An amino acid sensor and its application

Abstract

This application relates to the field of molecular biology, and particularly to a customized and universal amino acid sensor and its application. This application discloses an amino acid sensor, which includes a constitutive promoter, the coding gene of the natural transcriptional regulatory element amino acid attenuator of Escherichia coli, a reporter gene, and a terminator connected in sequence. Through element transformation, signal mechanism innovation, and reaction system optimization, this application has constructed a new generation of amino acid detection technology system, achieving breakthrough improvements in core indicators such as detection sensitivity, specificity, and application scenarios, providing an innovative technical solution for the field of biosensing.

Description

Technical Field

[0001] This application relates to the field of molecular biology, and particularly to amino acid attenuator-based biosensors and their applications. Background Art

[0002] Amino acids and their precursor compounds, as important metabolic intermediates in organisms and basic units for protein synthesis, play a crucial role in multiple fields such as biosynthesis, metabolic engineering, drug development, and the food industry. With the rapid development of synthetic biology and metabolic engineering technologies, the demand for precise detection, efficient screening, and dynamic regulation of amino acids and their precursor compounds is increasing. Amino acid biosensors, as a type of biomolecular tool that can specifically recognize and respond to changes in amino acid concentrations, have shown great application potential in aspects such as functional element screening, metabolic pathway regulation, and industrial production strain screening, and have received extensive attention in recent years. Currently, amino acid biosensors based on different design principles emerge in an endless stream, mainly including sensors based on mechanisms such as transcriptional regulators, riboswitches, and metabolic pathway intermediate sensing. Among them, biosensors based on transcriptional regulators have become the most widely used type due to their wide range of responses to amino acid types, superiority in performance, and ease of further modification. However, these sensors have deficiencies in amino acid response specificity and are prone to producing false positive results during the screening process, limiting their application accuracy. In contrast, biosensors based on riboswitches perform better in terms of response sensitivity and specificity, but their dynamic range and operating range are relatively small, making it difficult to play a comprehensive role in the dynamic regulation of complex metabolic pathways. Therefore, developing amino acid biosensors with high sensitivity, high specificity, wide dynamic range, and good operability has become an important research direction at present.

[0003] Although amino acid biosensors have shown broad application prospects in multiple fields, they still face many problems and challenges. First, the coverage of amino acid types is incomplete: Although biosensors for most protein amino acids have been reported, biosensors for all 20 natural amino acids are not yet fully mature. In particular, biosensors for important amino acids such as L-aspartic acid, L-threonine, and L-proline are yet to be developed, which to some extent affects the screening efficiency of related amino acid high-yield strains. Second, there is an urgent need to improve performance. The performance of existing amino acid biosensors still has limitations in terms of sensitivity, specificity, dynamic range, etc. Especially in industrial strains, due to the complexity of the intracellular metabolic environment, the response of the sensor is prone to saturation, resulting in a decrease in detection accuracy and limiting its reliability in industrial applications. Therefore, constructing more specific biosensors and improving their comprehensive performance to enhance their reliability in industrial applications has become an urgent problem to be solved. Third, the selection of reporter genes and application scenarios are limited. Traditional amino acid biosensors mostly use fluorescent proteins or enzymes involved in color reactions as reporter genes. The translational-level signal output of these reporter genes has deviations during the amino acid response process and is easily affected by factors such as the growth of strains. In addition, most traditional sensors choose to sense amino acids in vivo, with limited application scenarios and difficulty in meeting diverse detection needs. Summary of the Invention

[0004] In view of the problems and challenges existing in the existing amino acid biosensors, this application proposes a novel amino acid biosensor based on the attenuator of the amino acid regulatory feedback inhibition mechanism of Escherichia coli. As a model organism, the amino acid regulatory feedback inhibition mechanism of Escherichia coli mainly relies on two mechanisms: transcriptional regulatory factors and attenuators. Among them, the attenuator, through the coupling of prokaryotic translation and transcription, regulates the transcription of downstream structural genes during the process of RNA polymerase transcribing mRNA by using the translation situation of ribosomes on the leader peptide of the attenuator.

[0005] This application has achieved specific responses to 20 natural amino acids by modifying the Escherichia coli attenuator mechanism. Specifically, the codon sequence of the target amino acid in the natural attenuator is changed to the codon sequence of other amino acids, enabling the system to respond to the concentration changes of all 20 natural amino acids. At the same time, this application selects RNA aptamers as reporter genes, restricting the signal output to the transcriptional level and reducing the interference of amino acid concentration on the translational-level signal output. In particular, this application utilizes a high-affinity ribonucleotide aptamer called 3WJdB, which can bind a fluorophore derivative DFHBI-1T with nanomolar affinity and emit green fluorescence when binding. By designing 3WJdB-IV with 4 repeats of the 3WJdB unit as the reporter gene, the signal output is further enhanced.

[0006] In addition, this application also established an in vitro transcription and translation platform using a cell-free reaction system, improving the sensitivity of the amino acid biosensor and expanding its application scope. This innovative design not only overcomes the problems of traditional amino acid biosensors in terms of amino acid type coverage, performance improvement, and limitations in reporter gene selection and application scenarios, but also provides new technical means for the precise detection, efficient screening, and dynamic regulation of amino acids and their precursor compounds.

