A molecular marker of wheat stripe rust snp homozygous site based on whole genome sequence and application thereof
Molecular markers for homozygous SNP sites in wheat stripe rust fungus, developed using whole-genome sequencing, have solved the problem of inaccurate detection in existing technologies, enabling rapid, accurate identification and efficient detection in population genetics studies of wheat stripe rust fungus.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- NORTHWEST A & F UNIV
- Filing Date
- 2025-01-17
- Publication Date
- 2026-06-26
AI Technical Summary
Existing wheat stripe rust SNP markers do not use a reference genome spliced to the chromosome level, do not fully consider the differences between different regions around the world, and do not consider the homozygosity of the loci, resulting in inaccurate detection.
Molecular markers for homozygous SNP sites were developed using whole-genome sequences. Using stripe rust genome sequences from different regions around the world, 37 specific primers were designed. PCR amplification and fluorescence data reading were performed using KASP-SNP molecular marker technology. Population structure analysis was conducted using IQ-TREE and STRUCTURE software.
It enables rapid and accurate identification of the genetic diversity and structure of wheat stripe rust populations, improving the accuracy and efficiency of detection and making it suitable for large-scale sample testing.
Smart Images

Figure CN119799953B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of molecular biotechnology and molecular marker technology, specifically relating to a molecular marker based on homozygous SNP sites in wheat stripe rust fungus and its application. Background Technology
[0002] Wheat stripe rust is a catastrophic disease caused by the fungus *Strombus styracifolius*, which severely damages wheat production and food security. In epidemic years, this disease can lead to yield losses exceeding 40%, or even total crop failure. *Strombus styracifolius* is characterized by rapid race variation, high epidemic frequency, rapid spread, large-scale outbreaks, and severe losses. Identifying the genotype of *Strombus styracifolius* populations can monitor their population structure and dynamic changes, clarify the communication and transmission relationships between different regions, and provide a theoretical basis for the precise control of wheat stripe rust.
[0003] SNP stands for Single Nucleotide Polymorphism. SNP molecular markers refer to genetic markers formed by single nucleotide variations in the genome. They are characterized by wide distribution in the genome, high stability, and rich polymorphism, and are widely used in molecular-assisted breeding, germplasm resource identification, and species population structure analysis.
[0004] Currently, existing wheat stripe rust SNP markers were developed without using a reference genome spliced to the chromosome level, resulting in inaccurate locus information. The stripe rust genomes used to detect variant sites are limited, and the differences between stripe rusts in different regions of the world have not been fully considered. At the same time, the homozygosity of loci was not considered in the development of existing wheat stripe rust SNP markers, and the identified differential loci may be due to the heterozygosity of the stripe rust itself.
[0005] Therefore, by using stripe rust genomes spliced to the chromosome level as a reference genome and employing stripe rust genome sequences from different regions around the world, a set of molecular markers based on homozygous SNP sites of whole genome sequences was developed and applied to population genetics research of wheat stripe rust. This has played an important role in monitoring dynamic changes in wheat stripe rust populations, analyzing population structure, and studying population genetic communication relationships. Summary of the Invention
[0006] The purpose of this invention is to provide a molecular marker for homozygous SNP sites in wheat stripe rust fungus based on whole genome sequence and its application, thereby overcoming the defects and deficiencies in the existing technology.
[0007] To achieve the above objectives, the present invention adopts the following technical solution: The present invention provides 37 SNP-specific primers, which can be applied to the genotyping of wheat stripe rust fungus. Primer information is detailed in Table 1.
[0008] Table 1 Primer design for homozygous SNP sites in wheat stripe rust based on whole genome sequence.
[0009]
[0010]
[0011] This invention also provides a method for identifying wheat stripe rust genotypes using this set of SNP molecular markers, the method being as follows:
[0012] (1) Genomic DNA of wheat stripe rust fungus was extracted using the CTAB method;
[0013] (2) Add the FAM fluorescent adapter sequence GAAGGTGACCAAGTTCATGCT to the 5' end of the forward Wildtype primer in Table 1, add the HEX fluorescent adapter sequence GAAGGTCGGAGTCAACGGATT to the 5' end of the forward Mutant primer, and synthesize the KASP-SNP molecular marker.
