Frog Virus Genus Grouper Iridovirus-Necrosis Virus Chimeric Vaccine Strain and Its Application

The GIVΔ51 and GIVΔ51-NNVCP FL vaccine strains constructed using homologous recombination technology have solved the problem of high mortality rates from viral diseases in grouper farming, achieving low-cost, low-side-effect multi-virus prevention.

CN120041403BActive Publication Date: 2025-10-31SUN YAT SEN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411936284.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-26
Publication Date
2025-10-31
Estimated Expiration
2044-12-26

AI Technical Summary

Technical Problem

In existing grouper and barramundi farming, viral diseases such as GIV-R, ISKNV, and NNV cause high mortality rates. Existing vaccines have problems with high cost or side effects, and there is a lack of low-cost and low-side-effect vaccine solutions.

Method used

The orf51 gene of frog grouper iridovirus GIV-R was removed using homologous recombination technology to construct the GIVΔ51 strain. A nucleotide sequence of the capsid protein of neuronecrosis virus was then inserted into its gene locus to form the GIVΔ51-NNVCP FL chimeric vaccine strain, which is used to simultaneously prevent grouper iridovirus and neuronecrosis virus infection.

Benefits of technology

The GIVΔ51 live attenuated vaccine has an immunization protection rate of up to 100%, while the GIVΔ51-NNVCP FL chimeric vaccine has immunization protection rates of 60.47% and 88.46%, respectively. It can also effectively induce specific antibodies, achieving comprehensive prevention against multiple viruses, and is low in cost and highly safe.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120041403B_ABST
    Figure CN120041403B_ABST
Patent Text Reader

Abstract

This invention relates to a chimeric vaccine strain of grouper iridovirus-neural necrosis virus (NINV) and its application, belonging to the field of aquaculture disease prevention and control technology. The invention relates to grouper iridovirus strains GIVΔ51 and GIVΔ51-NNV. CP FL Both are live attenuated vaccines, with accession numbers CCTCC NO:V2024120 and CCTCC NO:V2024118, respectively. The GIVΔ51 vaccine of this invention provides 100% protection against GIV-R in grouper immunized with this product; the inactivated GIVΔ51-NNV... CP FL Immunizing grouper and barramundi with GIV-R resulted in immunization protection rates of 60.47% and 88.46%, respectively, and effectively inhibited NNV replication in the fish; simultaneously, it induced specific anti-GIV-R and NNV IgM. A corresponding quadrivalent vaccine was prepared by combining the chimeric vaccine with bivalent vaccines for infectious spleen and kidney necrosis virus and desquamation virus, which can prevent four viruses.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of aquaculture disease prevention and control technology, and in particular to a chimeric vaccine strain of iridovirus-neurone necrosis virus belonging to the grouper frog genus and its application. Background Technology

[0002] Grouper and barramundi are important farmed fish species internationally and also important economic fish species in South my country. With the continuous development of grouper and barramundi aquaculture, disease problems have become increasingly serious, severely hindering the healthy development of the aquaculture industry. Ranavirus type Grouper iridovirus (GIV-R), Infectious spleen and kidney necrosis virus (ISKNV), and nerve necrosis virus (NNV) are the three most important viruses in farmed grouper. Infection of fry and juvenile grouper at different stages of aquaculture causes mass mortality, resulting in serious economic losses over the years. GIV-R, ISKNV, and NNV are also three important viral pathogens in farmed barramundi. In addition to GIV-R, ISKNV, and NNV, scale drop disease virus (SDDV) is also an important virus causing high mortality in farmed barramundi.

[0003] Vaccination is a crucial and effective means of preventing and controlling viral diseases. Currently, GIV-R vaccines that have shown significant efficacy in the laboratory stage include inactivated vaccines, subunit vaccines, and DNA vaccines. For ISKNV, there is already a commercially available inactivated vaccine (NH0618 strain) for farmed mandarin fish. The development of NNV vaccines is also of paramount importance for the prevention and control of diseases in economically important fish species. Internationally, there are two commercially licensed cell-culture-based inactivated NVV vaccines. NNV virus has a simple structure; the capsid protein (CP) is the only structural protein of NNV and also its important immunogenic antigen, making it a key target for vaccine development. Various subunit vaccines developed based on CP have achieved ideal immunoprotective effects. SDDV is an important viral pathogen in farmed barramundi in Southeast Asian countries (Singapore, Malaysia, Thailand, Indonesia, etc.). In China, it is an important viral pathogen causing ascites in yellowfin seabream. SDDV isolates from diseased yellowfin seabream in China share more than 99% homology with SDDV from diseased barramundi widely prevalent in Southeast Asian countries at the whole genome level. In artificial infection experiments, SDDV isolates from yellowfin seabream in China also showed strong pathogenicity to barramundi.

[0004] Homologous recombination is a routine experimental technique in gene knockout technology, offering advantages such as strong targeting and ease of operation. Simultaneously, homologous recombination technology has laid the foundation for expressing heterologous proteins using viruses as vectors, providing theoretical support for the construction of chimeric viruses. In fish iridoviruses, including GIV and ISKNV, there have been numerous reports of using homologous recombination to replace specific viral genes with reporter genes (resistance genes or fluorescent protein genes). Some modified viruses obtained through this recombinant virus technology have also shown potential as attenuated live vaccines. The core aspects of obtaining recombinant viral strains using homologous recombination technology are, on the one hand, the parental strains used in the genetic manipulation themselves; different isolates of the same virus exhibit certain differences in replication efficiency, pathogenicity, and antigenicity. On the other hand, it is the discovery of the function of the target gene.

[0005] Currently reported GIV-R vaccines under development are mainly inactivated vaccines, DNA vaccines, and subunit vaccines, which either have high production costs or significant side effects. Therefore, finding a new vaccine with low cost and low side effects has become an urgent technical problem to be solved in this invention. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a chimeric vaccine strain of grouper iridovirus-neural necrosis virus and its application.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0008] In a first aspect, the present invention provides a grouper iris virus, wherein the grouper iris virus is frog grouper iris virus GIVΔ51 or frog grouper iris virus GIVΔ51-NNV. CP FL The frog grouper iridovirus GIVΔ51 has the accession number CCTCC NO: V2024120, is deposited at the China Center for Type Culture Collection, Wuhan University, Wuhan, China, on December 12, 2024; the frog grouper iridovirus GIVΔ51-NNV CP FL The accession number is CCTCC NO:V2024118, the depositary institution is the China Center for Type Culture Collection, the deposit address is Wuhan University, Wuhan, China, and the deposit date is December 12, 2024.