[0007] The first aspect of this application is to provide an amino acid sensor.

[0008] The amino acid sensor includes a constitutive promoter, a coding gene of the amino acid attenuator of the natural transcriptional regulatory element of Escherichia coli, a reporter gene, and a terminator, which are connected in sequence;

[0009] Further, the constitutive promoter is the trc promoter;

[0010] Furthermore, the nucleic acid sequence of the constitutive promoter trc promoter is as shown in SEQ ID NO. 2;

[0011] Further, the reporter gene is a fluorescent nucleic acid aptamer coding gene;

[0012] Furthermore, the fluorescent nucleic acid aptamer coding gene includes the 3WJdB coding gene and the 3WJdB-IV coding gene that maintain the fluorescence of DFHBI-1T;

[0013] Specifically, the 3WJdB is as shown in SEQ ID NO. 3, and the nucleic acid sequence of the 3WJdB-IV coding gene is as shown in SEQ ID NO. 4;

[0014] Further, the terminator is the rrnB t1 terminator;

[0015] Furthermore, the nucleic acid sequence of the rrnB t1 terminator is as shown in SEQ ID NO. 5.

[0016] In some specific embodiments, the nucleic acid sequence of the coding gene of the amino acid attenuator includes the sequence shown in SEQ ID NO. 1 for detecting histidine;

[0017] In other specific embodiments, (1) the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO. 1 is replaced with the leucine codon CTTCTTCTTCTT for detecting leucine;

[0018] (2) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 in the input sequence list with the codon CGTCGTCGTCGT of arginine for detecting arginine;

[0019] (3) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 with the codon ATGATGATGATG of methionine for detecting methionine;

[0020] (4) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 with the codon ATCATCATCATC of isoleucine for detecting isoleucine;

[0021] (5) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 with the codon GACGACGACGAC of aspartic acid for detecting aspartic acid;

[0022] (6) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 with the codon GAGGAGGAGGAG of glutamic acid for detecting glutamic acid;

[0023] (7) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 with the codon AATAATAATAAT of asparagine for detecting asparagine;

[0024] (8) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 with the codon TTCTTCTTCTTC of phenylalanine for detecting phenylalanine;

[0025] (9) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 with the codon GCTGCTGCTGCT of alanine for detecting alanine;

[0026] (10) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 with the codon TGGTGGTGGTGG of tryptophan for detecting tryptophan;

[0027] (11) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 with the codon CAACAACAACAA for glutamine to detect glutamine;

[0028] (12) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 with the codon TACTACTACTAC for tyrosine to detect tyrosine;

[0029] (13) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 with the codon GGGGGGGGGGGG for glycine to detect glycine;

[0030] (14) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 with the codon GTAGTAGTAGTA for valine to detect valine;

[0031] (15) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 with the codon AAGAAGAAGAAG for lysine to detect lysine;

[0032] (16) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 with the codon AGTAGTAGTAGT for serine to detect serine;

[0033] (17) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 with the codon ACTACTACTACT for threonine to detect threonine;

[0034] (18) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 with the codon CCACCACCACCA for proline to detect proline;

[0035] (19) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 with the codon TGCTGCTGCTGC for cysteine to detect cysteine.

[0036] SEQ ID No.1:

[0037] atcagttgaataaacattcacagagacttttatgacacgcgttcaatttaaacaccaccatcatcaccatcatcctgactagtctttcaggcgatgtgtgctggaagacattcagatcttccagtggtgcatgaacgcatgagaaagcccccggaagatcaccttccgggggcttttttatt

[0038] SEQ ID NO.2:

[0039] ttgacaattaatcatccggctcgtataatgtgtgg

[0040] SEQ ID NO.3:

[0041] ggacccacatactctgatgatccgagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcggatcattcatggcaagagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcttgccatgtgtatgtggg

[0042] SEQ ID NO.4:

[0043] ggacccacatactctgatgatccgagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcggatcattcatggcaagagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcttgccatgtgtatgtgggttttttttttggagcacgtacctctgatgatccgagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcggatcattcatggcaagagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcttgccatgtggtacgtgcttttttttttggagacatgccctctgatgatccgagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcggatcattcatggcaagagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcttgccatgtgggcatgtcttttttttttggaggtgcatcctctgatgatccgagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcggatcattcatggcaagagacggtcgggtccagatattcgtatctgtcgagtagagtgtgggctcttgccatgtggatgcacc

[0044] SEQ ID NO.5:

[0045] caaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaat

[0046] SEQ ID NO.6:

[0047]

[0048] The second aspect of the present application lies in providing the application of the amino acid sensor provided in the first aspect of the present application in detecting changes in amino acid concentration in vitro.

[0049] The third aspect of the present application lies in providing a kit for detecting the amino acid concentration in the environment. The kit includes the amino acid sensor provided in the first aspect of the present application.

[0050] Furthermore, the kit further includes a standard of the amino acid to be detected.

