Preparation method and application of a recombinant adenovirus spontaneously generating virus-like particles

By inserting exogenous viral membrane protein genes into an adenovirus vector, virus-like particles are spontaneously assembled, solving the problems of complex construction and high cost of existing virus-like particle vaccines, and achieving the effects of simplified production and improved immunogenicity.

CN119979483BActive Publication Date: 2026-05-12HUAZHONG AGRI UNIV
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202510143667.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-10
Publication Date
2026-05-12
Estimated Expiration
2045-02-10

AI Technical Summary

Technical Problem

In existing technologies, the construction process of virus-like particle vaccines is complex, the production cost is high, the purification is difficult, the batch-to-batch stability is poor, and the storage conditions are stringent. Furthermore, adenovirus vectors can only express intact membrane proteins on the surface of infected cell membranes, which limits the maximization of their immune response.

Method used

By linking the exogenous viral membrane protein gene with the EARP gene and inserting it into the E3 region of the adenovirus backbone plasmid and the E1 region of the shuttle plasmid, a recombinant adenovirus was constructed, which spontaneously assembled into the VLP structure of the viral membrane protein during in vivo and in vitro infection.

Benefits of technology

It simplifies the VLP construction process, reduces vaccine production costs, significantly improves vaccine immunogenicity, and enables easy purification and stable storage of virus-like particles.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119979483B_ABST
    Figure CN119979483B_ABST
Patent Text Reader

Abstract

The application discloses a preparation method and application of a recombinant adenovirus spontaneously generating virus-like particles, and relates to the technical field of biology. The preparation method of the recombinant adenovirus comprises the following steps: connecting a virus membrane protein gene and a budding-promoting EARP gene to construct a recombinant exogenous virus membrane protein gene; inserting the recombinant exogenous virus membrane protein gene into an E3 region of an adenovirus skeleton plasmid to obtain a recombinant skeleton plasmid; inserting the recombinant exogenous virus membrane protein gene into an E1 region of an adenovirus shuttle plasmid to obtain a recombinant shuttle plasmid; and co-transfecting the recombinant skeleton plasmid and the recombinant shuttle plasmid into a host cell to obtain a recombinant adenovirus spontaneously generating virus-like particles (VLP). The recombinant adenovirus constructed by using the preparation method can spontaneously assemble VLPs containing virus outer membrane proteins in an in-vivo or in-vitro infection process, and thus the immunogenicity of a vaccine can be greatly improved, the VLP production process is simplified, and the production cost of the vaccine is reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a method for preparing recombinant adenovirus that spontaneously generates virus-like particles and its application. Background Technology

[0002] The continuous emergence of new and emerging infectious diseases has created an urgent need for safe and effective new vaccines. In recent decades, with the rapid development of fields such as genetic engineering, molecular and cellular immunology, structural biology, bioinformatics, computational biology, nanotechnology, and synthetic biology, new vaccine platforms such as mRNA, synthetic DNA, recombinant viral vectors, and virus-like particles (VLPs) have been gradually established and matured, and have played a significant role in the fight against the COVID-19 pandemic.

[0003] Virus-like particle (VLP) technology offers an alternative platform for developing effective vaccines to control infectious diseases, progressing alongside mRNA and viral vector vaccines. VLPs are mostly nanoparticles formed by the in vitro self-assembly of one or more viral structural proteins, containing no genetic material, which greatly improves the safety of such vaccines. VLPs, due to their antigenic structure and spatial distribution being highly similar to their originating viruses, can effectively elicit humoral and cellular immune responses. Furthermore, their morphology and size are highly variable, ranging from 20 to 200 nanometers. This size range allows the body to freely release them into lymph nodes, where they are more easily taken up by antigen-presenting cells (APCs), particularly dendritic cells (DCs), and then processed and presented via major histocompatibility complex (MHC) class II molecules. Currently, only a few non-enveloped viral structural proteins (such as HPV L1 protein, HBV surface antigen HBsAg, and norovirus VP1) can spontaneously assemble into VLPs. In contrast, most enveloped viruses cannot spontaneously form VLPs from a single viral structural protein. The formation of VLPs in influenza viruses requires the co-expression of matrix protein M1 and surface glycoproteins HA (hemagglutinin) or NA (neuraminidase); for SARS-CoV-2 to form a complete VLP, the spike protein S, membrane protein M, and envelope protein E must be co-expressed; the co-expression of prM and E proteins in Zika virus can form a VLP; and the formation of VLPs in rabies virus requires the co-expression of glycoprotein G and matrix protein M. The co-expression of multiple structural proteins makes the VLP formation process more complex. In existing technologies, VLPs are mainly developed by cloning viral structural protein genes into expression vectors and then expressing these genes in vitro in systems such as bacteria, yeast, mammalian cells, and insect cells. While each of these expression systems has its advantages, it also has some shortcomings. Key challenges associated with VLPs include low stability, difficult downstream processing, poor batch-to-batch stability, high production costs, and high sensitivity to storage conditions. Large-scale production and purification of VLPs require different processes, such as density gradients or even chromatography, to manufacture the final formulated product. These complex processes are costly and time-consuming. This also leads to difficulties in industrial-scale production of VLPs and requires multiple quality control measures.

[0004] Compared to the complex construction process, high cost, cumbersome production quality control steps, and stringent storage and transportation conditions of in vitro self-assembled VLPs, adenovirus vectors have significant advantages such as high virus yield, low production cost, simple purification steps, stable physicochemical properties, and easy storage and transportation.

[0005] With in-depth research and continuous exploration in adenovirus biology and immunology, various adenovirus vector vaccines have emerged. In existing technologies, adenovirus vector vaccines primarily integrate exogenous genes into the E1 or E3 region of the adenovirus genome using reverse genetics. After infecting cells, the exogenous gene is expressed on target cells, thereby stimulating an immune response or enabling gene therapy. For viral membrane proteins, current technologies can only express intact membrane proteins on the surface of infected cell membranes. However, the anchoring sites of membrane proteins are limited, and the isolated expression of membrane protein antigens on the cell surface may restrict the large-scale expression of exogenous genes in adenovirus vector vaccines. Furthermore, current technologies can only produce membrane proteins in situ (immunization / injection site); the antigens cannot be recognized and bound by immune cells far from the injection site. Therefore, vector vaccines produced by current technologies cannot maximize the stimulation of the body's immune potential.

[0006] In existing technologies, virus-like particle (VLP) vaccines face numerous challenges, including complex construction processes, difficulties in in vitro expression, high purification requirements, cumbersome processes, high production costs, poor batch-to-batch stability, and stringent storage conditions. Furthermore, adenovirus vectors can only express intact exogenous membrane proteins on the surface of infected cell membranes, thus limiting the potential of such vector vaccines to reach their full potential. This invention, based on the complementary strengths and weaknesses of adenovirus vectors and VLPs platforms, aims to develop a method for preparing recombinant adenoviruses that spontaneously generate virus-like particles. This method simplifies the VLP construction process and production technology, reduces vaccine production costs, and simultaneously significantly improves vaccine immunogenicity. Summary of the Invention

[0007] The purpose of this invention is to provide a method for preparing recombinant adenoviruses that spontaneously generate virus-like particles and their applications, thereby addressing the problems existing in the prior art. The recombinant adenovirus constructed using this method can spontaneously assemble into a VLP structure containing the viral membrane protein during in vitro and in vivo infection by expressing only a single modified viral membrane protein. This simplifies the VLP construction process and production technology, reduces vaccine production costs, and significantly improves vaccine immunogenicity.