[0014] (3) Using the DNA obtained in (1) as a template, the genotype of wheat stripe rust was detected by PCR-specific amplification using the molecular marker synthesized in (2). The PCR reaction system was 5.07 μL: genomic DNA 2 μL (dried at 65°C), 2×KASP mix 2.5 μL, primer mixture 0.07 μL, and ddH2O 2.5 μL. The PCR reaction conditions were: pre-denaturation at 94°C for 15 minutes; 10 decreasing PCR cycles, each cycle including denaturation at 94°C for 20 seconds and annealing for 60 seconds, with an initial annealing temperature of 60°C and a decrease in annealing temperature of 0.8°C per cycle; followed by 32 extension cycles, including denaturation at 94°C for 20 seconds and annealing at 57°C for 60 seconds.
[0015] (4) The amplification products were read for fluorescence data using a fully automated multi-functional microplate reader, and the genotype was detected using KlusterCaller software;
[0016] (5) The phylogenetic tree of wheat stripe rust fungus population was constructed using IQ-TREE 2.1.3 software and beautified using iTOL 6 software; the population structure was analyzed using STRUCTURE 2.3 software and principal component discrimination analysis was performed using the adegenet package in R language.
[0017] The present invention also provides the application of the above-mentioned SNP molecular markers in the genotyping and population genetic analysis of wheat stripe rust fungus. The feature is that the set of molecular markers can rapidly and accurately identify the genetic diversity and population structure of wheat stripe rust fungus.
[0018] Compared with the prior art, the present invention has the following advantages:
[0019] (1) In this invention, CRY34 spliced to the chromosome level is selected as the reference genome. Original data of wheat stripe rust fungus from different countries such as China, the United States, the United Kingdom, Australia, Denmark, France, and India are compared, filtered, and screened to develop SNP molecular markers, which have higher polymorphism and applicability than existing markers.
[0020] (2) The nucleus of wheat stripe rust fungus is binucleate and has a high degree of heterozygosity. The SNP molecular markers in this invention are developed based on homozygous SNP sites on the wheat stripe rust fungus genome, which can effectively eliminate differences caused by the heterozygosity of the sites themselves, and can ensure the accuracy of differential site detection;
[0021] (3) In this set of SNP molecular markers, the PCR reaction system for each marker only requires 5.07 μL, which can be completed in a 384-well PCR plate, allowing for the simultaneous detection of a large number of samples with high detection efficiency. Attached Figure Description
[0022] Figure 1 This is a phylogenetic tree constructed from 308 wheat stripe rust genotypes obtained using molecular markers developed based on this invention. MG1-MG6 represent different molecular populations; bootstrap represents the support of a branch in the phylogenetic tree.
[0023] Figure 2 This is a structural diagram of 308 wheat stripe rust fungal communities constructed based on molecular marker genotypes. G1 represents the eastern Qinghai community, G2 the central Gansu community, G3 the western Liupanshan community, G4 the Longnan community, G5 the eastern Longdong community, and G6 the western Guanzhong community.
[0024] Figure 3 This is a principal component discriminant analysis diagram of 308 wheat stripe rust fungal populations constructed based on molecular marker genotypes. Detailed Implementation
[0025] The advantages and features of the present invention are further illustrated below through specific embodiments. These embodiments are merely examples and should not be considered as any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions in detail and form can be made to the technical solutions of the present invention without departing from the spirit and scope thereof, but such modifications or substitutions all fall within the protection scope of the present invention.