[0051] The fourth aspect of the present application lies in providing a method for detecting changes in amino acid concentration in vitro, which includes the following steps:

[0052] (1) According to the type of amino acid to be detected, construct the amino acid sensor provided in the first aspect of the present application; the amino acid sensor includes a constitutive promoter trc promoter sequence, a nucleic acid sequence of any amino acid attenuator encoding gene capable of sensing changes in amino acid concentration provided in the second aspect of the present application, a fluorescent RNA aptamer encoding gene sequence, and a terminator rrnB t1 sequence;

[0053] (2) Use the PCR method to amplify and purify the amino acid sensor transcription template in step (1);

[0054] (3) Mix the amino acid sample or standard solution to be detected with the amino acid sensor transcription template in step (2) and the ligand of the fluorescent RNA aptamer, and initiate the processes of RNA transcription and signal reporting;

[0055] (4) Use a microplate reader with fluorescence intensity kinetic measurement to measure the change in fluorescence intensity of the reaction solution.

[0056] In some specific embodiments, in step (3), components required for in vitro transcription and translation expression of Escherichia coli are further added, including RNA polymerase, ribosome, ATP, GTP, CTP, and UTP.

[0057] Furthermore, the above components can be from the cell lysate of Escherichia coli.

[0058] In some specific embodiments, the fluorescent RNA aptamer includes 3WJdB or 3WJdB-IV; the ligand of the fluorescent RNA aptamer includes DFHBI-1T.

[0059] Advantages of the invention

[0060] By precisely regulating the key base sites in the attenuator element, the present application realizes the specific recognition and detection of all 20 natural amino acids by a single sensor system, breaking through the technical bottleneck that traditional sensors need to design independent detection modules for different amino acids, and greatly reducing the system complexity and development cost.

[0061] Meanwhile, the present application innovatively uses fluorescent nucleic acid aptamers as reporter genes, effectively avoiding the interference problem that traditional fluorescent protein signals are easily regulated directly by amino acids, ensuring that the detection signal is strictly linearly correlated with the amino acid concentration, and significantly improving the accuracy and reliability of the detection results. In addition, based on the optimized design of the multi-unit tandem structure, while maintaining the specific recognition ability of the fluorescent nucleic acid aptamer, a 3- to 5-fold enhancement in the signal output intensity is achieved, breaking through the inherent defect of weak signal output of single-stranded nucleic acid aptamers, and providing key technical support for high-sensitivity detection. Therefore, by establishing an in vitro reaction system and breaking through the limitation of traditional sensors being restricted by the intracellular environment, this technology can be widely applied to diversified scenarios such as food detection, environmental detection, and biopharmaceuticals, significantly expanding the application boundary of amino acid sensors. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] Figure 1 Shows the basic schematic diagram of the present application according to the present application. On the left is the state of abundant target amino acids, with weak fluorescence signal; on the right is the state of scarce target amino acids, with strong fluorescence signal.

[0063] FIG. 2 shows the RNA secondary structure diagram of the transcription template of the amino acid sensor involved in the present application predicted by the RNAfold software. Among them Figure 2A is the secondary structure of the histidine attenuator in the state of abundant histidine concentration. The blue-marked area is the histidine sensing region, and the orange-marked area is the terminator-like region that normally forms at this time; Figure 2B is the secondary structure of the histidine attenuator when histidine is scarce. The blue-marked area is the histidine sensing region, and the orange-marked area is the terminator-like region that cannot form at this time; Figure 2C is the secondary structure of 3WJdB. The blue-marked area is the DFHBI-1T binding region; Figure 2D is the secondary structure of 3WJdB-IV.

[0064] Figure 3 Shows the comparison of the fluorescence signal intensities of 3WJdB and 3WJdB-IV according to the present application. The solid line is the signal intensity of 3WJdB-IV, and the dashed line is the signal intensity of 3WJdB. 3WJdB-IV has better signal intensity and discrimination compared to 3WJdB.

[0065] Figure 4Shows the comparison of the fluorescence signal intensities of 3WJdB-IV according to the present application in 5 mM and 0 mM histidine standard solutions. The red line is for 5 mM, and the blue line is for 0 mM. The signal intensity of 5 mM histidine is significantly lower than that of 0 mM.

[0066] Figure 5 Shows the comparison of the fluorescence signal intensities of 3WJdB-IV according to the present application in 5 mM, 4 mM, and 0 mM histidine standard solutions. The red line is for 5 mM, the green line is for 4 mM, the blue line is for 0 mM, and the gray line is after diluting the test solution by 10 times. The result shows that the signal of the test solution after being diluted by 10 times is between the standard curves of 4 mM and 5 mM and overlaps with the 5 mM signal. Therefore, it is determined that the test solution contains 50 mM histidine. Detailed implementation mode

[0067] The basic principle of the technical solution designed in the present application is as follows:

[0068] Since the amino acid regulation feedback inhibition mechanism in Escherichia coli mainly relies on the synergistic action of two mechanisms: transcriptional regulatory factors and attenuators. Among them, transcriptional regulatory factors regulate the transcriptional activity of related genes by specifically binding to specific amino acids. However, the types of transcriptional regulatory factors are limited to those existing in nature, which limits the diversity of amino acid sensors developed based on this mechanism. In contrast, the attenuator mechanism utilizes the principle of the coupling of translation and transcription in prokaryotes, providing a more flexible and extensive approach for the development of broad-spectrum amino acid sensors. During the process of RNA polymerase transcribing mRNA, ribosomes simultaneously initiate the translation of the attenuator leader peptide. The secondary structure of attenuator mRNA has multiple stem-loop structures, and the stem-loop structure at the front contains codon sequences of multiple specific amino acids. The progress of ribosome translation directly affects the change of the secondary structure of attenuator mRNA.

