hyperimmune serum and the antigen were diluted with the above-mentioned high-salt diluent, and the pH was adjusted to the pH value of the corresponding agar plate, the amount added to each hole was 30-50 μL, the flat dish cover was covered and then inverted and placed in a wet box, and the results were observed after incubation at 37°C for 24 hours.

[0073] The results are shown in Table 2. Figure 4 As shown, the titer of the PCV2 Cap protein antigen agglutination detected by the agar plate with pH of 7.0 was the highest, which was 1:60, while the titers detected at other pH values were lower, which were 1:40 at pH 6.0 and pH 8.0, and the precipitin line at 1:40 was very weak at pH 9.0.

[0074] 4. Comparison of addition of preservative sodium azide

[0075] (1) Prepare solution A and solution B according to the above method. Take 25 mL of solution A and 75 mL of solution B in two Erlenmeyer flasks and mix them. Then add 1 g of agarose and 8 g of NaCl, adjust the pH to 7.0, and heat until the agarose is completely dissolved. Add 1 mL of 2% sodium azide to the first Erlenmeyer flask and do not add sodium azide to the second one. Then add purified water to make up 100 mL. Pour the solution into a petri dish at a rate of 25 mL / plate. After cooling and solidification, punch holes with a plum blossom punch and pick out the agarose gel in the holes. Heat the bottom of the petri dish with an alcohol lamp flame to seal it.

[0076] (2) Add 8-fold diluted hyperimmune serum to the middle well of each of the two agar plates, and add serially diluted PCV2 Cap protein antigen to the surrounding 6 wells in sequence. The hyperimmune serum and antigen are diluted with the above-mentioned high-salt diluent and the pH is adjusted to 7.0. The amount added to each well is 30~50μL. After covering the petri dish with the lid, invert it and place it in a humidified box. Incubate at 37°C for 120 hours and observe the results.

[0077] The results are as follows Figure 5 As shown, when observing the results after 120 hours, the agar plates without sodium azide showed bacterial growth, affecting the observation of the results, while the agar plates with sodium azide did not affect the observation.

[0078] 5. Construct an improved method for detecting agar-agar.

[0079] Based on the above results, the improved agar plate amplification detection method is as follows: On a high-salt agar plate after perforation, add 30-50 μL of 8-fold diluted hyperimmune serum to the middle well, and add 30-50 μL of diluted porcine circovirus type 2 Cap protein antigen to the surrounding 6 wells in sequence. Both the hyperimmune serum and the antigen are diluted with high-salt diluent with a pH of 7.0. After covering the plate, invert it and place it in a humidified chamber. Incubate at 37°C for 24 hours to observe the results.

[0080] Example 3: Comparison of the addition of interferon with the BCA and Bradford methods

[0081] Some reagents or contaminating proteins can severely interfere with the accuracy of protein content detection results. For example, the elution buffer commonly used for the purification of His-tagged proteins often requires 500 mM imidazole. In addition, contaminating proteins may remain during the purification process. Therefore, this example compares the improved agar amplification detection method established in Example 2 with the BCA and Bradford methods. The specific process is as follows:

[0082] Prepare PCV2 Cap protein standard solution and PCV2 Cap protein solution containing interferon. The interferon-containing solution is prepared by adding 500 mM imidazole and 500 μg / mL BSA protein to the PCV2 Cap protein standard solution. Detection was performed using the modified agar amplification method, the BCA method, and the Bradford method, respectively. Results are shown in [Figure number missing].Figure 6 and Table 1.

[0083] Table 1. Detection results of three methods

[0084]

[0085] As Figure 6 As shown in the detection results of Table 1, the detection results of the RIA method are both 1:60 before and after adding the interference agent, which indicates that the addition of 500 mM imidazole and 500 μg / mL BSA protein has no effect on the detection of RIA titer.