[0008] To achieve the above objectives, the present invention provides the following solution:

[0009] This invention provides a method for preparing recombinant adenovirus that spontaneously generates virus-like particles, comprising the following steps:

[0010] The exogenous viral membrane protein gene was linked with the EARP gene to construct a recombinant exogenous viral membrane protein gene.

[0011] The recombinant exogenous viral membrane protein gene was inserted into the E3 region of the adenovirus backbone plasmid to obtain the recombinant backbone plasmid.

[0012] The recombinant exogenous viral membrane protein gene was inserted into the E1 region of the adenovirus shuttle plasmid to obtain the recombinant shuttle plasmid.

[0013] The recombinant adenovirus that spontaneously generates virus-like particles is prepared according to any one of the following methods (1)-(3):

[0014] (1) The recombinant backbone plasmid and the recombinant shuttle plasmid were co-transfected into host cells;

[0015] (2) The recombinant backbone plasmid and adenovirus shuttle plasmid were co-transfected into host cells;

[0016] (3) The adenovirus backbone plasmid and the recombinant shuttle plasmid were co-transfected into the host cell;

[0017] The nucleotide sequence of the EARP gene is shown in SEQ ID NO.17.

[0018] Exogenous viral membrane proteins include, but are not limited to, membrane proteins of enveloped viruses, including those from the Orthomyxoviridae, Flaviviridae, Retroviridae, Filoviridae, Rhabdoviridae, Herpesviridae, Coronaviridae, and Paramyxoviridae families.

[0019] Adenovirus vectors include, but are not limited to, human adenovirus type 5.

[0020] Furthermore, the adenovirus backbone plasmid is the pBHGcre / loxp plasmid.

[0021] Furthermore, the adenovirus shuttle plasmid is the pDC315 plasmid.

[0022] Furthermore, the nucleotide sequence of the recombinant exogenous viral membrane protein gene is shown in any one of SEQ ID NO.29-31.

[0023] The present invention also provides a recombinant adenovirus that spontaneously generates virus-like particles, wherein the preparation method of the recombinant adenovirus includes the following steps:

[0024] The exogenous viral membrane protein gene was linked with the EARP gene to construct a recombinant exogenous viral membrane protein gene.

[0025] The recombinant exogenous viral membrane protein gene was inserted into the E3 region of the adenovirus backbone plasmid to obtain the recombinant backbone plasmid.

[0026] The recombinant exogenous viral membrane protein gene was inserted into the E1 region of the adenovirus shuttle plasmid to obtain the recombinant shuttle plasmid.

[0027] The recombinant adenovirus that spontaneously generates virus-like particles is prepared according to any one of the following methods (1)-(3):

[0028] (1) The recombinant backbone plasmid and the recombinant shuttle plasmid were co-transfected into host cells;

[0029] (2) The recombinant backbone plasmid and adenovirus shuttle plasmid were co-transfected into host cells;

[0030] (3) The adenovirus backbone plasmid and the recombinant shuttle plasmid were co-transfected into the host cell;

[0031] The nucleotide sequence of the EARP gene is shown in SEQ ID NO.17.

[0032] Furthermore, the nucleotide sequence of the recombinant exogenous viral membrane protein gene is shown in any one of SEQ ID NO.29-31.

[0033] Furthermore, the adenovirus backbone plasmid is the pBHGcre / loxp plasmid; the adenovirus shuttle plasmid is the pDC315 plasmid.

[0034] The present invention also provides the application of the above-mentioned recombinant adenovirus in the preparation of recombinant adenovirus vaccines.

[0035] The present invention also provides a recombinant adenovirus vaccine comprising the above-described recombinant adenovirus.

[0036] Furthermore, the recombinant adenovirus vaccine also includes pharmaceutically acceptable excipients.

[0037] The present invention discloses the following technical effects:

[0038] This invention utilizes synthetic biology techniques to modify exogenous viral membrane protein genes and insert them into the E1 and E3 regions of adenovirus type 5. Recombinant adenoviruses constructed using this method can spontaneously assemble VLP structures containing inserted viral outer membrane proteins during in vitro and in vivo infection.

[0039] This invention combines the advantages of both VLP and adenovirus vector platforms while avoiding their drawbacks in production and immunization processes. This greatly improves the immunogenicity of the vaccine, simplifies the VLP production process, reduces the production cost of the vaccine, and provides a theoretical basis and practical experience for the subsequent development of other types of vector vaccines that can produce virus-like particles in vitro and in vivo. Attached Figure Description

[0040] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0041] Figure 1 This is a schematic diagram illustrating the construction of recombinant adenovirus and VLP production before and after modification.

[0042] Figure 2 The figures show the growth curves of the recombinant adenovirus before and after modification; where A represents Ad5-HA. PR8 and Ad5-HA PR8 -VLP growth curve; B represents Ad5-S JN.1 and Ad5-S JN.1 -VLP growth curve; C is Ad5-GP Zaire and Ad5-GP Zaire -VLP growth curve; D is the growth curve of Ad5-RVDG and Ad5-RVDG-VLP;

[0043] Figure 3 The results show the detection of exogenous gene expression of recombinant adenovirus in HEK293 cells; where A and B are the Western Blot results and expression level statistics of HA protein, respectively; C and D are the Western Blot results and expression level statistics of Spike protein, respectively; E and F are the Western Blot results and expression level statistics of GP protein, respectively; and G and H are the Western Blot results and expression level statistics of RVG protein, respectively.

[0044] Figure 4 This is a schematic diagram showing the stratification of recombinant adenovirus and VLP after separation.

[0045] Figure 5 For transmission electron microscopy observation of virus-like particles;

[0046] Figure 6 For Ad5-HA PR8 -Graph showing the hemagglutination activity assay of the purified supernatant from VLP-infected cells;

[0047] Figure 7 For Ad5-HA PR8 With Ad5-HA PR8 - Results of HA expression detection in different cell lines by VLP; A and B are the Western Blot results and expression statistics of HA in MDCK, respectively; C and D are the Western Blot results and expression statistics of HA in BSR, respectively; E and F are the Western Blot results and expression statistics of HA in CRFK, respectively.

[0048] Figure 8 For Ad5-HA PR8 With Ad5-HA PR8-Statistical graph of HA protein concentration in bronchoalveolar lavage fluid after VLP nasal drops;

[0049] Figure 9 The results show the immunogenicity comparison between VLP and soluble viral envelope proteins; where A is the comparison of the hemagglutination inhibition titers of influenza virus in mouse serum after immunization with HA-VLP and soluble HA-His protein; B is the comparison of the neutralizing titers of S-VLP and soluble S protein against 50% pseudovirus in mice after immunization with parental strain JN.1; C is the comparison of the neutralizing titers of GP-VLP and GP protein against 50% pseudovirus in mice after immunization with Ebola Zaire strain; and D is the comparison of the neutralizing antibody titers against rabies virus CVS-11 strain after immunization with RVG-VLP and RVG protein.

[0050] Figure 10 For Ad5-HA PR8 With Ad5-HA PR8 -VLP immunogenicity and challenge protection evaluation results; where A represents muscle-mediated Ad5-HA. PR8 With Ad5-HA PR8 - Comparison of serum influenza virus hemagglutination inhibition titers in mice after VLP; B represents intranasal immunization with Ad5-HA. PR8 With Ad5-HA PR8 - Comparison of serum influenza virus hemagglutination inhibition titers in mice after VLP; C shows the changes in body weight of mice after 174 days of influenza virus PR8 challenge; D shows the survival rate of mice after 174 days of influenza virus PR8 challenge.