[0009] This invention marks the first discovery that the orf51 gene is a non-essential virulence gene of the frog grouper iridovirus GIV-R RP strain. This gene was removed using homologous recombination technology, yielding the frog grouper iridovirus GIVΔ51 strain. Experiments demonstrated that the GIVΔ51 strain exhibits significantly reduced virulence at the in vivo level, achieving a 100% protection rate when used as an attenuated vaccine for grouper immunization, thus showing promise as a candidate strain for a live attenuated vaccine.

[0010] This invention also utilizes homologous recombination technology to insert a neuronecrosis virus capsid protein nucleotide sequence into the orf51 gene site of the frog grouper iridovirus GIV-R RP strain, resulting in another frog grouper iridovirus, namely frog grouper iridovirus GIVΔ51-NNV. CP FL This virus strain can simultaneously prevent infection with grouper iridovirus and nerve necrosis virus, and can be used as a chimeric vaccine of grouper iridovirus-nerve necrosis virus from the frog virus genus.

[0011] This invention deposited the frog grouper iridovirus GIVΔ51 at the China Center for Type Culture Collection, Wuhan University, Wuhan, on December 12, 2024, with accession number CCTCC NO:V2024120, taxonomically named Grouperiridovirus, and specifically as frog grouper iridovirus GIVΔ51; and further deposited the frog grouper iridovirus GIVΔ51-NNV... CP FL It was deposited on December 12, 2024, at the China Center for Type Culture Collection, Wuhan University, Wuhan, with accession number CCTCC NO:V2024118, and its taxonomic name is Grouper iridovirus, specifically: Frog Grouper Iridovirus GIVΔ51-NNV. CP FL .

[0012] Secondly, the present invention provides a method for constructing the grouper iris virus, the method comprising the following steps: inserting a selection gene into the position of the orf51 gene of the grouper iris virus strain of the frog virus genus by homologous recombination to obtain the frog grouper iris virus GIVΔ51.

[0013] Alternatively, the preparation method includes the following steps:

[0014] The capsid protein nucleotide sequence of nerve necrosis virus was inserted into the orf51 gene of a grouper iridovirus strain belonging to the genus *Ranavira* using homologous recombination; thus obtaining the *Ranavira* GIVΔ51-NNV. CP FL .

[0015] As a preferred embodiment of the second aspect, the screening gene includes a first screening gene and a second screening gene; the first screening gene is an antibiotic resistance screening gene; and / or, the second screening gene is a fluorescent reporter gene.

[0016] As a preferred embodiment of the second aspect, the nucleotide sequence of the orf51 gene is shown in SEQ ID NO:1; and the nucleotide sequence of the capsid protein of the neuronecrosis virus is shown in SEQ ID NO:2.

[0017] Thirdly, the present invention provides the use of the grouper iridovirus described in the first aspect in the preparation of a vaccine to prevent grouper iridovirus.

[0018] As a preferred embodiment of the second aspect, the grouper iris virus is frog grouper iris virus GIVΔ51.

[0019] The grouper iridovirus prepared in this invention has been genetically modified to reduce its virulence, and experiments have shown that it can effectively prevent grouper iridovirus infection in fish.

[0020] As a preferred embodiment of the third aspect, the grouper iridovirus includes masculinic cell virus and grouper iridovirus of the frog virus genus.

[0021] As a preferred embodiment of the third aspect, the swollen cell virus includes one or more of the following: mandarin fish infectious spleen and kidney necrosis virus, red sea bream iridovirus, striped rock sea bream iridovirus, sea bass iridovirus, large yellow croaker virus, and oblique grouper iridovirus; the frog virus genus grouper iridovirus includes one or more of the grouper iridovirus Raoping strain; and the nerve necrosis virus includes red-spotted grouper nerve necrosis virus.

[0022] Fourthly, the present invention provides the application of the grouper iridovirus described in the first aspect in the preparation of a combined vaccine.

[0023] As a preferred embodiment of the fourth aspect, the combined vaccine is any one of the following:

[0024] (a) The combined vaccine comprises the grouper iridovirus and infectious spleen and kidney necrosis virus attenuated strains;

[0025] (b) The combined vaccine comprises the attenuated strains of grouper iridovirus and dephosphatemosis virus;

[0026] (c) The combined vaccine includes the grouper iridovirus, attenuated strain of infectious spleen and kidney necrosis virus and attenuated strain of dephosphatemosis virus.

[0027] Combining the grouper iris virus prepared in this invention with other attenuated viral strains or vaccine strains can produce a cost-effective combined vaccine that can simultaneously prevent multiple viruses. The aforementioned combined vaccine (a) can simultaneously prevent grouper iris virus, neuronecrosis virus, and infectious spleen and kidney necrosis virus; combined vaccine (b) can simultaneously prevent grouper iris virus, neuronecrosis virus, and desaturation virus; combined vaccine (c) can simultaneously prevent grouper iris virus, neuronecrosis virus, infectious spleen and kidney necrosis virus, and desaturation virus, achieving the goal of simultaneous prevention of multiple viruses with a single immunization.

[0028] Fifthly, the present invention provides a combined vaccine comprising: the grouper iridovirus, the attenuated strain of infectious spleen and kidney necrosis virus, and the attenuated strain of dephosphatemosis virus as described in the first aspect.

[0029] As a preferred embodiment of the fifth aspect, the grouper iris virus is frog grouper iris virus GIVΔ51-NNV. CP FL .

[0030] The frog grouper iridovirus GIVΔ51-NNV prepared by this invention CP FL Based on the frog grouper iridovirus GIV-RRP strain, a chimeric vaccine strain was obtained by inserting a neuronecrosis virus capsid protein nucleotide sequence into the orf51 gene locus of the GIV-RRP strain, which was named frog grouper iridovirus GIVΔ51-NNV. CP FL This chimeric vaccine strain possesses the function of jointly preventing grouper iridovirus and nerve necrosis virus (NNV) of the frog virus genus. Experiments have demonstrated that this chimeric vaccine strain, after inactivation and emulsification followed by intraperitoneal injection into grouper and barramundi, exhibits immunoprotective rates of 60.47% and 88.46% against GIV-R, respectively. It can effectively inhibit the replication of GIV-R and NNV in fish, and can also effectively induce specific anti-GIV-RP and NNV IgM.

[0031] The frog grouper iridovirus GIVΔ51-NNV of the present invention CP FL Combined with attenuated strains of infectious spleen and kidney necrosis virus and attenuated strains of desminosis virus, or their vaccine strains, a cost-effective combined vaccine can be prepared, providing simultaneous protection against multiple viruses. This achieves comprehensive protection against four viruses: grouper iridovirus, nerve necrosis virus, infectious spleen and kidney necrosis virus, and desminosis virus.