[0069] Specifically, when the concentration of a specific amino acid is sufficient, the translation of the attenuator leader peptide proceeds smoothly, and ribosomes stall in the stop codon region, resulting in the formation of a terminator-like structure in the last stem-loop structure of attenuator mRNA, thereby preventing RNA polymerase from transcribing the downstream amino acid synthesis genes and inhibiting the further production of this amino acid. On the contrary, when the concentration of this amino acid is scarce, ribosomes stall in the stem-loop structure region at the front, unable to form a terminator-like structure, and RNA polymerase continues to transcribe downstream genes, promoting the synthesis of amino acids. Then, by replacing the codon sequences of specific amino acids in the natural attenuator with the codon sequences of other amino acids. Through this modification, the attenuator mechanism can respond to the concentration changes of any natural amino acid, not limited to the amino acid it originally regulated.

[0070] In addition, traditional amino acid sensors usually use fluorescent proteins or enzymes involved in colorimetric reactions as reporter genes. However, the translation process of such reporter genes is susceptible to amino acid concentration, resulting in signal output deviation. To solve this problem, this application selects RNA aptamers as reporter genes, restricting signal output at the transcriptional level and effectively reducing the interference of amino acid concentration on signal output at the translational level.

[0071] Specifically, this application selects a high-affinity ribonucleotide aptamer called 3WJdB, which can bind to the fluorophore derivative DFHBI-1T with nanomolar affinity. When DFHBI-1T binds to 3WJdB, it emits green fluorescence and promotes and maintains the formation of the secondary structure of 3WJdB. To further enhance signal output, 3WJdB-IV with 4 repeats of the 3WJdB unit is designed as a reporter gene based on 3WJdB.

[0072] Since traditional amino acid biosensors mostly choose to sense amino acids in vivo, but this process is affected by many factors, such as the growth state of strains, environmental conditions, etc., which limits the application range and sensitivity of the sensors. To overcome these limitations, this application introduces a cell-free reaction system and constructs an in vitro transcription and translation platform.

[0073] Based on the design principle of the above-described attenuator mechanism, this application takes histidine as an example and realizes the specific response of the biosensor to multiple amino acids through the following invention strategies:

[0074] First, design an amino acid sensor for multiple amino acids respectively. The amino acid sensor includes a constitutive promoter, a coding gene of the Escherichia coli natural transcriptional regulatory element histidine attenuator, a coding gene of a fluorescent nucleic acid aptamer, and a terminator connected in sequence.

[0075] The amino acid sensor can encode the leader peptide of the natural histidine attenuator of Escherichia coli and the fluorescent nucleic acid aptamer 3WJdB, and has a constitutive promoter and a Rho factor-independent terminator. Specifically, the constitutive promoter is responsible for the transcription initiation of the overall sensor. Due to the principle of coupling of transcription and translation in prokaryotes, ribosomes translate the attenuator leader peptide while RNA polymerase transcribes to form mRNA. Therefore, when histidine is abundant, ribosome translation proceeds smoothly, and the end of the mRNA secondary structure of the attenuator presents a structure similar to a terminator, preventing RNA polymerase from transcribing the downstream fluorescent nucleic acid aptamer, and thus preventing the binding of the fluorescent nucleic acid aptamer and the small molecule chromophore DFHBI-1T, and no strong fluorescence signal can be detected. When histidine is scarce, ribosomes pause during the translation of the attenuator leader peptide, and the special pause position causes a change in the secondary structure of the attenuator mRNA, and a structure similar to a terminator cannot be formed. RNA polymerase continues to transcribe the downstream fluorescent nucleic acid aptamer, and then the binding of the fluorescent nucleic acid aptamer and DFHBI-1T occurs, resulting in the detection of a strong fluorescence signal.

[0076] In this application, the gene of the natural histidine attenuator of Escherichia coli is derived from Escherichia coli MG1655 (a derivative of the Escherichia coli K-12 strain).

[0077] The nucleic acid sequence of the coding gene of the natural transcriptional regulatory element histidine attenuator of Escherichia coli includes the sequence shown in SEQ ID NO.1 for detecting histidine;

[0078] When using the nucleic acid sequence of the coding gene of the natural transcriptional regulatory element histidine attenuator of Escherichia coli to detect other types of amino acids, the following changes are required:

[0079] (1) Replace CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 in the sequence listing with the leucine codon CTTCTTCTTCTT for detecting leucine

[0080] (2) Replace CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 in the sequence listing with the arginine codon CGTCGTCGTCGT for detecting arginine

[0081] (3) Replace CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 in the sequence listing with the methionine codon ATGATGATGATG for detecting methionine

[0082] (4) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown as SEQ ID NO.1 in the sequence listing with the codon ATCATCATCATC for isoleucine for the detection of isoleucine

[0083] (5) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown as SEQ ID NO.1 in the sequence listing with the codon GACGACGACGAC for aspartic acid for the detection of aspartic acid

[0084] (6) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown as SEQ ID NO.1 in the sequence listing with the codon GAGGAGGAGGAG for glutamic acid for the detection of glutamic acid

[0085] (7) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown as SEQ ID NO.1 in the sequence listing with the codon AATAATAATAAT for asparagine for the detection of asparagine