[0051] Figure 11 For Ad5-S JN.1 With Ad5-S JN.1 -VLP, Ad5-GP Zaire With Ad5-GP Zaire Immunogenicity comparison results of Ad5-RVDG and Ad5-RVDG-VLP in mouse models; where AD represents Ad5-VLP, Ad5-RVDG, and Ad5-RVDG-VLP, respectively. JN.1 With Ad5-S JN.1 - Comparison of 50% pseudovirus neutralization titers against JN.1 (Omicron), WA1 / D614G, BA.2.86 (Omicron), and B.1.617.2 (Delta) strains at 14 and 84 days post-VLP immunization; E represents the results of mice immunized with Ad5-GP. Zaire With Ad5-GP Zaire- Comparison of 50% pseudovirus neutralizing titers against Ebola Zaire strain at 7 days and 84 days after VLP; F is the comparison of neutralizing antibody titers against rabies virus CVS-11 strain in mice immunized with Ad5-RVDG and Ad5-RVDG-VLP one year later. Figure 12 The results show the protection against challenge after immunization with Ad5-RVDG and Ad5-RVDG-VLP; where A represents the intracranial injection of 50×LD30 on day 360 after immunization with Ad5-RVDG and Ad5-RVDG-VLP. 50 (Median lethal dose) Record of weight changes after challenge with the standard rabies virus strain CVS-24; B represents intracranial injection of 50×LD50 360 days after immunization with Ad5-RVDG and Ad5-RVDG-VLP. 50 Statistical results of mouse survival rate after challenge with the standard rabies virus strain CVS-24;

[0052] Figure 13 The results show the dynamic monitoring of exogenous gene expression in vivo after immunization with recombinant adenovirus via different immunization methods; where A represents the dynamic monitoring results of exogenous gene expression in vivo after intramuscular injection immunization in the hind limb; and B represents the dynamic monitoring results of exogenous gene expression in vivo after intranasal immunization.

[0053] Figure 14 The figure shows the results of comparing the immunogenicity of Ad5-RVDG and Ad5-RVDG-VLP in cat (A) and dog (B) models. Detailed Implementation

[0054] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0055] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0056] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0057] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0058] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0059] This invention utilizes synthetic biology techniques to fuse 47 residues derived from the cytoplasmic tail of the mouse Fcγ receptor FcRII with the active motif of the human CEP55 protein, which recruits the ESCRT pathway and ALIX protein, by adding a 2×GGGS flexible linker. The fusion protein is named EARP (ESCRT and ALIX recruit proteins, EARP). This fusion protein replaces the intracellular domain of the hemagglutinin protein (HA) of influenza virus (A / Puerto Rico / 8 / 1934). The HA genes, both before and after modification, are inserted into the E1 and E3 regions of the adenovirus vector, rescuing two recombinant adenoviruses (Ad5-HA). PR8 and Ad5-HA PR8 We validated the expression of virus-like particle structures loaded with HA protein (HA-VLP) in vitro and in vivo, and validated the purified HA-VLP and Ad5-HA in mice. PR8 and Ad5-HA PR8 - Immunogenicity of VLP. Furthermore, to verify the universality of this technology, this invention also constructed recombinant adenoviruses expressing the JN.1 spike protein (S) of the SARS-CoV-2 virus before and after modification (named Ad5-S, respectively). JN.1 and Ad5-S JN.1 -VLP), expressing the modified and unmodified Ebola virus Zaire GP protein (named Ad5-GP, respectively). Zaire and Ad5-GP ZaireThe invention relates to recombinant adenoviruses containing the modified rabies virus vaccine strain SAD-L16 glycoprotein (named Ad5-RVDG and Ad5-RVDG-VLP) and the modified rabies virus vaccine strain SAD-L16 glycoprotein (named Ad5-RVDG and Ad5-RVDG-VLP, respectively), and the feasibility of this technology was verified in various animal models, including mice, dogs, and cats. The technical solution involved in this invention will be clearly and thoroughly disclosed below:

[0060] Example 1

[0061] This invention modifies four viral proteins: influenza virus HA protein, SARS-CoV-2 S protein, Ebola virus GP protein, and rabies virus G protein. The modification strategy is described in detail using influenza virus HA protein as an example.

[0062] 1. Modification of viral envelope proteins and rescue of recombinant adenovirus

[0063] 1.1 Amplification of gene fragments before viral envelope protein modification

[0064] The influenza virus (A / Puerto Rico / 8 / 1934, Gene ID: 956529) used in this invention was preserved in our laboratory, and all subsequent gene amplification reaction templates were derived from the cDNA of this virus; the S gene template of the SARS-COV-2 (JN.1) strain was purchased from Sinopharm; the EBOV GP gene was derived from the pCMV3-GP-C-Flag plasmid (Cat: VG40304-CF, Sinopharm); the rabies virus G gene (RVG) was derived from the SAD-L16 whole genome plasmid preserved in our laboratory (the vaccine strain SAD-L16 and the SAD-L16 whole genome plasmid have been disclosed in the literature "Infectious rabies viruses from cloned cDNA").

[0065] Primers were designed targeting the viral envelope proteins mentioned above, and homologous arms to the pDC315 shuttle plasmid were added to the primers. The primer sequences are detailed in Table 1.

[0066] Table 1

[0067]

[0068]

[0069] After configuring the reaction system, the amplification conditions were set as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 58℃ annealing (select annealing temperature according to primer Tm value) for 15 s, 72℃ extension for 90 s (select extension time according to gene length), 35 cycles; 72℃ final extension for 5 min.

[0070] After the reaction was completed, the amplified gene fragments were recovered and named 315-HA, 315-S, 315-GP and 315-RVG, respectively, with nucleotide sequences as shown in SEQ ID NO.9-12.

[0071] 1.2 Amplification of gene fragments after modification of viral envelope proteins

[0072] 1.2.1 Obtaining the EARP fusion gene

[0073] Primers were designed to amplify the cytoplasmic gene fragment of the FcRII (Gene ID: 14130) protein derived from the spleen cells of C57BL / 6 mice, and the fusion gene was recruited from the CEP55 (Gene ID: 55165) protein derived from human A549 (CCL-185, ATCC) cells to fuse with the active motif of the ESCRT and ALIX pathway. The fused gene was named EARP.

[0074] The primer sequences used in the gene amplification process are as follows:

[0075] Mus-FcRII-B1-F: gctctcccaggaaaccctga (SEQ ID NO. 13);

[0076] Mus-FcRII-B1-R: agagccacctccgcctgaaccgcctccaccgtatgggctgatgcttgttg (SEQ ID NO. 14);

[0077] Homo-CEP55-F: ggttcaggcggaggtggctctttcaactcatcaataaataatatt (SEQ IDNO.15);

[0078] Homo-CEP55-R:TCAtgggagtgaatgagcagctgt (SEQ ID NO. 16).

[0079] The nucleotide sequence of the obtained fusion gene EARP is shown in SEQ ID NO.17.

[0080] 1.2.2 Fusion of viral envelope protein gene with EAREP gene

[0081] Design primers to amplify the coding gene for HA protein (1-552aa) and the ERAP gene, respectively:

[0082] PR8-HA 1-552aa -F:atgaaggcaaacctactggt(SEQ ID NO.18);

[0083] PR8-HA1-552aa -R: tcagggtttcctgggagagcccagaaactgattgccccca (SEQ ID NO. 19).