[0032] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0033] 1. The GIVΔ51 attenuated live vaccine prepared in this invention does not require emulsification of the virus culture. After diluting the stock solution 50 times (1.17108 copies / mL) and 100 times (5.87107 copies / mL), it is injected intraperitoneally into grouper. Only one case of death occurred during the immunization period. The fish were active and stable in feeding. The immune protection rate after challenge was as high as 100%. The GIVΔ51 prepared in this invention has strong immunogenicity, high safety, and low preparation cost, making it an ideal vaccine candidate strain.

[0034] 2. GIVΔ51-NNV prepared based on GIVΔ51 strain CPFLThe chimeric vaccine, after inactivation and emulsification, was administered intraperitoneally to grouper and barramundi, and the immunization protection rates were 60.47% and 88.46%, respectively. At the same time, it could effectively induce specific anti-GIV-RP and NNV IgM.

[0035] 3. In GIVΔ51-NNV CPFL GIVΔ51-NNV prepared based on the strain CPFL The ISKNV-SDDV multivalent vaccine immunizes barramundi with 100% efficacy against ISKNV and SDDV and 90% efficacy against GIV-R, while also effectively inhibiting NNV replication in vivo. Attached Figure Description

[0036] Figure 1 A schematic diagram illustrating the construction approach for the recombinant transfer vector pUC-delta ORF51;

[0037] Figure 2 Figure A shows the purification and identification of GIVΔ51 strain (Figure A is an electrophoresis diagram of PCR products of DNA extracts from GIV-RP and GIVΔ51 infected cells, with MCP primer, ORF51 primer and ORF51 flanking primer used in lanes 1, 2 and 3 respectively; Figure B is a schematic diagram of Western blot analysis results; Figure C is a schematic diagram of GIVΔ51 and SGIV genome alignment results).

[0038] Figure 3 Schematic diagram of the physiological characteristics of GIVΔ51 (Figure A shows the results of direct immunofluorescence observation of GIVΔ51 72 h after infection of MFF-1 cells; Figure B shows the growth curves of GIV-RP and GIVΔ51; Figure C shows the mortality rate of GIV-RP and GIVΔ51 in artificial infection experiments; Figure D shows the TCID of GIV-RP and GIVΔ51 infected cells 96 h later). 50 Schematic diagram; Figure E shows the TCID content of the supernatant of GIV-RP and GIVΔ51-infected cells at 48 h and 72 h. 50 (Schematic diagram)

[0039] Figure 4 Electron microscopic observation of the particle structure of GIV-RP and GIVΔ51 viruses;

[0040] Figure 5 A schematic diagram illustrating the safety and immunization efficacy evaluation process of the GIVΔ51 strain live attenuated vaccine.

[0041] Figure 6 GIVΔ51-NNV- CPSchematic diagram of the chimeric virus construction process (Figure A shows the PCR verification results, where lane 1 uses full-length GIV-RP MCP primers, lane 2 uses full-length GIV-RP ORF51 primers, lane 3 uses flanking primers of GIV-RP ORF51, lane 4 uses NNV S domain primers, and lane 5 uses NNVP domain primers; Figure B shows the WB verification results, where lane 1 contains MFF-1 cell lysates, lane 2 contains cells 60 days post-GIV-RP infection). Lane 3: MFF-1 cell lysate 60 h after GIVΔ51 infection; Lane 4: MFF-1 cell lysate 60 h after GIVΔ51-NNV-CP chimeric virus infection; Figure C is a schematic diagram of the whole genome alignment results of GIV-RP strain and GIVΔ51-NNV-CP strain; Figure D is a schematic diagram of the particle electron microscopy observation results of GIVΔ51-NNV-CP chimeric virus.

[0042] Figure 7 GIVΔ51-NNV- CP Experimental results of chimeric virus replication capacity at the cellular level and in vivo virulence (Figure A shows GIVΔ51-NNV). -CP Schematic diagram of intracellular proliferation capacity; Figure B shows GIVΔ51-NNV. -CP (Diagram of virulence at the in vivo level).

[0043] Figure 8 GIVΔ51-NNV- CP Schematic diagrams of the evaluation of the immunization effect of inactivated vaccines (Figure A shows the survival rate of grouper challenged with GIV-RP after immunization; Figure B shows the relative expression level of NNV CP in the brain tissue of grouper on day 4 after NNV challenge; Figure C shows the GIV-RP specific IgM titer in serum of grouper 21 days after immunization; Figure D shows the survival rate of barramundi challenged with GIV-RP after immunization; Figure E shows the relative expression level of NNV CP in the brain tissue of barramundi on day 4 after NNV challenge; Figure F shows the NNV specific IgM titer in serum of grouper 21 days after immunization).

[0044] Figure 9 This is a schematic diagram illustrating the evaluation of the immunization efficacy of the quadrivalent vaccine (Figure A shows the relative immunoprotection rate of each group after GIV-RP challenge; Figure B shows the relative immunoprotection rate of each group after ISKNV challenge; Figure C shows the relative immunoprotection rate of each group after SDDV challenge; Figure D shows the relative expression level of the NNVcp gene in each group after NNV challenge; among which ISKNV-SDDV-GIVΔ51-NNV...). CP FLThe quadrivalent vaccine 0.1 mL / tail dose group and 0.05 mL / tail dose group are represented as I / S / GN 0.1 and I / S / GN 0.05, respectively; the ISKNV-SDDV bivalent vaccine group is represented as I / S; GIVΔ51-NNV CP FL Chimeric vaccine group is denoted as GN). Detailed Implementation

[0045] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0046] This invention is the first to discover that the orf51 gene is a non-essential virulence gene of the frog grouper irisvirus GIV-R RP strain. In this invention, homologous recombination technology was used to insert a selection tag gene at the orf51 gene position to remove this gene, resulting in the frog grouper irisvirus GIVΔ51 strain. This GIVΔ51 strain exhibits significantly weakened virulence at the live in vivo level, and its protection rate as an attenuated vaccine against grouper is as high as 100%, making it a suitable candidate strain for a live attenuated vaccine. In this invention, it is named frog grouper irisvirus GIVΔ51.

[0047] This invention deposited the frog grouper iridovirus GIVΔ51 at the China Center for Type Culture Collection (CCTCC) on December 12, 2024. The deposit address is: Wuhan University, Wuhan, China. The accession number is CCTCC NO:V2024120. The taxonomic name is: Grouper iridovirus, and the name is: Frog Grouper Iridovirus GIVΔ51.

[0048] This invention is based on the frog grouper iridovirus GIV-R RP strain. A nucleotide sequence of the capsid protein of neuronecrosis virus (NNV) was inserted into the orf51 gene locus of the GIV-R RP strain to obtain a chimeric vaccine strain. This chimeric vaccine strain has the function of jointly preventing both frog virus-derived grouper iridovirus and NNV. Experiments have shown that this chimeric vaccine strain, after inactivation and emulsification, provides 60.47% and 88.46% immunoprotection rates in grouper and barramundi after intraperitoneal injection, respectively. It also effectively induces specific IgM against both GIV-RP and NNV. It is named Frog Grouper Iridovirus GIVΔ51-NNV. CP FL .