[0086] (8) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown as SEQ ID NO.1 in the sequence listing with the codon TTCTTCTTCTTC for phenylalanine for the detection of phenylalanine

[0087] (9) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown as SEQ ID NO.1 in the sequence listing with the codon GCTGCTGCTGCT for alanine for the detection of alanine

[0088] (10) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown as SEQ ID NO.1 in the sequence listing with the codon TGGTGGTGGTGG for tryptophan for the detection of tryptophan

[0089] (11) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown as SEQ ID NO.1 in the sequence listing with the codon CAACAACAACAA for glutamine for the detection of glutamine

[0090] (12) Replace the CACCATCATCAC at positions 53 to 64 of the DNA sequence shown as SEQ ID NO.1 in the sequence listing with the codon TACTACTACTAC for tyrosine for the detection of tyrosine

[0091] (13) Replace CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 in the sequence listing with the codon GGGGGGGGGG of glycine for detecting glycine

[0092] (14) Replace CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 in the sequence listing with the codon GTAGTAGTAGTA of valine for detecting valine

[0093] (15) Replace CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID No.1 in the sequence listing with the codon AAGAAGAAGAAG of lysine for detecting lysine

[0094] (16) Replace CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 in the sequence listing with the codon AGTAGTAGTAGT of serine for detecting serine

[0095] (17) Replace CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 in the sequence listing with the codon ACTACTACTACT of threonine for detecting threonine

[0096] (18) Replace CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 in the sequence listing with the codon CCACCACCACCA of proline for detecting proline

[0097] (19) Replace CACCATCATCAC at positions 53 to 64 of the DNA sequence shown in SEQ ID NO.1 in the sequence listing with the codon TGCTGCTGCTGC of cysteine for detecting cysteine.

[0098] The nucleic acid sequence of the constitutive promoter trc promoter includes the sequence shown in SEQ ID NO.2;

[0099] The fluorescent nucleic acid aptamer encoding gene includes the 3WJdB encoding gene or the 3WJdB-IV encoding gene that maintains the green fluorescence of DFHBI-1T;

[0100] The nucleic acid sequences of the 3WJdB and 3WJdB-IV encoding genes include the sequences shown in SEQ ID NO.3 and SEQ ID NO.4;

[0101] The nucleic acid sequence of the non-Rho factor-dependent terminator rrnB t1 includes the sequence shown in SEQ ID NO. 5.

[0102] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the present application will be further described in detail below through the following examples and test examples. It should be noted that the described examples are only a part of the present application, not all of it. Based on the present application, those skilled in the art can imitate it without creative labor, and all other examples obtained are within the protection scope of the present application. A series of experimental techniques and experimental methods involved and adopted in the present application, unless otherwise specifically marked or additionally explained, are default to follow the generally recognized conventional technical paths and operation specifications in the art. Specifically, various experimental operations, including but not limited to molecular biology experiments, microbial culture and identification, biochemical analysis, etc., are carried out in accordance with the standard procedures in authoritative textbooks and industry guidelines. For example, for experimental steps where specific operating conditions are not clearly marked, they are usually carried out under conventional laboratory conditions, which are detailed in classic works such as "Molecular Cloning: A Laboratory Manual (3rd Edition)" (Science Press) and "Microbiology Experiments (4th Edition)" (Higher Education Press), and can also follow the official recommended conditions provided by the manufacturers of the reagents, instruments and consumables used in the experiments. In the selection of experimental materials and reagents, unless otherwise specified in this example, all biological materials (such as strains, cell lines, etc.), chemical reagents (including but not limited to buffers, enzyme preparations, antibodies, etc.) and experimental consumables (such as culture dishes, centrifuge tubes, pipette tips, etc.) used are purchased through legal and compliant commercial channels to ensure that their quality meets the experimental requirements and industry specifications.

[0103] The primer sequences used in all the examples are shown in Table 1 below.

[0104] Table 1 Primer sequences used in all the examples

[0105]

[0106] Example 1 Construction of the transcription template

[0107] Using pTrc99a (purchased from addgene) as a template, PCR amplification was performed with primers P1 and P2. The PCR amplification product was recovered and purified by the FlaPure Gel Purification Kit DNA gel recovery kit (purchased from Beijing Jinsha Biotech Co., Ltd.). The product fragment includes the plasmid replication origin region (to ensure that the plasmid can replicate autonomously in Escherichia coli), the ampicillin resistance gene (for screening successfully transformed cells), the trc promoter (for controlling the expression of the target gene), and the rrnB t1 terminator region (for terminating the transcription process). Then, using the Escherichia coli MG1655 strain as a template, PCR amplification was performed with primers P3 and P4. The amplification product was recovered and purified by the gel recovery kit. The product fragment includes the histidine attenuator gene region, which is involved in the regulation of histidine biosynthesis in Escherichia coli and regulates the synthesis of histidine through an attenuation mechanism to adapt to the intracellular histidine concentration.

[0108] PCR reaction system:

[0109] Add each component to the PCR tube as shown in Table 2

[0110] Table 2 PCR reaction system

[0111]

[0112] PCR reaction conditions:

[0113] Pre-denaturation at 98°C for 3 min

[0114] Cycles: 98°C for 10 s → 64°C for 5 s → 72°C for elongation for 10 s → 35 cycles

[0115] Elongation at 72°C for 5 min.