[0084] After configuring the reaction system, the amplification conditions were set as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 90 s, 35 cycles; final extension at 72℃ for 5 min. After the reaction, gel extraction was performed, and the recovered gene was named HA. 1-552aa .

[0085] EARP-F: gctctcccaggaaaccctga (SEQ ID NO. 20);

[0086] EARP-R: ctatggggagtgaatgagcagc (SEQ ID NO. 21).

[0087] After configuring the reaction system, the amplification conditions were set as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 40 s, 35 cycles; 72℃ final extension for 2 min.

[0088] After the reaction is complete, the gel is recovered.

[0089] After recovery, the concentration was measured. 100 ng of each gene was added, and amplification conditions were set as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 56℃ annealing for 15 s, 72℃ extension for 100 s, 6 cycles; final extension at 72℃ for 5 min. PR8-HA was then added. 1-552aa 2 μL each of -F / EARP-R upstream and downstream primers. Amplification conditions were set as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 56℃ annealing for 15 s, 72℃ extension for 100 s, 30 cycles; final extension at 72℃ for 5 min. The recovered fusion gene was named HA. 1-552aa -EARP, nucleotide sequence as shown in SEQ ID NO.22.

[0090] Similar to the above operation, design the following primers to amplify the target protein S. 1-1232aa GP 1-672aa and RVG 1-480aa The encoding gene and primer sequences are shown in Table 2.

[0091] Table 2

[0092]

[0093] The amplified genes were recovered and named S. 1-1232aa Genes, GP 1-672aaGenes and RVG 1-480aa Gene. The above gene was fused with the EARP gene by PCR, and the recovered gene was named S. 1-1232aa -EARP, GP 1-672aa -EARP and RVG 1-480aa -EARP, the nucleotide sequences are shown in SEQ ID NO.29-31 respectively.

[0094] HA 1-552aa -EARP, S 1-1232aa -EARP, GP 1-672aa -EARP and RVG 1-480aa Using the EARP gene as a template, add 2 μL each of upstream and downstream primers. Introduce the homologous arm of the pDC315 plasmid into the fusion gene using the primers and introduce the Kozak sequence before the gene start codon. See Table 3 for primer sequences.

[0095] Table 3

[0096]

[0097] After configuring the reaction system, the amplification conditions were set as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 59℃ annealing for 15 s, 72℃ extension for 100 s, 35 cycles; 72℃ final extension for 5 min.

[0098] The recovered amplified fragments were named 315-HA. 1-552aa -EARP, 315-S 1-1232aa -EARP, 315-RVG 1-480aa -EARP and 315-GP 1-672aa -EARP.

[0099] 1.3 pDC315-exogenous gene plasmid construction

[0100] The adenovirus reverse genetics system mainly includes the shuttle plasmid pDC315 and the backbone plasmid pBHGcreloxp. The viral envelope protein genes, both before and after modification, were constructed into the shuttle plasmid pDC315.

[0101] According to the system shown in Table 4, the pDC315 plasmid (purchased from Microbix Biosystems Inc.) was digested with EcoRI / NheI, reacted in a water bath at 37°C for 30 min, and then subjected to nucleic acid electrophoresis. The vector fragment was recovered by gel extraction.

[0102] Table 4

[0103]

[0104] According to the instructions for the Novozymes ClonExpress II One Step Cloning Kit (C112-01), the target fragments (315-HA, 315-HA) were... 1-552aa -EARP, 315-S, 315-S 1-1232aa -EARP, 315-RVG, 315-RVG 1-480aa -EARP, 315-GP and 315-GP 1-672aa -EARP was ligated into the restriction enzyme vector (reaction system shown in Table 5), then transformed into XL-10 (Shanghai Maokang Biotechnology Co., Ltd.) competent cells, incubated on ice for 30 min, heat-shocked in a 42℃ water bath for 90 s, plated, and sequenced. Correctly cloned strains were selected for amplification, and plasmids were extracted using the omega endotoxin removal kit to obtain shuttle plasmids pDC315-HA and pDC315-HA, respectively. 1-552aa -EARP, pDC315-S, pDC315-S 1-1232aa -EARP, pDC315-RVG, pDC315-RVG 1-480aa -EARP, pDC315-GP and pDC315-GP 1-672aa -EARP, after concentration measurement, store at 4℃ for later use.

[0105] Table 5

[0106]

[0107] Construction of 1.4pBHGcre / loxp backbone plasmid

[0108] 1.4.1 Pac I digestion of pBHGcre / loxp backbone plasmid

[0109] Configure the enzyme digestion reaction system as shown in Table 6, and perform enzyme digestion reaction on the backbone plasmid pBHGcre / loxp (purchased from Microbix Biosystems Inc.).

[0110] Table 6

[0111]

[0112]

[0113] Enzyme digestion reaction: The reaction was carried out in a water bath at 37°C for 30 min. The reaction product was recovered using an Omega CP recovery kit and then purified via NanoDrop. TM Nucleic acid recovery concentration was detected using a One / One C micro-UV-Vis spectrophotometer.

[0114] 1.4.2 amplification of the pDC315-viral envelope protein expression cassette gene

[0115] pDC315-HA and pDC315-HA respectively 1-552aa -EARP, pDC315-RVG, pDC315-RVG 1-480aa Using the EARP plasmid as a template, the expression cassette was amplified and the fragment was recovered by adding homologous arms (30bp) of the Pac I site of the backbone plasmid to both ends.

[0116] E3PacI-F: cttggattacatcaagatcctctagttaatGAGTCATTAGGGACTTTCCAATG (SEQ IDNO.37);

[0117] E3PacI-R: atagatccccgggtactctagttaGATCCAGACATGATAAGATAC (SEQ ID NO. 38).

[0118] The expression cassette was cloned into the E3 region of the linearized backbone plasmid using the NEBuilder HiFi DNAAssembly Cloning Kit (E5520s) seamless cloning kit.

[0119] Configure the recombination system shown in Table 7:

[0120] Table 7

[0121]

[0122] After mixing the samples, place them in a PCR instrument and incubate at 50°C for 1 hour.

[0123] The recombinant product was transformed into stable 3 competent cells (Shanghai Angyu Biotechnology Co., Ltd., G6009-10), plated, and subjected to bacterial selection and sequencing. Correctly cloned strains were selected for amplification, and plasmids were extracted according to the omega endotoxin removal kit instructions. After concentration determination, the plasmids were stored at 4°C for later use.

[0124] Based on the different exogenous genes introduced into the E3 region, the recombinant backbone plasmids were named pBHGcre / loxp-HA and pBHGcre / loxp-HA, respectively. 1-552aa -EARP, pBHGcre / loxp-RVG and pBHGcre / loxp-RVG 1-480aa -EARP.

[0125] 1.5 Rescue and Identification of Recombinant Adenovirus

[0126] HEK293 cells (Hunan Fenghui Biotechnology Co., Ltd.) were seeded into 6-well plates one day in advance. Once the cell confluence reached 80%, the cells were seeded according to... The instructions state that the backbone plasmid and shuttle plasmid should be co-transfected as shown in Table 8. The construction strategy is as follows: Figure 1 As shown.

[0127] Table 8

[0128]

[0129]

[0130] Six hours after transfection, the medium was changed to 2% FBS maintenance medium. Depending on the cell condition, either a complete or partial medium change was chosen. On the eighth day after transfection, the supernatant was collected and seeded into new HEK293 cells. The cells were then blindly passaged for 10 generations, followed by three freeze-thaw cycles. The titers of eight viral strains were determined.