[0086] The detection results of BCA and Bradford methods on the PCV2 Cap protein standard solution and the PCV2 Cap protein solution containing the interference agent are shown in Table 1. The BCA detection results show that the protein concentrations before and after adding the interference agent are 1326 μg / mL and 3375 μg / mL, respectively, and the Bradford detection results show that the protein concentrations before and after adding the interference agent are 1357 μg / mL and 2283 μg / mL, respectively. The results show that the BCA method and the Bradford method are interfered by imidazole and impurities, but the improved RIA detection method constructed by the present application is not interfered, which proves that the improved RIA detection method constructed by the present application has strong specificity and can effectively avoid buffer interference.

[0087] Finally, it should be noted that the above specific embodiments are only used to illustrate the technical solutions of the present application and are not limiting. Although the present application has been described in detail with reference to the examples, it should be understood by those skilled in the art that the technical solutions of the present application can be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present application, and they should be covered in the scope of the claims of the present application.

Claims

1. A method for improving the sensitivity of a porcine circovirus type 2 Cap protein antigen ELISA assay, characterized in that, It comprises the following steps: (1) inoculating piglets with a porcine circovirus type 2a, 2b and 2d trivalent virus-like particle vaccine, and then separating serum to obtain a porcine circovirus type 2a, 2b and 2d trivalent hyperimmune serum; (2) preparing a high-salt agar plate; S1, using a 10-15 g / L disodium hydrogen phosphate dodecahydrate solution as the first liquid and a 1-3 g / L potassium dihydrogen phosphate solution as the second liquid; S2, mixing the first liquid and the second liquid at a ratio of 1:2-5, adding agarose and sodium chloride to obtain a mixed liquid, adjusting the pH value of the mixed liquid system to neutral, adjusting the concentration of sodium chloride in the mixed liquid to 70-80 g / L, heating until the agarose is completely melted, then adding an antibacterial agent, pouring into a flat dish, then allowing it to cool and solidify, punching, then heating to seal the bottom of the hole, and preparing a high-salt agar plate; (3) diluting the trivalent hyperimmune serum and the porcine circovirus type 2 Cap protein antigen with a high-salt diluent, then adding the diluted trivalent hyperimmune serum and the porcine circovirus type 2 Cap protein antigen to the holes of the agar plate, and incubating at 35-37°C for 20-24 h to complete the detection.

2. The method of claim 1, wherein, The porcine circovirus type 2a, 2b and 2d trivalent virus-like particle vaccine comprises porcine circovirus type 2a, 2b and 2d Cap proteins at a volume ratio of 1:1:1, and an adjuvant.

3. The method of claim 1, wherein, The volume ratio of the first liquid to the second liquid is 1:3, the concentration of disodium hydrogen phosphate dodecahydrate in the first liquid is 10-11 g / L, and the concentration of potassium dihydrogen phosphate in the second liquid is 1-1.5 g / L.

4. The method of claim 1, wherein, The antibacterial agent added in step (2) is sodium azide.

5. The method of claim 1, wherein, The preparation method of the high-salt diluent in step (3) is as follows: (1) using a 10-15 g / L disodium hydrogen phosphate dodecahydrate solution as the first liquid and a 1-3 g / L potassium dihydrogen phosphate solution as the second liquid; (2) mixing the first liquid and the second liquid at a ratio of 1:2-5, then adding sodium chloride, and adjusting the pH value of the system to neutral.

6. The method of claim 5, wherein, The concentration of sodium chloride in the high-salt diluent is 70-80 g / L.

7. A high salt agar plate characterized in that, Prepared by the method of any one of claims 1-4. Prepared by the method of any one of claims 1-4.

Citation Information

Patent Citations

  • Porcine circovirus type 2 antigen composition and application thereof in antigen quantification method

    CN114805501A

  • Porcine circovirus 2a, 2b and 2d type trivalent virus-like particle vaccine as well as preparation method and application thereof

    CN117143888A

  • Immunogenic streptococcus proteins

    CN101821627A