[0116] Then, using the pUC-3WJdB-IV plasmid (the sequence is shown in SEQ ID NO. 6) synthesized by a commissioned gene synthesis company as a template, PCR amplification was performed with primers P5 and P6. The product was recovered and purified by the FlaPure Gel Purification Kit DNA gel recovery kit. The product includes the 3WJdB-IV gene region. The above three amplified fragments (the 3WJdB-IV gene, the pTrc99a plasmid-related fragment, and the Escherichia coli MG1655 strain-related fragment) were ligated by seamless cloning (using the complementary pairing of homologous sequences to ligate the target fragment to the linearized vector) and transformed into Escherichia coli DH5a competent cells.

[0117] Using primers P7 and P8, 2× M5 SuperFast Taq PCR MasterMix (with blue dye) (Beijing Polymer Beauty Biotechnology Co., Ltd.) was used to perform colony PCR identification on the transformed Escherichia coli colonies according to the method in the product manual, that is, the recombinant plasmid was amplified with the corresponding P7 and P8 primers to confirm whether the correct gene fragment was inserted. Then, the transcription template region was determined by sequencing, and the strain containing the plasmid with correct sequencing was expanded and cultured, and the plasmid was obtained through a plasmid miniprep kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.). Using this plasmid as a template, according to the method in the product manual of 2× Phanta Flash Master Mix (Dye Plus) (Nanjing Novoprotein Biotechnology Co., Ltd.), PCR amplification was performed with primers P7 and P8, the product was recovered and purified by a gel recovery kit, and the product concentration was calculated by a ultra-micro spectrophotometer. This product is the transcription template.

[0118] In this example, only histidine was used as an example of the target amino acid. If other target amino acids are replaced, as described in the above invention design principle section, using the constructed transcription template plasmid as a template, corresponding primers were designed, and inverse PCR was used to mutate the corresponding attenuator fragment of the transcription template, and the purification steps of this example were repeated to obtain the transcription template for other target amino acids.

[0119] Example 2 In vitro transcription and translation of the histidine transcription template, fluorescence measurement, and determination of histidine concentration

[0120] In this example, the histidine transcription template prepared in Example 1 was subjected to in vitro transcription and translation using a cell-free system in vitro reaction. The following is the working principle: The cell-free system in vitro reaction is a technique that uses active components extracted from cells (such as enzymes, ribosomes, energy metabolism systems, etc.) to simulate intracellular biochemical processes in vitro. Its core principle is to obtain a lysate rich in components required for biosynthesis, such as RNA polymerase, DNA ligase, ribosomes, etc., by lysing Escherichia coli cells and removing cell membrane fragments. To enhance the reaction ability, a reaction premix containing energy molecules such as ATP / GTP, metal ions (such as Mg²⁺, K⁺), and substrates such as amino acids and nucleotides was added as appropriate. These components together constitute a simplified "reaction environment" that can directly drive the transcription and translation of proteins in a test tube.

[0121] When adding the DNA template to be transcribed (such as plasmid or linear DNA) to the cell lysate, RNA polymerase synthesizes mRNA using DNA as a template. Subsequently, ribosomes bind to the mRNA and assemble amino acids carried by tRNAs into proteins according to the codon sequence. The energy for the whole process is provided by exogenously added molecules such as ATP and regenerated by enzymes in the lysate (such as creatine kinase) to maintain the reaction for several hours. Since the conditions such as temperature, pH, and substrate concentration can be directly optimized without the need to maintain cell viability, interference from the complex intracellular regulatory network can be avoided, thus enabling the rapid in vitro transcription and translation process.

[0122] Using a cell-free in vitro reaction system, through RNA-based aptamer fluorescence-activated structures (such as nucleic acid-based fluorescence-activated structures like 3WJdB and 3WJdB-IV) that specifically bind to the fluorescent substrate DFHBI-1T, the complex formed by the binding of 3WJdB or 3WJdB-IV to DFHBI-1T will produce fluorescence under the conditions of an excitation wavelength of 472 nm and an emission wavelength of 507 nm. Thus, the following specific experimental steps are used to characterize the histidine concentration level using the fluorescence signal intensity, establish a standard curve, and determine the histidine concentration in the sample to be measured.

[0123] First, prepare the following reagents:

[0124] 1. Dissolve the cell membrane-permeable RNA aptamer-activated fluorescent probe DFHBI-1T powder (purchased from MCE) in dimethyl sulfoxide (DMSO, Shanghai Macklin Biochemical Co., Ltd.) to a final concentration of 40 mM.

[0125] 2. Dissolve histidine powder (Shanghai Macklin Biochemical Co., Ltd.) in RNase-free ultrapure water to make a standard product with a final concentration of 100 mM. Dissolve the other amino acids except histidine that participate in the translation of the histidine attenuator leader peptide (providing the amino acids required during the translation process) in RNase-free ultrapure water to a final concentration of 50 mM.