[0131] 2. Study on the growth characteristics of recombinant adenovirus before and after modification

[0132] To explore whether the foreign gene modification affects the growth characteristics of recombinant adenovirus, the above 8 recombinant adenovirus strains (shown in Table 8) were inoculated into 12-well HEK293 cells with an MOI of 0.1. After 1 hour, the cells were washed twice with PBS and 2% FBS was added to maintain medium. The supernatant was collected at 12 h, 24 h, 48 h, 60 h, 72 h, 84 h and 96 h after infection, and the growth curves of the 8 recombinant viruses were measured.

[0133] like Figure 2 As shown, the growth characteristics of the recombinant virus after modification were not significantly different from those before modification, proving that the insertion of the EARP gene does not affect the growth characteristics of the recombinant adenovirus.

[0134] 3. Western blot validation of recombinant adenovirus exogenous gene expression

[0135] Eight recombinant adenovirus strains (shown in Table 8) were inoculated into HEK293 cells at an MOI of 0.1. After 48 h of infection, 500 μL of cell supernatant was collected, and post-infection cell protein samples were extracted. After adjusting the protein concentration, loading buffer was added, and the cells were boiled in water for 10 min. The expression of viral envelope proteins in cells and supernatant was detected by Western blotting.

[0136] The results are as follows Figure 3 As shown, Ad5-HA PR8 -VLP, Ad5-S JN.1Viral envelope proteins (HA-VLP, S-VLP, and RVG-VLP) expressed after HEK293 infection with Ad5-VLP and Ad5-RVDG-VLP were detectable in cell culture supernatant. Furthermore, the expression levels of these envelope proteins in cell lysates were 2-fold, 1.8-fold, and 1.58-fold lower than those in the Ad5-HAPR8, Ad5-S JN.1, and Ad5-RVDG infection groups, respectively. Additionally, although GP expression was detected in the supernatant of both Ad5-GP and Ad5-GP-VLP infected cells, it was significantly higher in the Ad5-GP-VLP infection group than in the Ad5-GP infection group.

[0137] In summary, all eight recombinant adenovirus strains expressed exogenous viral envelope proteins, and the modified recombinant adenoviruses showed a greater number of exogenous viral proteins in the cell infection supernatant.

[0138] Example 2

[0139] Purification and identification of virus-like particles in the supernatant of cells infected with modified recombinant adenovirus:

[0140] 1. Recombinant adenovirus amplification and purification of virus-like particles in the supernatant

[0141] The four modified recombinant adenovirus strains (Ad5-S) were used with an MOI of 1. JN.1 -VLP, Ad5-RVDG-VLP, Ad5-HA PR8 -VLP and Ad5-GP Zaire -VLP) was inoculated into suspension 293 cells (Zhuhai Kairui Biotechnology Co., Ltd.). After 72 hours, the virus solution was collected, frozen and thawed once, and centrifuged at 4°C, 6000 rpm for 30 minutes. The supernatant was collected and the cell pellet was discarded. The supernatant was added to a 38.5 mL ultracentrifuge tube (Cat: 75000471, Thermofisher), and a 3 mL 20% sucrose pad was added to the bottom of the ultracentrifuge tube. Centrifugation parameters were set as follows: 4°C, 25000 rpm, for 2 hours. The supernatant was discarded, and 6 mL DMEM was added overnight to dissolve the pellet. The next day, the dissolved pellet was subjected to 54%-40%-25%-15% OptiPrep. TM Density gradient medium (Cat: D1556, Merck). Centrifugation parameters: 4℃, 30000 r / min, centrifugation for 3 hours, then collect the virus-like particle layer (15%-25%) and the virus layer (40%-54%) separately. Ultracentrifugation results are shown below. Figure 4 As shown, 40%-54% OptiPrep TM The layer between them is the virus layer, 15%-25% OptiPrep TM The space between them is a protein layer.

[0142] 2.2 Observation results of transmission electron microscopy of virus-like particles

[0143] Negative staining samples for HA-VLP, S-VLP, GP-VLP, and RVG-VLP were prepared using standard methods. Simply pipette 10 μL of the sample onto a 300-mesh copper grid, let it stand at room temperature for 5 min, carefully discard the sample, add 10 μL of phosphotungstic acid negative staining solution, let it stand at room temperature for 2 min, and then rinse the sample three times in PBS to remove excess staining solution. Subsequently, the samples were observed under a transmission electron microscope. The results are as follows: Figure 5 As shown, electron microscopy revealed bilayer vesicle structures with diameters ranging from 90 to 120 nm.

[0144] 2.3HA-VLP hemagglutination activity assay

[0145] Influenza virus HA protein can agglutinate chicken erythrocytes. To investigate whether the purified HA-VLP also has hemagglutinating activity, 25 μL of PBS was added to each well of a 96-well V-plate. The first column contained suspension 293 culture supernatant (negative control), PR8 strain (positive control), and Ad5-HA. PR8 -VLP infection purified supernatant and Ad5-HA PR8 25 μL of purified supernatant was purified after infection and serially diluted twice using an 8-well pipette. After dilution, 25 μL of 1% chicken red blood cells were added, and the samples were incubated at room temperature for 30 min before the hemagglutination activity of each sample was determined.

[0146] The results are as follows Figure 6 As shown, uninfected and Ad5-HA PR8 The purified products from the supernatant of infected cells failed to induce chicken erythrocyte agglutination. Ad5-HA PR8 Both VLP and the positive control PR8 influenza virus can cause agglutination of chicken erythrocytes.

[0147] Example 3

[0148] Given that the EARP sequence is obtained by fusing different genes from humans and mice, it can help the modified viral envelope protein spontaneously assemble into virus-like particle structures in human HEK293 cells. However, it is unclear whether virus-like particles can be generated in cells of other species. Therefore, taking the influenza virus protein HA as an example, this study verifies whether the recombinant adenovirus before and after modification produces HA-VLP in different cell lines of different species:

[0149] With MOI=5, Ad5-eGFP and Ad5-HA were respectively... PR8 With Ad5-HA PR8-VLP cells were seeded into MDCK (Stock No. CCL-34, ATCC), BSR (derived from BHK-21 cells), and CRFK (Stock No. CCL-94, ATCC) cells, with three replicates per group. After 48 hours, cell supernatant and cell samples were collected, and protein samples were prepared. HA protein expression was then detected by Western blot.

[0150] The results are as follows Figure 7 As shown, Ad5-HA PR8 HA expression was detected in the supernatant of VLP-infected MDCK, BSR, and CRFK cells, and the expression level of HA was decreased in cell lysates. Ad5-HA PR8 HA protein expression was not detected in the supernatant of infected MDCK, BSR, and CRFK cells. This example demonstrates that the modified recombinant adenovirus can also produce virus-like particles in canine, cat, and mouse cell lines.

[0151] Example 4

[0152] Influenza virus is a respiratory pathogen, and recombinant adenovirus vectors have been proven to be effective for nasal immunization. To verify whether the modified recombinant adenovirus can produce VLP in vivo, the influenza virus protein HA was used as an example to verify Ad5-HA. PR8 Can HA-VLP expression be detected in bronchoalveolar lavage fluid after nasal immunization with -VLP strain?