[0049] This invention utilizes frog grouper iridovirus GIVΔ51-NNV CP FL It was deposited on December 12, 2024, at the China Center for Type Culture Collection, Wuhan University, Wuhan, with accession number CCTCC NO:V2024118. Its taxonomic name is Grouperiridovirus, specifically: Frog Grouper Iridovirus GIVΔ51-NNV. CP FL .

[0050] Example 1: Construction of a dual reporter gene recombinant vector

[0051] In this embodiment, puromycin resistance and EGFP fluorescence were selected as reporter genes for the screening and purification of recombinant viruses. The first and second selection genes were inserted into the orf51 gene of the grouper iridovirus strain (Frogvirus genus) using homologous recombination; the construction approach is as follows. Figure 1 As shown:

[0052] First, a puromycin-EGFP fusion expression vector was constructed based on pEGFP-N3, that is, the puromycin resistance gene was inserted between the CMV promoter and the EGFP gene, resulting in a dual reporter gene vector (pcmv-puro-EGFP) that fused puromycin resistance and EGFP. Second, the dual reporter gene expression cassette (cmv-puro-EGFP) was obtained by PCR amplification and inserted into the pUC19 vector to obtain the pUC-puro-EGFP vector. Third, the upstream and downstream homologous arms (approximately 500 bp) of the target gene orf51 were amplified by PCR. Finally, the upstream and downstream homologous arms of the gene orf51 were inserted into the pUC-puro-EGFP vector, respectively, to obtain the recombinant transfer vector pUC-delta ORF51 containing the upstream (UF) and downstream (DF) homologous arms of orf51 and the dual reporter genes. The specific methods are as follows:

[0053] Step 1. Construct the dual reporter gene expression vector pcmv-puro-EGFP:

[0054] Primers were designed based on the puromycin DNA sequence, and appropriate restriction enzyme sites were selected. The puromycin fragment was amplified using KOD enzyme (Takara). The primers and restriction enzyme sites used are shown in Table 1. The PCR products were purified using a gel extraction kit (Omega) according to the manufacturer's instructions. The gel-extracted products and pEGFP-N3 plasmid were double-digested with restriction enzymes Nhe I and BamHI, respectively. The digested products were purified using a CP extraction kit (Omega) according to the manufacturer's instructions. The purified digested products were ligated with T4 ligase (thermofisher) at 22℃ for 1 h. The ligation products were transformed into DH5α competent strains, incubated on ice for 30 min, then heat-shocked at 42℃ for 90 s, placed on ice for 2 min, and then evenly spread onto LB plates containing kanamycin resistance. The plates were incubated upside down at 37℃ overnight. Single colonies were picked for PCR verification and sequencing. The recombinant with the correct sequence was retained, named pcmv-puro-EGFP, and stored at -20℃ for later use.

[0055] Step 2. Construct the recombinant expression vector pUC-puro-EGFP

[0056] Primers and suitable restriction enzyme sites were designed based on the cmv-puro-EGFP expression cassette DNA sequence. The puro-EGFP expression cassette nucleic acid fragment was amplified using KOD enzyme (Takara). The primers and restriction enzyme sites used are shown in Table 1. The PCR products were purified using a gel extraction kit (Omega) according to the manufacturer's instructions. The gel-extracted products and pUC19 plasmid were double-digested with Xba I and KpnI restriction enzymes, respectively. The digested products were purified using a CP extraction kit (Omega) according to the manufacturer's instructions. The purified digested products were ligated using T4 ligase (Thermo Fisher) at 22 °C for one hour. The ligation products were transformed into DH5α competent cells, incubated on ice for 30 min, then heat-shocked at 42 °C for 90 s, placed on ice for two minutes, and then evenly spread onto LB agar plates containing kanamycin resistance. The plates were incubated upside down at 37 °C overnight. Single colonies were picked for PCR verification and sequencing. The recombinant with the correct sequence was named pUC-puro-EGFP.

[0057] Table 1: Primers and restriction enzyme sites used

[0058]

[0059] Step 3. Construct the recombinant expression vector pUC-delta ORF51

[0060] Primers were designed based on the upstream and downstream fragments of the orf51 gene, as shown in Table 2. PCR products were purified using an Omega gel extraction kit according to the manufacturer's instructions. Due to the limited number of restriction enzyme sites, homologous recombination technology was used for vector construction. The pUC-puro-EGFP vector was double-digested with Xba I and Hind III restriction enzymes. The digestion products were purified using an Omega CP extraction kit according to the manufacturer's instructions. The upstream homologous arm fragment and the pUC-puro-EGFP vector digestion product were ligated using a seamless homologous recombinase (Beyotime). The ligation product was transformed into DH5α competent strains, incubated on ice for 30 min, then heat-shocked at 42 ℃ for 90 s, placed on ice for 2 min, and then evenly spread onto LB agar plates containing kanamycin resistance. The plates were incubated upside down at 37 ℃ overnight. Single colonies were picked for PCR verification and sequencing. Recombinants with correct sequences were retained and named pUC-ORF51-U-puro-EGFP, and stored at -20 ℃ for later use. pUC-ORF51-U-puro-EGFP was double-digested with Kpn I and EcoR I restriction enzymes. The digestion products were purified and recovered using a CP recovery kit (Omega) according to the manufacturer's instructions. The downstream homologous arm fragment and the digested pUC-ORF51-U-puro-EGFP vector were ligated using seamless homologous recombinase (Beyotime). The ligation product was transformed into DH5α competent strains, incubated on ice for 30 min, then heat-shocked at 42 °C for 90 s, placed on ice for 2 minutes, and then evenly spread onto LB agar plates containing kanamycin resistance. The plates were incubated upside down at 37 °C overnight. Single colonies were picked for PCR verification and sequencing. The recombinant with the correct sequence was retained and named pUC-delta ORF51, and stored at -20 °C for later use.