[0026] Example 1: Obtaining molecular markers of homozygous SNP sites in wheat stripe rust fungus based on the whole genome
[0027] This invention selects the wheat stripe rust fungus CRY34, spliced to the chromosome level, as the reference genome. Using BWA-MEM and GATK HaplotypeCaller software, raw genome data from 28 wheat stripe rust fungi from China, the United States, the United Kingdom, Australia, Denmark, France, and India were compared with the reference genome, identifying 1,790,286 variant sites. Among these, 1,381,576 biallelic SNP sites were identified with sequencing depths between 20 and 1000-fold. Linkage disequilibrium analysis yielded 100,749 independent SNP sites, of which 1,076 were identified as homozygous in the 28 wheat stripe rust fungi. Further screening based on minor allele frequencies, deletion rates, and other parameters ultimately yielded 113 SNP sites.
[0028] Example 2: Development of KASP-SNP markers for wheat stripe rust fungi based on the whole genome
[0029] Primers were designed for the aforementioned SNP sites using WASP software. Thirty-seven SNP sites were suitable for primer design. These markers had a minor allele frequency of 0.11–0.39, gene diversity of 0.19–0.48, polymorphism information content of 0.17–0.36, and heterozygosity of 0 for all sites. FAM 5'GAAGGTGACCAAGTTCATGCT 3' and HEX 5'GAAGGTCGGAGTCAACGGATT 3' fluorescent linkers were added to the forward Wildtype and Mutant primers, respectively, to synthesize KASP-SNP molecular markers.
[0030] Example 3: Genotyping Method Based on Whole-Genome Markers for Wheat Stripe Rust
[0031] DNA was extracted from the urediniospores of wheat stripe rust fungus using the CTAB method. PCR amplification of the stripe rust DNA was performed using 37 sets of specific KASP-SNP primers, with each primer set capable of detecting 384 stripe rust samples at once on a PCR plate. 2 μL of DNA was added to each PCR well and dried at 65°C for 40 minutes, followed by 2.5 μL of 2×KASP mix, 0.07 μL of primer mixture, and 2.5 μL of ddH2O. The PCR amplification program was as follows: 94°C pre-denaturation for 15 minutes; 94°C denaturation for 20 seconds, annealing at 60°C (-0.8°C / cycle) for 60 seconds, for a total of 10 cycles; 94°C denaturation for 20 seconds, annealing at 57°C for 60 seconds, for 32 cycles. Fluorescence data of the amplified products were read using a FLUOstar Omega fully automated multi-functional microplate reader (BMG LABTECH, Germany), and SNP genotyping was performed using Kluster Caller software (LGC Biosearch Technologies, UK).
[0032] Example 4: Analysis of wheat stripe rust community structure based on SNP genotypes
[0033] A phylogenetic tree of 308 wheat stripe rust fungal communities was constructed using 37 SNPs. A bootstrapping analysis with 1000 replicates was performed using the TVM+F+ASC+G4 model in IQ-TREE 2.1.3 software. The phylogenetic tree was visualized and annotated using iTOL 6 (https: / / itol.embl.de / ). Figure 1 The population structure analysis was performed using the STRUCTURE 2.3 program. For each simulation's cluster size (K), five runs were performed, each consisting of 10,000 tests and 40,000 iterations. The optimal K value was determined using the STRUCTURE HARVESTER program (http: / / taylor0.biology.ucla.edu / structureHarvester). The generated population structure data were processed using Clumpp 1.1.2 software and visualized using Distruct 1.1. Figure 2 Principal component discriminant analysis (DAPC) was performed using the adegenet package in R to complete the clustering of wheat stripe rust samples. Figure 3 ).