[0153] Six-week-old female ICR mice were used and injected intranasally with 10 7 TCID 50 / 40μLAd5-eGFP, Ad5-HA PR8 With Ad5-HA PR8 Five mice per group were immunized with VLP. Seventy-two hours post-immunization, the mice were euthanized. After aseptic dissection to expose the trachea, a transverse incision was made in the larynx, and an 8-gauge straight-tipped gavage needle was inserted. The needle was secured with sutures, and 500 μL of sterile PBS was injected using a 1 mL syringe. The lungs were gently squeezed for 15 seconds, and the bronchoalveolar lavage fluid was aspirated. This process was repeated. The lavage fluid was then centrifuged at 12000 rpm for 10 minutes at 4°C, and the supernatant was collected. The HA protein content in the bronchoalveolar lavage fluid was determined using an ELISA kit (Cat: KIT11684, Sinocare).

[0154] Experimental results are as follows Figure 8 As shown, Ad5-HA PR8 The concentration of HA protein in the bronchoalveolar lavage fluid of the VLP nasal drop group was as high as 290 ng / mL, which is Ad5-HA. PR8 The nasal drop group showed a 34-fold increase in HA expression, while no HA expression was detected in the Ad5-eGFP nasal drop group.

[0155] This example demonstrates that the modified recombinant adenovirus can also spontaneously form VLPs in vivo.

[0156] Example 5

[0157] The immunogenicity of VLPs spontaneously generated by the modified recombinant adenovirus is far superior to that of soluble proteins:

[0158] To verify the use of Ad5-HA PR8 To determine the immunogenicity of HA-VLP generated during VLP amplification, 6-week-old female ICR mice were immunized in the hind limb muscles with 10 μg / 100 μL of purified HA-VLP supplemented with AS03 adjuvant (Cat. No. vac-as0310, InvivoGen), and soluble protein HA-His, respectively. Ten mice were used in each group. Blood was collected from the orbital vein at specified time points after immunization, and the hemagglutination inhibition titer of influenza virus was measured. Figure 9 As shown in Figure A, two mice in the HA-VLP immunization group achieved a hemagglutination inhibition titer of 2 on day 4 post-immunization. 3 Peak levels were reached 14 days after immunization, with an average of 2. 9.5 This continued for 174 days. In the HA-His immune group, the hemagglutination inhibition titer was 2 at day 14. 6.5 The immunogenicity of HA-VLP was significantly lower than that of the HA-VLP immunization group, and it failed to inhibit the agglutination of influenza virus on erythrocytes 35 days after immunization, with a shorter antibody duration. Experimental results demonstrate that the immunogenicity of ultrapure HA-VLP is far higher than that of the soluble protein HA-His.

[0159] Similarly, to verify the immunogenicity of S-VLP, GP-VLP, and RVG-VLP, 6-week-old female ICR mice were immunized in the hind limb muscles with 10 μg / 100 μL of purified GEL02 adjuvant (MONTANIDE). TM GEL 02 (SEPPIC) was used to detect S-VLP, GP-VLP, and RVG-VLP, along with soluble proteins S (Cat:40589-V08H59, Sinopharm), GP (Cat:40304-V08B1, Sinopharm), and RVG (Cat:40997-VNAH3, Sinopharm). Blood was collected from the orbital vein at 14 and 84 days post-immunization, and serum was collected to determine virus-specific neutralizing antibodies.

[0160] SARS-CoV-2 pseudovirus neutralization experiments proved ( Figure 9 The 50% pseudovirus neutralization titer (pVNT) at 14 and 84 days post-S-VLP immunization (B) 50The values ​​were 728 and 595, respectively, which were 5.1 times and 6.6 times higher than those of the soluble S protein immunization group.

[0161] Ebola virus pseudovirus neutralization experiments proved ( Figure 9 pVNTs at 14 and 84 days post-GP-VLP immunization (C) 50 The values ​​were 799 and 552, respectively, which were 9.1 times and 13.3 times higher than those of the soluble GP protein immunization group.

[0162] The rabies virus fluorescent antibody neutralization test (FAVN) showed that... Figure 9 In the RVG-VLP immunization group, 14 days after immunization, only 3 mice had neutralizing antibody levels exceeding 0.5 IU / mL (challenge protection value). By 84 days after immunization, 90% of immunized mice had antibody levels below 0.5 IU / mL. In the RVG-VLP immunization group, 14 days after immunization, neutralizing antibody levels were all significantly higher than 0.5 IU / mL, with an average of 19.23 IU / mL. By 84 days after immunization, the levels had slightly decreased, with an average of 16.55 IU / mL.

[0163] In summary, this embodiment demonstrates that immunizing mice with virus-like particles spontaneously generated from cells infected in vitro by the modified recombinant adenovirus can induce the production of neutralizing antibodies against the protective antigens of the virus, and the immunogenicity is far superior to that of the soluble protein expressed in vitro.

[0164] Example 6

[0165] Horizontal comparison of Ad5-HA PR8 With Ad5-HA PR8 -VLP immunogenicity and protection against challenge:

[0166] Six-week-old female ICR mice were used, and 10 mg / L of the drug was injected intramuscularly into their hind limbs. 7 TCID 50 / 100μLAd5-HA PR8 With Ad5-HA PR8 -VLP, 10 animals per group, to compare the hemagglutination inhibition titers of influenza virus in the serum of the two groups. To explore whether the production of HA-VLP enhances the immunogenicity of the adenovirus vector vaccine.

[0167] Meanwhile, to verify the mucosal immunogenicity of the two recombinant adenovirus strains before and after modification, six-week-old female ICR mice were immunized intranasally with 10... 7 TCID 50 / 40μLAd5-HA and Ad5-HA PR8-VLP, 10 animals per group, blood was collected from the orbital vein weekly, serum was separated, the hemagglutination inhibition titer of influenza virus was measured, and the immunization effects of the two groups were compared.

[0168] In a muscle immune model ( Figure 10 (A), Ad5-HA PR8 Four days after VLP immunization, 40% of mice rapidly developed influenza virus neutralizing antibodies, with a hemagglutination inhibition titer of 2. 2 The average hemagglutination titer reached 2 on 7 days after immunization. 8.9 Peak levels were reached 14 days after immunization. 11.6 After 14 days, the hemagglutination inhibition titer showed a slow decreasing trend, but remained as high as 2 at 174 days post-immunization. 10.2 Ad5-HA PR8 Four days post-immunization, none of the mice produced influenza virus neutralizing antibodies. Seven days post-immunization, the antibody seroconversion rate reached 100%, and the average hemagglutination titer was 2. 7.5 Peak levels were reached 14 days after immunization. 10.5 The hemagglutination inhibition titer also showed a slow decreasing trend after 14 days, reaching 2 at 174 days post-immunization. 8.6 174 days post-immunization, nasal antiviral treatment was administered for 10 days. 4 PFU PR8 strain was continuously monitored for 12 days to assess body weight changes and survival rate. Results are as follows: Figure 10 As shown in C and D, Ad5-HA PR8 -VLP and Ad5-HA PR8 In the immunized group, the body weight of mice decreased significantly within 4 days after challenge, but Ad5-HA... PR8 -VLP decline was more gradual, and the time required to recover to original body weight was shorter (11 days). Furthermore, the mortality rate of mice in the blank immunized group after challenge was 100%, and Ad5-HA... PR8 -VLP-immunized group all survived after challenge, while Ad5-HA PR8 The survival rate of the immunized group after challenge was 90%. In conclusion, Ad5-HA... PR8 -VLP can stimulate the body to produce neutralizing antibodies as early as 4 days after the onset of immunity, and the highest hemagglutination inhibition titer is Ad5-HA. PR8 The immunized group had a 2.14-fold increase, and Ad5-HA... PR8 -VLPs have an advantage in providing long-lasting immune protection.