[0061] Table 2: Primers for amplification of upstream and downstream homologous arms of the orf51 gene

[0062]

[0063] Table 3: Homologous recombination linkage system

[0064]

[0065] The nucleotide sequence of the orf51 gene described in this embodiment is as follows:

[0066] ATGTTTGTGGTTGTAGCTCTAGTTTTCCTGATCGTAAACCAAGCTAACGCTTTACAATTTTCGTCCGACA CCTACGACAGCCGACACGAATGCACTTCGTGCGGGGACCCTACAAATGAAACGTACGGGTACGACGTGAA GATGCAACGCATTCAAATGGAAGGGTACCTTACATATGACTTTGCCGGATTACCGTTAGGTTATGACAAT ACAGATTGGGAGCGGGTCATGAAAAAAGGATTAACTATAGCTGACGGGACACCGTGCGTGGGTATGTGTA CTCCGTACAGAATGAGCTCAAACAATCATTACTGCGTGCCTAAAGGAAAAGTGAACGAATGGGAACGCTG CGCCCTACCTGGGCGAGATCAGTATGGGAGATGGTGCGCAGAAATTAATAAAGACGAAACGTACGGAACG TGGTGCTACGTAAAGGACAGAAACAAGTACGGAACGTTCTCAGGAGGTCAATGGGGATACACGCATCCCG CCCTATGTTTTAAATCCCAAAAGAGCTGCAGATACAATTTTAACGACATAGATGTCAGCGTGTAA (SEQ ID NO: 1).

[0067] Example 2 Construction and identification of GIVΔ51 recombinant deletion strain

[0068] 1. Cell resuscitation and transient transfection

[0069] Frozen MFF-1 cells (mandarin fish embryonic cell line) were revived. After two passages, the revived cells could be used for transient transfection. The transfection reagent was MIK superluminal, and the specific method was described in the instruction manual. The recombinant transfer vector pUC-delta ORF51 constructed in Example 1 was transfected into MFF-1 cells, and the fluorescence expression was observed under a fluorescence microscope.

[0070] 2. Construction and purification of GIVΔ51 recombinant deletion strain

[0071] 2.1 Homologous recombination:

[0072] After MFF-1 cells showed green fluorescence under a microscope (24-48 h post-transfection), the parental GIV-RP strain was inoculated into cells transfected with the recombinant transfer vector (MOI=1). Two h after challenge, the original culture medium was aspirated, and DMEM medium containing 2% FBS was added for further culture. Cell pathogenesis and fluorescence expression were observed under a fluorescence microscope. After complete cell pathogenesis, the cells were freeze-thawed three times to obtain the viral solution.

[0073] Healthy MFF-1 cells (MOI=10) were inoculated with the viral solution. One hour after challenge, the original culture medium was aspirated, and DMEM medium containing 2% FBS with puromycin (final concentration 2 μg / mL) was added. The cells were cultured for a longer period, and the cytopathic effect (CPE) and fluorescence expression were observed. 1 μL of trypsin was pipetted onto the fluorescently expressing diseased cells using a sterile white pipette tip to obtain fluorescently expressing diseased cells.

[0074] The fluorescent diseased cells were transferred to healthy MFF-1 cells, cultured and observed, and the above steps were repeated until large areas of fluorescent plaques were obtained.

[0075] 2.2 Plaque Purification:

[0076] After obtaining continuous, passageable fluorescent plaques, their locations were marked under a fluorescence microscope. 1 μL of trypsin was pipetted onto the plaques using a sterile white pipette tip, diluted 10-fold with sterile PBS, and then transferred to healthy cells for further culture and observation. This process was repeated until a pure recombinant deletion strain was obtained. Following continuous plaque purification, green fluorescent plaques gradually became dominant, yielding the GIVΔ51 virus strain.

[0077] 3. Identification of GIVΔ51 recombinant deletion strains

[0078] 3.1. PCR identification ( Figure 2 A)

[0079] Healthy MFF-1 cells were infected with GIV-RP and GIVΔ51 at MOI=1 and cultured at 26℃ in 5% CO2. After complete cell pathogenesis, the cells were collected, and MFF-1 cell DNA was extracted for PCR virus purity testing. The cell DNA extraction method followed the instructions for the Novizan DNA Extraction Kit. Primers used for PCR identification of the deletion strain are shown in Table 3.

[0080] Table 3: Primers for PCR identification of deletion strains:

[0081]

[0082] Using the parent strain GIV-RP as a reference, the major capsid protein gene (MCP) of GIV could be detected in GIVΔ51-infected cell samples, but the orf51 gene could not be detected. Meanwhile, a mutant band of approximately 1800 bp (pcmv-puro-EGFP) was amplified using orf51 flanking primers, indicating that puro-EGFP successfully replaced orf51 and integrated into the viral genome, thus verifying the deletion of orf51 at the gene level.

[0083] 3.2. Western-bolt (WB) analysis

[0084] Healthy MFF-1 cells (MOI=1) were inoculated with parental and deletion strains, respectively. After incubation for 2 h, the medium was changed, and the cells were cultured for another 48 h. The original medium was then aspirated, and the cells were washed once with PBS. 1 mL of PBS was added, and the cells were gently scraped off using a cell scraper. The cell suspension was transferred to centrifuge tubes and centrifuged at 500g for 5 min to collect the cell pellet. The supernatant was carefully aspirated, taking care not to remove the cells. RIPA lysis buffer was added to 100 μL / well of a 6-well plate, and the plate was incubated on ice for 5 min. Protein loading was added to the obtained protein sample, and the plate was boiled for 10 min for SDS-PAGE electrophoresis. Western blotting was performed after SDS-PAGE. The primary antibodies used were antiORF22 (ORF22 is a homolog of SGIV VP88), antiORF51, antiGFP, and antiβ-actin, all diluted 1:3000.

[0085] like Figure 2 As shown in Figure B, with β-actin as an internal control, cell samples infected with GIV-RP and GIVΔ51 were compared. In both cases, viral ORF22 protein expression was detected, while in the latter, ORF51 protein expression was undetectable, although puro-EGFP fusion protein expression was detected. This indicates that the puro-EGFP integrated into the viral genome can be expressed normally and successfully replaces ORF51, validating the absence of ORF51 at the protein level.

[0086] 3.3. Genome resequencing

[0087] Genomic DNA was extracted from GIVΔ51-infected cells, and the purified genomic DNA was used for genome resequencing. Genome sequencing and assembly were performed by Beijing Novogene Technology Co., Ltd. After obtaining the complete GIVΔ51 genome sequence, it was aligned with the GIV-R type species SGIV (NC_006549.1) on the NCBI website (https: / / www.ncbi.nlm.nih.gov). Figure 2As shown in C, GIVΔ51 is homologous to SGIV VP125. The vp125 gene is located at 109474~110028 bp in the genome, but there is a mutation at 110 kbp in the SGIV genome.