[0126] 3. Dissolve and pre-cool on ice the transcription template prepared in Example 1, the DFHBI-1T solution, RNase A inhibitor (Nanjing Novozymes Biotech Co., Ltd.), RNase-free ultrapure water, the histidine aqueous solution, and the cell lysate in the in vitro transcription and translation kit L1030 (purchased from Promega (Beijing) Biotechnology Co., Ltd., which contains various components required for transcription and translation such as RNA polymerase and ribosomes) and the reaction premix required for in vitro transcription and translation expression of Escherichia coli (containing NTPs such as ATP, GTP, CTP, UTP, and other cofactors).

[0127] Prepare the transcription reaction system: Add each reagent to a 384-well plate with a black edge and clear bottom according to Table 3.

[0128] Table 3 Transcription reaction system

[0129]

[0130] Among them, RNase-free ultrapure water is used as a blank control, representing the histidine sample to be tested with a final concentration of 0 mM.

[0131] Draw the standard curve of histidine:

[0132] Prepare standard solutions of histidine at different concentrations (such as 0 mM, 1 mM, 2 mM, 3 mM, 4 mM, and 5 mM), record the change rate of fluorescence intensity at each histidine concentration, draw the standard curve, and the R² value of the standard curve should be ≥0.95; otherwise, recalibration is required. Make the standard curve independently for each plate.

[0133] Using a multi-channel pipette, accurately add 20 μL of the above reaction system of histidine to be tested into a 384-well plate with a black border, clear bottom, and lid produced by Greiner. Place the loaded 384-well plate in an enzyme-labeled instrument (such as the infinite 200 from TECAN) that can control the temperature and perform fluorescence kinetics measurements, and maintain the reaction temperature at 30 °C. Control the reaction time at 2 hours to allow the transcription reaction to proceed fully. Set the fluorescence intensity detection parameters as the excitation wavelength of 472 nm and the emission wavelength of 507 nm to ensure accurate detection of the fluorescence signal. Detect the fluorescence intensity from the bottom of the well plate every 3 minutes, and record the fluorescence intensity value of each sample at the end of the reaction. During the reaction, an oscillation program of the enzyme-labeled instrument can be set to ensure the uniformity of the reaction system.

[0134] Select a suitable reporter gene through fluorescence intensity detection

[0135] The results are as Figure 3 shown, Figure 3 are the experimental data of the change of fluorescence intensity over time (0 - 120 minutes), where the vertical axis represents the relative fluorescence intensity. It can be found from the figure that the black solid line as the control group remains at the lowest level, indicating that the signal intensity is very low in the absence of any reactants. Figure 3The middle dotted line represents the fluorescence intensity using 3WJdB as the reporter gene (red dotted line (1 mM amino acid to be measured) and purple dotted line (0 μM amino acid to be measured)). Due to the weak signal in the middle, it is impossible to clearly distinguish the changes in fluorescence signals caused under different concentrations of the amino acid to be measured. The purple solid line (0 μM) and the red solid line (1 mM) represent the treatment groups using 3WJdB-IV to characterize the fluorescence signal. The signal intensity at 1 mM concentration of the amino acid to be measured is significantly lower than that at 0 μM, indicating that 3WJdB-IV has better fluorescence performance than 3WJdB as a signal characterization means. Therefore, in the present invention, the 3WJdB-IV reporter gene with the function of enhancing the fluorescence signal intensity is used to monitor the changes in the transcriptional level, providing support for the stable signal output of the present invention.

[0136] Data analysis:

[0137] Import the measured data including information such as experimental conditions, sample numbers, and measured values into an Excel spreadsheet, and use the software GraphPad Prism 5.0 for data processing including removing outliers to obtain relevant information. All experiments and detections should be repeated at least three times to exclude the influence of accidental errors to ensure the reliability and repeatability of the results. Each experiment should be carried out independently to ensure the consistency of experimental conditions.

[0138] Set the method for measuring the concentration of the sample to be measured:

[0139] Compare the 3WJdB-IV fluorescence curve of the measured histidine sample with the 3WJdB-IV fluorescence curve of the histidine standard. If the fluorescence curve of the sample to be measured is lower than 5 mM, it indicates that the concentration of the sample to be measured is greater than 5 mM; at this time, dilute the sample to be measured by 10 times and repeat the experiment. If the curve falls between 4 mM and 5 mM at this time, it indicates that the concentration of the sample to be measured is 40 mM to 50 mM. If a more accurate concentration value is required, further dilute the standard solution, re-make the standard curve, and then conduct the comparison. As Figure 4 shown, Figure 4The graph shows the intensity change over time at two different histidine concentrations (0 mM and 5 mM). Similarly, the horizontal axis represents time (minutes), and the vertical axis represents fluorescence intensity. The blue dashed line and the red dashed line represent the fluorescence changes in the case of histidine standard solutions with concentrations of 0 mM and 5 mM respectively. During the 0 - 30 min of the reaction, the fluorescence intensities of both groups of histidine increased rapidly. And in the presence of 5 mM histidine, at the peak stage (about 30 minutes), the intensity of the 5 mM histidine concentration reached about 3500, while the intensity of the 0 mM histidine concentration reached about 4500. The fluorescence intensity of 5 mM histidine was significantly lower than that of 0 mM. When entering the descending stage (30 - 120 minutes), after reaching the peak, the fluorescence intensities of both groups began to decline. The decline rate of the 5 mM group was faster than that of the 0 mM group. By 120 minutes, the intensity of the 5 mM group was about 1000, while the intensity of the 0 mM group was about 1500. Therefore, the present invention controls the reaction time within 30 min.