[0169] In the nasal immunization model ( Figure 10 (B) Regardless of Ad5-HA PR8 -VLP or Ad5-HA PR8 In the immunized group, no influenza virus-specific neutralizing antibodies were stimulated in the early stages of immunization (days 4 and 7). However, 14 days post-immunization, Ad5-HA... PR8The seroconversion rate of the VLP-immunized group reached 100%, and the average hemagglutination inhibition titer reached 2. 5.7 Ad5-HA PR8 The antibody seroconversion rate in the immunized group was 90%, and one mouse never developed influenza virus-specific neutralizing antibodies after immunization. Ad5-HA PR8 -VLP and Ad5-HA PR8 In the immunized group, the hemagglutination inhibition titer reached its peak at 28 days and 35 days post-immunization, respectively, at 2... 9.3 and 2 6.2 After reaching their peak values, the hemagglutination inhibition titers in each immunization group showed a slow downward trend, with titers of 2 at 174 days post-immunization. 7.8 and 2 4.9 174 days post-immunization, nasal antiviral treatment was administered for 10 days. 4 PFU PR8 strain was continuously monitored for 12 days to assess body weight changes and survival rate. Results are as follows: Figure 10 As shown in C and D, Ad5-HA PR8 -VLP and Ad5-HA PR8 In the immunized group, mice showed a significant decrease in body weight within 5 days after challenge, but the decrease was less severe than that following muscle immunization. Furthermore, the mortality rate in the blank immunized group was 100% after challenge, and Ad5-HA... PR8 -VLP-immunized group all survived after challenge, while Ad5-HA PR8 The survival rate of the immunized group after challenge was 80%. Overall, in the intranasal immunization model, the production of influenza virus-specific neutralizing antibodies in serum was delayed and lower than in the muscle immunization model; the results of challenge protection showed that the weight loss of mice challenged after intranasal immunization was more moderate than that after muscle immunization.

[0170] In summary, in influenza virus models, the modified strain Ad5-HA... PR8 -VLP compared to the parental strain Ad5-HA PR8 It has better immunogenicity and is more advantageous in long-term immune protection.

[0171] Example 7

[0172] Ad5-S JN.1 With Ad5-S JN.1 -VLP, Ad5-GP Zaire With Ad5-GP Zaire Immunogenicity comparison of -VLP, Ad5-RVDG and Ad5-RVDG-VLP in mouse models:

[0173] Since the novel coronavirus is a respiratory pathogen, nasal administration was chosen as the immunization method. Ebola and rabies viruses were compared using intramuscular injection to assess their immunogenicity.

[0174] Six-week-old female ICR mice were used and immunized intranasally. 7 TCID 50 / 40μLAd5-S JN.1 With Ad5-S JN.1 -VLP, 8 animals per group, blood was collected from the orbital vein 14 days and 84 days after immunization. The serum was collected and the 50% pseudovirus neutralization titer after immunization was determined by pseudovirus neutralization test.

[0175] Six-week-old female ICR mice were immunized with 10 mmol / L via intramuscular injection in their hind limbs. 7 TCID 50 / 100μL Ad5-GP Zaire With Ad5-GP Zaire -VLP, 8 animals per group, blood was collected from the orbital vein 7 days and 84 days after immunization. The serum was collected and the 50% pseudovirus neutralization titer after immunization was determined by pseudovirus neutralization test.

[0176] Six-week-old female ICR mice were immunized with 10 mmol / L via intramuscular injection in their hind limbs. 7 TCID 50 / 100μL Ad5-RVDG and Ad5-RVDG-VLP, 10 animals in each group. Blood was collected from the orbital vein at a specified time point after immunization. After collecting serum, rabies virus neutralizing antibodies were monitored by the Fluorescent Antibody Virus Neutralization Test (FAVN). The immunization monitoring period was one year.

[0177] like Figure 11 As shown in Figure A, the SARS-CoV-2 pseudovirus neutralization experiment demonstrates that Ad5-S JN.1 - The 50% pseudovirus neutralization titer (pVNT) against parental strain JN.1 at 14 and 84 days post-VLP immunization. 50 The values ​​are 3514 and 67537 respectively, representing Ad5-S. JN.1 2.2-fold and 2.7-fold increase in the immunized group; Ad5-S JN.1 -VLP immunization at 14 and 84 days post-immunization showed 50% neutralizing titers against the original WA1 / D614G pseudovirus of 3652 and 20011, respectively, corresponding to Ad5-S. JN.1 The immunized group was 3.6 times and 2.3 times higher ( Figure 11 (B); Ad5-S JN.1 -VLP immunization at 14 and 84 days post-immunization showed 50% pseudovirus neutralizing titers of 3602 and 33783 against another Omicron variant, BA.2.86, respectively, corresponding to Ad5-S. JN.1The immunized group was 2.2 times and 1.5 times higher than the control group. Figure 11 (C); Ad5-S JN.1 -VLP immunization at 14 and 84 days post-immunization showed 50% pseudovirus neutralization titers of 2535 and 41023 against Delta B.1.617.2 strain, respectively, corresponding to Ad5-S. JN.1 The immunized group was 3.8 times and 4.3 times higher ( Figure 11 (D). Ad5-S JN.1 -VLP immunization produces higher titers of broad-spectrum neutralizing antibodies, a phenomenon that becomes more pronounced with prolonged immunization time.

[0178] Furthermore, neutralization experiments using Ebola virus pseudoviruses have demonstrated ( Figure 11 (E), Ad5-GP Zaire -7 days after VLP immunization, 84dpVNT 50 The values ​​are 2703 and 15622 respectively. Ad5-GP Zaire 7 days after immunization, 84dpVNT 50 The values ​​are 1141 and 6079 respectively, far lower than Ad5-GP. Zaire -VLP immune group.

[0179] like Figure 11 As shown in Figure F, 4 days after Ad5-RVDG-VLP immunization, 50% of mice developed rabies-specific neutralizing antibodies, with levels exceeding 0.5 IU / mL. At 7 days post-immunization, the antibody seroconversion rate reached 100%, with an average of 11.13 IU / mL. At 28 days post-immunization, the neutralizing antibody level reached its peak at 56.31 IU / mL. During the one-year antibody monitoring period, the neutralizing antibody level showed a slow downward trend, reaching 17.28 IU / mL one year after immunization, still significantly higher than the 0.5 IU / mL challenge protection antibody level. Only one mouse in the Ad5-RVDG immunization group had a neutralizing antibody level of 0.86 IU / mL 4 days after immunization, also reaching its peak of 34.34 IU / mL at 28 days, significantly lower than the Ad5-RVDG-VLP immunization group; the neutralizing antibody level was 10.54 IU / mL one year after immunization.

[0180] To verify that the modified recombinant adenovirus still has advantages in challenge protection, this invention uses rabies virus as an example. After immunization with Ad5-RVDG and Ad5-RVDG-VLP for 360 days, 50×LD was injected intracranially. 50 CVS-24 rabies virus standard challenge strain, 21-day weight change and survival rate were recorded. Results are as follows: Figure 12As shown, the blank immunized group experienced a sharp drop in weight after challenge and all mice died 11 days after challenge. Both the Ad5-RVDG and Ad5-RVDG-VLP immunized groups showed a decrease in weight after challenge, but the weight loss in the Ad5-RVDG-VLP immunized group was more moderate and the protection rate was as high as 100%. In contrast, one mouse in the Ad5-RVDG immunized group died 8 days after challenge, resulting in a protection rate of 90%.

[0181] In summary, adenovirus vaccines that produce virus-like particles exhibit better immunogenicity and show significant advantages in providing long-lasting immune protection and inducing the production of broad-spectrum neutralizing antibodies.