[0088] 3.4. Physiological characteristics of GIVΔ51 strain

[0089] 3.4.1. Growth characteristics of GIVΔ51 plant

[0090] After purification, pure GIVΔ51 was seeded into MFF-1 cells (MOI=1), cultured for 72 h, fixed with methanol, and the nuclei were stained with DAPI and mounted. Observation under a fluorescence microscope showed that green fluorescent protein was highly expressed in the infected cells (see...). Figure 3 A). Cell samples taken 72 hours post-infection were fixed with electron microscopy fixative and prepared into electron microscopy sections for observation of virus particle morphology under a transmission electron microscope, such as... Figure 4 As shown, GIVΔ51 viral particles also exhibit a typical hexagonal (icosahedral) structure. Mature viral particles are enveloped, and the morphology of GIVΔ51 viral particles is not significantly different from that of the parent strain, meaning that the absence of orf51 does not affect viral particle packaging. To detect the replication capacity of GIVΔ51 at the cellular level, GIV-RP and GIVΔ51 were inoculated into fresh MFF-1 cells (MOI=1). Cell samples were collected at 12 h, 24 h, 48 h, 72 h, and 96 h post-inoculation, and DNA was extracted for viral copy number detection by qRT-PCR. Figure 3 As shown in Figure B, the proliferation capacity of GIVΔ51 at the cellular level was not significantly different from that of the parental strain, meaning that the absence of orf51 does not affect viral replication at the cellular level. Simultaneously, TCID levels were measured in cell samples from GIV-RP and GIVΔ51 infected cells 96 h post-infection. 50 The result is as follows Figure 3 As shown in D, the TCID of both 50 All are 10 8 The TCID levels were approximately 0.1 mL, with no significant difference. To detect the intracellular release of GIVΔ51, TCID levels were measured in the supernatant of GIV-RP and GIVΔ51-infected MFF-1 cells at 48 h and 72 h, respectively. 50 The result is as follows Figure 3 As shown in E, there was no significant difference in the supernatant of both at 48 h and 72 h post-infection, meaning that the absence of orf51 does not affect viral release.

[0091] 3.4.2. Toxicity Identification

[0092] Live virus challenge experiment: Grouper were artificially infected with the parental strain GIV-RP and the deletion strain GIVΔ51, respectively, with a viral copy number of 10 in both strains.9 Copies / mL, intraperitoneal injection, injection dose is 100 μL / fish, control group is intraperitoneally injected with the same dose of sterile PBS, 25 fish in each group, recirculating aquaculture, water temperature controlled at 26-28℃, fed daily, mortality observed and recorded. Results are as follows Figure 3 As shown in D, the peak mortality period of GIVΔ51 occurred 3-5 days after challenge, consistent with the parent strain, but the mortality rate was significantly lower than that of the parent strain (82.35%), with a mortality rate of only 35%, indicating that the deletion strain GIVΔ51 reduced toxicity.

[0093] 4. Evaluation of the immunogenicity of GIVΔ51 strain live attenuated vaccine

[0094] Preparation of live attenuated vaccine: GIVΔ51 was inoculated into fresh, healthy MFF-1 cells with approximately 80% confluence and cultured for 3-4 days. After complete cytopathic effect, the cells were subjected to three freeze-thaw cycles at -80°C, and TCID was measured. 50 Collect the viral copy number, collect the pathogen, and store it at -80℃ for later use without inactivation.

[0095] Immunization: The grouper was purchased from a fish farm in Yangjiang City, Guangdong Province, and weighed approximately 10 g. The virus stock solution was diluted 50 times (1.1710). 8 copies / mL), 100 times (5.8710 7 After administering 0.2 mL of DMEM culture medium per fish (copies / mL), the experimental fish were immunized intraperitoneally. Each group consisted of approximately 40 fish. The control group received the same dose of DMEM culture medium. The experimental fish were temporarily housed in a recirculating aquaculture system with a salinity of 30‰ and a water temperature controlled at around 28℃. Aeration was provided by a unified air pump, and the fish were fed twice daily.

[0096] Challenge: 21 days after immunization, a challenge experiment was conducted using GIV-RP (8.4010). 9 0.2 mL / tail, intraperitoneal injection. Daily observation, mortality rate analysis, and relative protection rate (RPS) calculated using the following formula.

[0097]

[0098] The results are as follows Figure 5 As shown, only one death occurred during the immunization period with the GIVΔ51 live attenuated vaccine, indicating a good safety profile. This demonstrates that the GIVΔ51 live attenuated vaccine is safe to use, has strong immunogenicity, provides good immunoprotection, and has low production costs.

[0099] Based on the above identification and verification, this invention names the GIVΔ51 strain of the frog grouper iridovirus GIVΔ51. The frog grouper iridovirus GIVΔ51 was deposited on December 12, 2024, at the China Center for Type Culture Collection, Wuhan University, Wuhan, with accession number CCTCC NO: V2024120, and its taxonomic name is Grouper iridovirus, named Frog Grouper Iridovirus GIVΔ51.

[0100] Example 3 Construction and purification of GIVΔ51-NNVCPFL chimeric virus

[0101] A nucleotide sequence of the capsid protein of a nerve necrosis virus was inserted into the orf51 gene of a grouper iridovirus strain (Frogvirus genus) using homologous recombination; the details are as follows:

[0102] 1. Construction of the recombinant transfer vector pUC-knock in-NNV CP-mCherry

[0103] Homologous recombination primers were designed to amplify the mCherry, puro, and NNV CP genes, respectively. Simultaneously, homologous recombination primers were designed to linearize the pUC-delta ORF51 vector PCR product, which was then purified by gel extraction and stored at 4°C for later use. The mCherry, puro, and NNV CP fragments were ligated into the linearized pUC-delta ORF51 plasmid using Beyotime's seamless homologous recombination enzyme, replacing the puro-EGFP expression cassette. The ligation product was transformed into DH5α competent cells, incubated on ice for 30 min, then heat-shocked at 42°C for 90 s, placed on ice for 2 minutes, and then evenly spread onto LB agar plates containing kanamycin resistance. The plates were incubated overnight at 37°C. Single colonies were picked for PCR verification and sequencing. Recombinants with correct sequences were retained and named pUC-knock in-NNV CP-mCherry, and stored at -20°C for later use. The primers and restriction enzyme sites used are shown in Table 3.

[0104] Table 3: Primers and enzyme sites used

[0105]

[0106] The nucleotide sequence of the NNV CP fragment in this embodiment is as follows:

[0107] gctcccatcatgacacaaggttccctgtacaacgattccctttccacaaatgacttcaagtccatcctcctaggatccacaccactggacattgcccctgatggagcagtcttccagctggaccgtccgctgtccattgactacagccttggaactggagatgttgaccgtgctgtttat tggcacctcaagaagtttgctggaaatgctggcacacctgcaggctggtttcgctggggcatctgggacaacttcaacaagacgttcgca gatggcgttgcctactactctgatgagcagcctcgtcaaatcctgctgcctgttggcactgtctgcactagggttgactcggaaaac (seq ID NO:2).