Claims
1. A primer set for detecting SNP molecular markers in wheat stripe rust fungus, characterized in that, The primer set consists of 37 primer combinations as described in 1-37 below, wherein each primer combination consists of a forward Wildtype primer, a forward Mutant primer, and a reverse primer: Primer combinations 1-37 were used to amplify the corresponding SNP sites. The reference genome was CYR34, and the 37 homozygous SNP sites were distributed on 14 chromosomes of the reference genome. The site information is as follows: Chr1_277111 is located at position 277111 on chromosome 1, and its deoxynucleotide is either G or A. Chr1_1514334 is located at position 1514334 on chromosome 1, and its deoxynucleotide is G or T. Chr1_5151405 is located at position 5151405 on chromosome 1, and its deoxynucleotide is C or G; Chr2_279415 is located at position 279415 on chromosome 2, and its deoxynucleotide is either G or A. Chr2_896156 is located at position 896156 on chromosome 2, and its deoxynucleotide is either A or G. Chr2_998173 is located at position 998173 on chromosome 2, and its deoxynucleotide is C or T. Chr2_1041509 is located at position 1041509 on chromosome 2, and its deoxynucleotide is either G or C. Chr3_2205441 is located at position 2205441 on chromosome 3, and its deoxynucleotide is C or T. Chr3_2269449 is located at position 2269449 on chromosome 3, and its deoxynucleotide is C or T. Chr3_3970574 is located at position 3970574 on chromosome 3, and its deoxynucleotide is either G or A. Chr4_2956131 is located at position 2956131 on chromosome 4, and its deoxynucleotide is C or T. Chr4_3402226 is located at position 3402226 on chromosome 4, and its deoxynucleotide is C or T. Chr4_5392145 is located at position 5392145 on chromosome 4, and its deoxynucleotide is C or T. Chr5_1499190 is located at position 1499190 on chromosome 5, and its deoxynucleotide is either G or A. Chr5_4544872 is located at position 4544872 on chromosome 5, and its deoxynucleotide is either A or G. Chr6_749630 is located at position 749630 on chromosome 6, and its deoxynucleotide is either G or A. Chr6_1939399 is located at position 1939399 on chromosome 6, and its deoxynucleotide is C or T. Chr6_2733230 is located at position 2733230 on chromosome 6, and its deoxynucleotide is either A or T. Chr7_717077 is located at position 717077 on chromosome 7, and its deoxynucleotide is C or T. Chr7_2276040 is located at position 2276040 on chromosome 7, and its deoxynucleotide is either G or C. Chr7_3763260 is located at position 3763260 on chromosome 7, and its deoxynucleotide is either G or A. Chr9_201188 is located at position 201188 on chromosome 9, and its deoxynucleotide is C or T. Chr9_843505 is located at position 843505 on chromosome 9, and its deoxynucleotide is either T or A. Chr9_1370829 is located at position 1370829 on chromosome 9, and its deoxynucleotide is either G or A. Chr9_1381122 is located at position 1381122 on chromosome 9, and its deoxynucleotide is C or T. Chr9_3149493 is located at position 3149493 on chromosome 9, and its deoxynucleotide is either G or A. Chr10_230077 is located at position 230077 on chromosome 10, and its deoxynucleotide is C or T. Chr12_23929 is located at position 23929 on chromosome 12, and its deoxynucleotide is either T or C. Chr12_2805263 is located at position 2805263 on chromosome 12, and its deoxynucleotide is either A or G. Chr14_3096987 is located at position 3096987 on chromosome 14, and its deoxynucleotide is either T or C. Chr16_106435 is located at position 106435 on chromosome 16, and its deoxynucleotide is C or T. Chr16_1855070 is located at position 1855070 on chromosome 16, and its deoxynucleotide is G or T. Chr16_2481069 is located at position 2481069 on chromosome 16, and its deoxynucleotide is either G or A. Chr17_724947 is located at position 724947 on chromosome 17, and its deoxynucleotide is either G or C. Chr17_1200207 is located at position 1200207 on chromosome 17, and its deoxynucleotide is C or T. Chr17_1279204 is located at position 1279204 on chromosome 17, and its deoxynucleotide is either G or A. Chr18_30688 is located at position 30688 on chromosome 18, and its deoxynucleotide is either G or T.
2. The application of the primer set for detecting SNP molecular markers of wheat stripe rust as described in claim 1 in the genetic diversity analysis of wheat stripe rust.
3. The application of the primer set for detecting SNP molecular markers of wheat stripe rust as described in claim 1 in the detection of wheat stripe rust genotypes.
Citation Information
Patent Citations
Application of wheat stripe rust genome SNP (Single Nucleotide Polymorphism) site combination in genetic typing of wheat stripe rust
CN116287394A
Wheat stripe rust SNP molecular marker, KASP detection primer group and application
CN117568521A