[0182] This embodiment demonstrates the versatility of the present invention in modifying different viral envelope proteins to improve their immunogenicity.

[0183] Example 8

[0184] Dynamic monitoring of exogenous gene expression in vivo after immunization with recombinant adenovirus via different methods:

[0185] Examples 6 and 7 demonstrate that both intranasal and intramuscular injection of the modified recombinant adenovirus vaccine can induce a stronger immune response, presumably related to the sustained expression of VLP in the recombinant adenovirus. In this example, the expression of the Luci gene was detected at different time points using a small animal in vivo optical imaging system after immunizing recombinant adenovirus (Ad5-Dluci) expressing the pattern antigen firefly luciferase (Luci) in different ways. Specifically:

[0186] Six-week-old female BALB / c mice were used, with three mice in each group. They were immunized via intramuscular injection in the left hind limb and intranasal drops, respectively. 7 TCID 50 Ad5-Dluci was administered intraperitoneally at different time points using 100 μL of 15 mg / mL D-fluorescein potassium salt (cat: 40902ES02, YEASEN), and the fluorescence signal was detected using a small animal in vivo optical imaging system.

[0187] like Figure 13 As shown in Figure A, intramuscular injection of Ad5-Dluci can result in sustained expression of Luci at the injection site for approximately 25 days, followed by nasal immunization. Figure 13 After B)Ad5-Dluci, Luci can be continuously expressed in the lungs for about 10 days.

[0188] Example 9

[0189] Immunogenicity comparison of Ad5-RVDG and Ad5-RVDG-VLP in canine and feline models:

[0190] Based on "Verification of Ad5-HA"PR8 The test results regarding whether the modified adenovirus strain can produce HA-VLP in different species cell lines were obtained, meaning that the modified viral protein can also self-assemble into virus-like particle structures and be secreted into the cell culture supernatant in canine and feline cell lines. Simultaneously, the experimental results showed that the recombinant adenovirus capable of producing VLP exhibited better immunogenicity in a mouse model. To evaluate the potential and effectiveness of this invention in practical applications, and to verify whether the modified recombinant adenovirus rabies vaccine still has better immunogenicity in other species (dogs and cats), dogs and cats aged 3 months and older, 5 in each group, were subcutaneously immunized in the neck for 10 minutes. 8 TCID 50 / mL Ad5-RVDG and Ad5-RVDG-VLP. Blood was collected weekly from the radial vein, serum was separated, and rabies virus-specific neutralizing antibodies were measured.

[0191] like Figure 14 As shown in Figure A, in the cat model, rabies virus-specific neutralizing antibodies were detectable in the Ad5-RVDG-VLP group as early as 7 days post-immunization, with all levels exceeding 0.5 IU / mL, peaking at 31.2 IU / mL in the fourth week post-immunization. In the Ad5-RVDG group, only one cat had neutralizing antibodies above 0.5 IU / mL in the first week post-immunization, also peaking at 12.2 IU / mL in the fourth week, significantly lower than the Ad5-RVDG-VLP immunization group. In conclusion, in the cat model, Ad5-RVDG-VLP can more quickly elicit a humoral immune response to rabies virus and induce the production of higher levels of neutralizing antibodies.

[0192] like Figure 14 As shown in Figure B, in the canine model, rabies virus-specific neutralizing antibodies were detectable in all dogs in the Ad5-RVDG-VLP group 7 days after immunization, with levels exceeding 0.5 IU / mL, and peaking at 34.6 IU / mL in the 3rd week after immunization. In the Ad5-RVDG group, two dogs had neutralizing antibodies exceeding 0.5 IU / mL in the 1st week after immunization, peaking at 16.15 IU / mL in the 3rd week, which was significantly lower than that in the Ad5-RVDG-VLP immunization group.

[0193] In summary, compared with Ad5-RVDG, the modified recombinant adenovirus rabies vaccine Ad5-RVDG-VLP not only showed better immunogenicity in mouse models, but also induced the production of higher levels of neutralizing antibodies more quickly in dog and cat models.

[0194] The above nine embodiments demonstrate that this invention addresses common problems in existing vaccine technology platforms, such as limited antigen presentation efficiency and insufficient systemic immune activation, by developing an endogenous VLP synthesis system based on a recombinant adenovirus vector. This technology achieves breakthroughs in: 1) utilizing the efficient transduction characteristics of adenovirus vectors to achieve more efficient systemic antigen delivery, simplifying the traditional VLP vaccine construction and production process; 2) utilizing the long-term expression of exogenous genes by adenovirus in vivo, enabling the continuous formation of VLPs in vivo; 3) its unique multivalent antigen presentation mode can increase neutralizing antibody titers several times, significantly reducing vaccine production and usage costs, and providing a breakthrough technical solution for novel vaccine development; 4) utilizing the broad-spectrum infectivity of adenovirus, VLPs can be delivered through multiple routes such as intramuscular injection, nasal drops, and oral administration, stimulating a more efficient immune response.

[0195] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for preparing recombinant adenovirus that spontaneously generates virus-like particles, characterized in that, Includes the following steps: Incorporating exogenous viral membrane protein genes with EARP Gene ligation was used to construct a recombinant exogenous viral membrane protein gene. The recombinant exogenous viral membrane protein gene was inserted into the E3 region of the adenovirus backbone plasmid to obtain the recombinant backbone plasmid. The recombinant exogenous viral membrane protein gene was inserted into the E1 region of the adenovirus shuttle plasmid to obtain the recombinant shuttle plasmid. The recombinant adenovirus that spontaneously generates virus-like particles was prepared in the following manner: The recombinant backbone plasmid and the recombinant shuttle plasmid were co-transfected into host cells; The EARP The nucleotide sequence of the gene is shown in SEQ ID NO.17; The adenovirus backbone plasmid is the pBHGcre / loxp plasmid. The adenovirus shuttle plasmid is pDC315 plasmid; The nucleotide sequence of the recombinant exogenous viral membrane protein gene is shown in any one of SEQ ID NO.29-31.

2. A recombinant adenovirus that spontaneously produces virus-like particles, characterized in that, The method for preparing the recombinant adenovirus includes the following steps: Incorporating exogenous viral membrane protein genes with EARP Gene ligation was used to construct a recombinant exogenous viral membrane protein gene. The recombinant exogenous viral membrane protein gene was inserted into the E3 region of the adenovirus backbone plasmid to obtain the recombinant backbone plasmid. The recombinant exogenous viral membrane protein gene was inserted into the E1 region of the adenovirus shuttle plasmid to obtain the recombinant shuttle plasmid. The recombinant adenovirus that spontaneously generates virus-like particles was prepared in the following manner: The recombinant backbone plasmid and the recombinant shuttle plasmid were co-transfected into host cells; The EARP The nucleotide sequence of the gene is shown in SEQ ID NO.17; The nucleotide sequence of the recombinant exogenous viral membrane protein gene is shown in any one of SEQ ID NO.29-31; The adenovirus backbone plasmid is pBHGcre / loxp plasmid; the adenovirus shuttle plasmid is pDC315 plasmid.

3. The use of the recombinant adenovirus as described in claim 2 in the preparation of a recombinant adenovirus vaccine.

4. A recombinant adenovirus vaccine, characterized in that, Includes the recombinant adenovirus as described in claim 2.

5. The recombinant adenovirus vaccine according to claim 4, characterized in that, The recombinant adenovirus vaccine also includes pharmaceutically acceptable excipients.