[0108] 2.GIVΔ51-NNV CPFL Chimeric virus and purification

[0109] GIVΔ51-NNV was performed in MFF-1 cells according to the method described in Example 2. CPFL Chimeric viruses were constructed, and aggregated, continuously passaged red fluorescent plaques were obtained. Plaque purification followed. Through continuous purification, red fluorescent plaques gradually became dominant. After approximately 30 generations of continuous plaque purification, pure GIVΔ51-NNV was obtained. CPFL Chimeric virus. Take GIVΔ51-NNV. CPFL Infected cell samples were validated by PCR and Western blot, and their genomes were resequencing.

[0110] Take GIV-RP (wild strain) and GIVΔ51-NNV CPFL Genomic DNA was extracted from cell samples 60 hours post-infection and then subjected to PCR detection. Figure 6 As shown in A, in GIVΔ51-NNV CPFL Orf51 was not detected in the infected cell samples, but mutant bands were detected by flanking primers, and NNV CPs domain and p domain were also detected.

[0111] Take GIV-RP (wild strain) and GIVΔ51-NNV CPFL Western blot analysis was performed on cell lysates 60 hours post-infection, such as... Figure 6 As shown in B, in GIVΔ51-NNV CPFLThe NNV CP-mCherry fusion protein was detected in the lysate of infected cells (lane 4) using NNV CP-specific and mCherry-specific antibodies, but not in the lysate of GIV-RP-infected cells.

[0112] For GIV-RP and GIVΔ51-NNV CPFL The genome of the strain was re-sequencing, and after assembling the complete genome, it was aligned using BLAST on the NCBI website. https: / / blast.ncbi.nlm.nih.gov / Blast.cgi ),like Figure 6 As shown in C, the mutation occurs at approximately 50 kbp in the GIV-RP genome, which is basically consistent with orf51 (49771~50325 bp).

[0113] GIVΔ51-NNV CPFL Electron microscopy observations of chimeric viral particles are as follows: Figure 6 As shown in Figure D, GIVΔ51-NNV CPFL The morphology is also typical "hexagonal" and there is no significant difference between it and its parent strain GIVΔ51 and wild-type GIV-RP. In other words, the insertion of the NNV CP-mCherry fusion protein does not affect the assembly of viral particles.

[0114] GIVΔ51-NNV CPFL Intracellular replication capacity and in vivo virulence were assessed, and the results were as follows: Figure 7 As shown in A, GIVΔ51-NNV CPFL Its intracellular proliferation capacity is stronger than that of GIV-RP and GIVΔ51. At the late stage of infection, GIVΔ51-NNV... CPFL The viral load was significantly higher than that of GIV-RP and GIVΔ51 (**p<0.01). Results of artificial infection experiments showed (see...). Figure 7 B) GIVΔ51-NNV CPFL The toxicity decreased at the live level.

[0115] 3.GIVΔ51 - NNV CPFL Evaluation of the immunoprotective effect of chimeric vaccines

[0116] GIV-RP, GIVΔ51, and GIVΔ51-NNV CPFL Chimeric virus cell cultures were inactivated in formalin at room temperature for 24 hours and then emulsified with white oil adjuvant to prepare vaccines. These vaccines were used to immunize grouper (~10g) and barramundi (~5g), respectively. Twenty-one days after immunization, the experimental fish were challenged with GIV-RP and ASB-NNV-23 virus suspensions, respectively. Mortality and morbidity rates were observed and statistically analyzed after challenge, and the recurrence-free survival (RPS) was calculated.

[0117] The results are as follows Figure 8 As shown in A, GIV-RP, GIVΔ51, and GIVΔ51-NNV CPFL The RPS (recovery potential) of the grouper in the immunized group after GIV-RP challenge were 55.81%, 58.14%, and 60.47%, respectively, indicating good immunoprotective effect. Figure 8 As shown in D, GIV-RP, GIVΔ51, and GIVΔ51-NNV CPFL The RPS of the immunized group of barramundi after GIV-RP challenge were 82.64%, 96.15% and 88.64%, respectively, indicating good immune protection.

[0118] GIV-RP, GIVΔ51, GIVΔ51-NNV CPFL Disease was observed in grouper from both the immunized group and the PBS control group after challenge with ASB-NNV-23, but no experimental fish died. This may be because the grouper's weight at the time of challenge was approximately 15g, far exceeding the NNV-sensitive size (around 3-5g), at which point NNV infection could be established but rarely fatal. Therefore, on the 4th day after challenge, brain tissue was collected from 5 randomly selected fish from each group for dissection, and the relative expression level of NNV CP in the tissue was measured to determine the vaccine's protective effect. The results are as follows... Figure 8 As shown in B, GIVΔ51-NNV CPFL The relative expression level of NNV CP in the brain tissue of the immunized group was significantly lower than that in the other three groups (p<0.05), indicating that GIVΔ51-NNV... CPFL Chimeric vaccines can effectively protect grouper from ASB-NNV-23 infection.

[0119] GIV-RP, GIVΔ51, GIVΔ51-NNV CPFL Significant disease was observed in the ASB-NNV-23 challenge group and the PBS control group of bluefin bream after challenge, but no fish died. Similarly, the bluefin bream were approximately 10 g in size during the challenge experiment, far exceeding the NNV-sensitive size. Diseased fish exhibited clear grouping with other fish, congregating near the aquarium drain. Symptoms primarily included lying on the bottom, darkening of the body, and decreased appetite. GIV-RP, GIVΔ51 immunization group, and GIVΔ51-NNV were also included. CPFL In the immunized group and PBS group, the onset of illness was approximately day 3 post-challenge; in the GIV-RP and GIVΔ51 immunized group and PBS group, it lasted until approximately day 7; while in the GIVΔ51-NNV group... CPFL The symptoms in the immune group gradually subsided after 3 days.

[0120] Based on the above symptoms, the number of diseased fish was counted, and the morbidity rate and relative protection rate were calculated. The morbidity rate and relative protection rate are shown in Table 4. (GIVΔ51-NNV) CPFL The chimeric vaccine has a relative protection rate against NNV of approximately 79.55%.

[0121] On day 7 post-infection, five fish from each group were dissected to obtain brain tissue, and the relative expression levels of NNV CP in the tissue were measured. Figure 8 As shown in E, GIVΔ51-NNV CPFL The relative expression level of NNV CP in the brain tissue of the immune group was significantly lower than that of the other three groups. In conclusion, this indicates that GIVΔ51-NNV... CPFL Chimeric vaccines provide excellent immune protection against both GIV-RP and NNV.

[0122] Table 4: Morbidity and RPS of ASB-NNV-23 challenge after immunization of barramundi

[0123]

[0124] To detect GIVΔ51-NNV CPFL Whether chimeric vaccines can induce the production of specific IgM antibodies was tested using GIV-RP and GIVΔ51-NNV, respectively. CPFL Grouper (~200 g), 8 fish per group, were immunized via intraperitoneal injection, 0.2 mL / fish. Blood was collected from the tail vein 21 days post-immunization, and serum was separated. The titers of GIV-RP and NNV-specific IgM antibodies in the serum were determined using a sandwich ELISA method. Figure 8 As shown in C, GIV-RP and GIVΔ51-NNV CPFL The serum titer of GIV-RP-specific IgM antibodies in the immunized group was significantly higher than that in the non-immunized group. Figure 8 As shown in F, GIVΔ51-NNV CPFL The titer of NNV-specific IgM antibody in the serum of the immunized group was significantly higher than that in the GIV-RP immunized group and the non-immunized group.