[0140] Example 3 Histidine Concentration Determination

[0141] According to the amino acid concentration detection method established in Example 2, histidine concentration determination was carried out, and the results are as Figure 5 shown. Figure 5 It shows the change of fluorescence intensity over time at different histidine concentrations (0 mM, 4 mM, and 5 mM). Among them, the standard curves are represented by the blue dashed line, the green dashed line, and the red dashed line respectively, for comparing the fluorescence changes of the test solution.

[0142] Specifically, the blue dashed line (0 mM) has the highest fluorescence intensity when there is no histidine. The green dashed line (histidine 4 mM): As time goes by, the fluorescence intensity gradually increases, but the increasing amplitude is relatively small. The red dashed line (histidine 5 mM): The increasing amplitude of the fluorescence intensity is the smallest compared to that at 4 mM, showing a negative correlation between concentration and fluorescence intensity.

[0143] Fluorescence change of the test solution:

[0144] Among them, the test solution is a mixed liquid of 20 amino acids, which contains histidine with an unknown concentration. The gray solid line represents the fluorescence change of the test solution diluted 10 times.

[0145] The result analysis is as follows. It can be seen from Figure 5 that the fluorescence intensity change of the diluted test solution is between 4 mM and 5 mM, and is closer to 5 mM. Therefore, based on the negative correlation between fluorescence intensity and histidine concentration, since the fluorescence intensity of the test solution diluted 10 times is close to the situation of 5 mM, it can be inferred that the histidine concentration in the original test solution is approximately between 40 mM and 50 mM, and is closer to 50 mM.

[0146] The experimental results show that other amino acids in the sample to be tested have little effect on the fluorescence reaction, indicating that the proposed detection method has strong anti-interference ability. Even in the case of a mixture of multiple amino acids, the concentration of histidine can be accurately detected.

[0147] Example 4 Determination of the concentration of other amino acids

[0148] When detecting other amino acids other than histidine, the histidine attenuator in the amino acid sensor can be mutated to become the attenuator of the amino acid to be detected. Then, the detection can be carried out according to the detection method in Example 3.

[0149] In summary, by comparing the fluorescence changes of the histidine standard solutions with different concentrations and the fluorescence changes of the sample to be tested in the examples, the concentration of histidine in the sample to be tested can be accurately estimated. The experimental results also confirm the specificity and high anti-interference ability of this method for histidine detection in a multi-amino acid environment, which is of great significance for the detection of amino acid concentration in practical applications. Therefore, the amino acid sensor constructed in this application can be used as a standardized amino acid detection platform, which has the advantages of modularization, high throughput, low cost, etc., and provides a core technical solution for the development of industrial-grade amino acid detection equipment, with significant industrial promotion value.

[0150] The description of the above embodiments is intended to help those of ordinary skill in the art understand and use this application. Those familiar with the relevant technology can easily make various modifications to these embodiments and apply the general principles described to other examples without creative efforts. Therefore, this application is not limited to these embodiments, and any improvements and modifications made on the basis of what is disclosed in this application shall fall within the protection scope of this application.

Claims

1. An amino acid sensor, characterized in that, The amino acid sensor comprises a constitutive promoter, the coding gene of the histidine attenuator which is a natural transcriptional regulatory element of Escherichia coli as shown in SEQ ID NO.1, a reporter gene, and the rrnB t1 terminator as shown in SEQ ID NO.5, which are connected in sequence; The constitutive promoter is the trc promoter, and its nucleic acid sequence is as shown in SEQ ID NO.2; The reporter gene is the 3WJdB-IV coding gene as shown in SEQ ID NO.

4.

2. Use of the amino acid sensor according to claim 1 in the in vitro detection of amino acid concentration.

3. A kit for detecting the concentration of amino acids in the environment, characterized in that, The kit comprises the amino acid sensor according to claim 1.

4. The kit according to claim 3 further comprises a standard of the amino acid to be detected.

5. A method for in vitro detecting changes in amino acid concentration, characterized in that, Comprising the following steps: (1) Construct the amino acid sensor according to claim 1; The amino acid sensor comprises: the trc promoter sequence which is the constitutive promoter as described in claim 1, the coding gene of the histidine attenuator which is a natural transcriptional regulatory element of Escherichia coli, the 3WJdB-IV coding gene sequence, and the rrnBt1 terminator sequence; (2) Amplify and purify the transcription template of the amino acid sensor in step (1) by PCR method; (3) Mix the amino acid sample or standard solution to be detected with the transcription template of the amino acid sensor in step (2) and the ligand of the 3WJdB-IV coding gene sequence to initiate the RNA transcription process; (4) Use an enzyme-linked immunosorbent assay instrument with fluorescence intensity kinetic determination to measure the change in fluorescence intensity of the reaction solution.

6. The method according to claim 5, characterized in that In step (3), components required for in vitro transcription and translation expression of Escherichia coli are further added, including RNA polymerase, ribosome, ATP, GTP, CTP, and UTP.

7. The method according to claim 6, characterized in that, The components can be from the cell lysate of Escherichia coli.

8. The method according to any one of claims 5-7, characterized in that The ligand of the 3WJdB-IV coding gene sequence includes DFHBI-1T.

Images