[0125] Based on the above identification and verification, this invention relates to the GIVΔ51-NNV virus. CPFL The strain was named: Frog Grouper Iridovirus GIVΔ51-NNV CP FL And the frog grouper iridovirus GIVΔ51-NNV CP FL It was deposited on December 12, 2024, at the China Center for Type Culture Collection, Wuhan University, Wuhan, with accession number CCTCC NO:V2024118, and its taxonomic name is Grouper iridovirus, specifically: Frog Grouper Iridovirus GIVΔ51-NNV. CP FL .

[0126] Example 4. ISKNV-SDDV-GIVΔ51-NNV CP FL Evaluation of the immunoprotective effect of the quadrivalent vaccine

[0127] This embodiment provides a quadrivalent vaccine, which includes: a frog virus grouper iris virus-neural necrosis virus chimeric vaccine strain (i.e., frog grouper iris virus GIVΔ51-NNV of Example 3). CP FL ), attenuated strains of infectious spleen and kidney necrosis virus and attenuated strains of dephosphatemosis virus.

[0128] Based on the proven immunogenicity of the ISKNV-SDDV bivalent vaccine, it was mixed with GIVΔ51-NNV at a volume ratio of 1:1. CPFL Chimeric vaccines are combined to form a quadrivalent vaccine.

[0129] To verify the efficacy of the quadrivalent vaccine, approximately 5g of barramundi were used for evaluation. The barramundi were divided into 5 groups of 200 fish each, and were intraperitoneally injected with either the ISKNV-SDDV bivalent vaccine (0.1 mL / fish) or the GIVΔ51-NNV vaccine. CP FL Chimeric vaccine (0.1 mL / tail), ISKNV-SDDV-GIVΔ51-NNV CPFL Quadrivalent vaccine (0.1 mL / tail), ISKNV-SDDV-GIVΔ51-NNV CPFL A quadrivalent vaccine (0.05 mL / tail) was administered, while the control group received sterile PBS (0.1 mL / tail). Recirculating aquaculture systems were used, with daily feeding. Challenge experiments were conducted 18 days post-immunization using ISKNV, SDDV, GIV-RP, and NNV. ISKNV, SDDV, and GIV-RP were administered intraperitoneally, while NNV was administered via intramuscular injection in the back. Feeding and observation were conducted daily after challenge, and mortality was recorded to calculate RPS (Recovery Price Score).

[0130] No deaths or significant disease incidence occurred in any group after NNV challenge. This may be because the fish were too large for the NNV-sensitive size during the challenge experiment. Therefore, on the fourth day after challenge, five fish were randomly selected from each group for dissection and brain tissue analysis to determine the relative expression level of the NNVcp gene. Results Figure 9 As shown, the quadrivalent vaccine at doses of 0.1 mL / tail and 0.05 mL / tail exhibited good protective effects against ISKNV, SDDV, and GIV-RP, with relative immunization protection rates as high as 80% or more. Figure 9 AC). The relative expression levels of the NNVcp gene showed ( Figure 9 (D) The relative expression level of NNVcp gene was lowest in the quadrivalent vaccine group (0.1 mL / tail and 0.05 mL / tail), followed by the chimeric vaccine group, both significantly lower than the PBS control group. However, the relative expression level of NNVcp gene in the ISKNV-SDDV bivalent vaccine group was not significantly different from that in the PBS control group.

[0131] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A grouper iridovirus, characterized in that, The grouper iris virus mentioned is frog grouper iris virus GIVΔ51 or frog grouper iris virus GIVΔ51-NNV. CP FL ; The accession number of the frog grouper iridovirus GIVΔ51 is: CCTCC NO:V2024120, the depositary institution is: China Center for Type Culture Collection, the deposit address is: Wuhan University, Wuhan, China, and the deposit date is: December 12, 2024; The frog grouper iridovirus GIVΔ51-NNV CP FL The accession number is CCTCC NO:V2024118, the depositary institution is the China Center for Type Culture Collection, the deposit address is Wuhan University, Wuhan, China, and the deposit date is December 12, 2024.

2. A method for constructing a grouper iridovirus as described in claim 1, characterized in that, The construction method includes the following steps: The selection gene was inserted into the orf51 gene of the grouper iris virus strain of the frog virus genus by homologous recombination to obtain the frog grouper iris virus GIVΔ51; wherein the orf51 gene is deleted in the frog grouper iris virus GIVΔ51, and the nucleotide sequence of the orf51 gene is shown in SEQ ID NO:

1. Alternatively, the construction method includes the following steps: The capsid protein nucleotide sequence of nerve necrosis virus was inserted into the orf51 gene of the grouper iridovirus strain of the frog virus genus GIVΔ51-NNV by homologous recombination. CP FL Among them, the frog grouper iridovirus GIVΔ51-NNV CP FL The orf51 gene is deleted in the virus, and the nucleotide sequence of the capsid protein of the neuronecrosis virus is shown in SEQ ID NO:

2.

3. The method for constructing grouper iridovirus as described in claim 2, characterized in that, The screening genes include a first screening gene and a second screening gene; the first screening gene is an antibiotic resistance screening gene; and the second screening gene is a fluorescent reporter gene.

4. The use of the grouper iridovirus as described in claim 1 in the preparation of a vaccine against grouper iridovirus of the genus Rhamnovirus.

5. The application of the grouper iridovirus as described in claim 1 in the preparation of a quadrivalent vaccine, characterized in that, The quadrivalent vaccine comprises the grouper iris virus, an attenuated strain of infectious spleen and kidney necrosis virus, and an attenuated strain of dephosphatemosis virus as described in claim 1; the grouper iris virus is frog grouper iris virus GIVΔ51-NNV. CP FL .

6. A quadrivalent vaccine, characterized in that, The quadrivalent vaccine comprises: the grouper iris virus as described in claim 1, an attenuated strain of infectious spleen and kidney necrosis virus, and an attenuated strain of dephosphatemosis virus; wherein the grouper iris virus is frog grouper iris virus GIVΔ51-NNV. CP FL .

Citation Information

Patent Citations

  • Iridovirus bivalent inactivated vaccine as well as preparation method and application thereof

    CN118853536A

  • Vaccines and antibodies produced from viruses derived from an immortal cell line of grouper epinephelus coioides

    WO2003050142A1